picture
RJR-logo

About | BLOGS | Portfolio | Misc | Recommended | What's New | What's Hot

About | BLOGS | Portfolio | Misc | Recommended | What's New | What's Hot

icon

Bibliography Options Menu

icon
QUERY RUN:
21 Sep 2026 at 01:53
HITS:
9786
PAGE OPTIONS:
Hide Abstracts   |   Hide Additional Links
NOTE:
Long bibliographies are displayed in blocks of 100 citations at a time. At the end of each block there is an option to load the next block.

Bibliography on: Mitochondrial Evolution

RJR-3x

Robert J. Robbins is a biologist, an educator, a science administrator, a publisher, an information technologist, and an IT leader and manager who specializes in advancing biomedical knowledge and supporting education through the application of information technology. More About:  RJR | OUR TEAM | OUR SERVICES | THIS WEBSITE

RJR: Recommended Bibliography 21 Sep 2026 at 01:53 Created: 

Mitochondrial Evolution

The endosymbiotic hypothesis for the origin of mitochondria (and chloroplasts) suggests that mitochondria are descended from specialized bacteria (probably purple nonsulfur bacteria) that somehow survived endocytosis by another species of prokaryote or some other cell type, and became incorporated into the cytoplasm.

Created with PubMed® Query: ( mitochondria AND evolution NOT 26799652[PMID] NOT 33634751[PMID] NOT 38225003[PMID]) NOT pmcbook NOT ispreviousversion

Citations The Papers (from PubMed®)

-->

RevDate: 2026-09-18
CmpDate: 2026-09-18

Kang SW, Shin H, Kim SJ, et al (2026)

The first complete assembly and analysis of mitochondrial genome of Pinus thunbergii in Pinaceae.

BMC plant biology, 26(1):.

BACKGROUNDS: The Korean black pine (Pinus thunbergii) is a coastal conifer native to East Asia, including Korea, China, and Japan. Mitochondria and chloroplast in plants are semi-autonomous organelle that encode a small set of proteins and modulate nuclear genome expressions with retrograde signaling to coordinate stress responses and photosynthesis. Although the chloroplast genome of P. thunbergii has been previously characterized, a complete mitochondrial genome has not yet been reported, limiting genomic insights into the evolutionary dynamics of the genus Pinus.

RESULTS: We assembled the mitogenome using a hybrid sequencing approach that integrates Nanopore long reads with Illumina short reads. The mitogenome comprises two distinct chromosomes-a circular chromosome (~ 2.24 Mb) and a linear chromosome (~ 0.31 Mb)-with a total length of 2,553,981 bp (46.86% of GC), which is two times larger than mitogenome of P. taeda (1.2 Mb). These genomes encode 41 protein-coding genes (PCGs), 17 tRNA genes, and three rRNA genes. Based on these PCGs, we predicted 861 potential C-to-U RNA editing sites. Relative synonymous codon usage (RSCU) analysis identified that 30 codon values exceed 1; among these, 86.6% of codons ended with A/T bases, except UUG (Leu), UCC (Ser), ACC (Thr), and UAG (Ter). Only atp1 is exposed to purifying selection (Ka/Ks < 1). Comparative genomics revealed that 15 fragments were transferred to chromosome 1 and two fragments were transferred to chromosome 2 from the chloroplast of P. thunbergii (Accession number MW599991.31). Moreover, collinearity analysis showed that 217 fragments were similar to the mitogenome of P. taeda, which accounts for 23.92% of the P. thunbergii mitogenome. Phylogenetic analysis with 15 PCGs confirmed the taxonomic position within the family Pinaceae. Notably, rps3 showed a similar distribution to the phylogenetic tree of 30 PCGs.

CONCLUSIONS: In this study, we present the first complete mitogenome of P. thunbergii, analyze mitochondrial genomic characters, confirm horizontal gene transfer from the chloroplast genome, and reveal similarity and close phylogenetic affinity with P. taeda. This study expands the current organellar genomic resources and provides a foundation for evolutionary research in the genus Pinus. Moreover, the discovery of a multi-chromosomal architecture opens new avenues for investigating genome rearrangement and complex evolutionary dynamics across gymnosperm lineages.

RevDate: 2026-09-17
CmpDate: 2026-09-17

Tan SL, Vera-Vives AM, Wang H, et al (2026)

Essential mitochondrial activity in Physcomitrium patens relies on complementary cytochrome and alternative oxidase pathways.

The Plant journal : for cell and molecular biology, 127(5):e71127.

Mitochondrial respiration catalyses the transfer of electrons from NADH to oxygen through the activity of five multiprotein complexes. In plants, mitochondria also possess additional alternative electron transport pathways, including the alternative oxidase (AOX) pathway, which transfers electrons from ubiquinol to O2, bypassing the cytochrome-dependent electron transport chain. This study investigates the functional role of AOX during plant evolution by analysing Physcomitrium patens plants that lack or overexpress AOX. In the moss P. patens, AOX exhibits a remarkably high electron transport capacity, sufficient to fully compensate for the inactivation of the cytochrome pathway. Despite the high potential activity of AOX, aox knockout lines did not show significant defects in growth under various abiotic stresses. This suggests that the cytochrome pathway can compensate for AOX loss and effectively support the consumption of reducing power produced by photosynthesis even under stressful conditions. Although photosynthetically active cells can produce ATP in chloroplasts under illumination independently of mitochondrial electron transport, respiration is shown to be essential for the conversion of reducing power into ATP for distribution throughout the cell. Simultaneous inactivation of AOX and CIII was lethal, indicating that AOX and the complementary cytochrome pathway contribute to the essential role of mitochondrial respiration in the redox and energy balance in P. patens cells.

RevDate: 2026-09-17

Miller E, Bambakidis P, Templin P, et al (2025)

Emerging roles of the ciliary-mitochondrial axis in cellular homeostasis and neuroprotection.

Molecular neurodegeneration advances, 1(1):5.

Primary cilia and mitochondria, long studied as separate cellular players, are now recognized as a tightly coupled signaling and metabolic hub whose interplay powerfully shapes cell fate. The bidirectional ciliary-mitochondrial axis integrates extracellular sensing, calcium dynamics, bioenergetics, and organelle quality control to drive adaptive responses to stress and sustain neuronal resilience. Recent studies reveal compelling associations that merit further investigation, such as the impact of primary cilium-initiated signaling cascades on mitochondrial dynamics and mitophagy, and the effects on cilia of shifting mitochondrial metabolic states. Dysfunction at any node in this axis has potential to trigger neurodegeneration. Framing primary cilia and mitochondria as a coordinated physiologic axis enables reconsideration of neurodegeneration and reveals novel, tractable entry points for therapeutic restoration of brain homeostasis. This review traces the field's evolution, synthesizes key molecular mechanisms, and highlights exciting translational opportunities to harness the ciliary-mitochondrial axis for neuroprotection.

RevDate: 2026-09-15
CmpDate: 2026-09-15

Morabito F, Martino EA, Bruzzese A, et al (2026)

Mitochondrial Fitness as a Functional Immune Checkpoint in Cancer: Metabolic Plasticity, Tumor Evolution, and Immunotherapy.

Cancers, 18(17):.

Mitochondria are increasingly recognized as dynamic regulators of cancer-cell adaptation, immune function, and therapeutic response. Beyond their canonical role in energy production, mitochondrial metabolism, dynamics, quality control, and stress signaling influence tumor-cell survival and the capacity of immune effector cells to sustain antitumor activity within the tumor microenvironment. In this narrative review, we examine mitochondrial fitness as a multidimensional functional property encompassing bioenergetic capacity, metabolic flexibility, redox homeostasis, mitochondrial quality control, and adaptation to cellular and therapeutic stress. We propose the mitochondrial functional immune checkpoint as a conceptual framework linking mitochondrial fitness in malignant and immune cells to tumor-immune interactions and immunotherapy response. We discuss how mitochondrial metabolic plasticity, mitochondrial stress and mtDNA signaling, reactive oxygen species, mitochondrial dynamics, and intercellular mitochondrial transfer contribute to immune escape and treatment resistance. We further examine the relevance of mitochondrial fitness to immune checkpoint blockade, CAR-T-cell therapy, and T-cell-redirecting bispecific antibodies, with particular attention to hematological malignancies, including acute myeloid leukemia and multiple myeloma, while incorporating selected evidence from solid tumors to highlight shared mitochondrial mechanisms and their broader oncologic relevance. Finally, we discuss emerging strategies for mitochondrial targeting and functional mitochondrial profiling and their potential integration with established molecular and measurable residual disease assessments. Current evidence supports mitochondrial biology as a complementary dimension of precision oncology, although important challenges remain regarding context dependence, biomarker standardization, therapeutic selectivity, and preservation of immune-cell fitness. Prospective studies are needed to determine whether functional mitochondrial profiling can improve patient stratification and guide rational therapeutic combinations that selectively exploit tumor mitochondrial vulnerabilities while preserving effective antitumor immunity.

RevDate: 2026-09-14

Chakraborty A, Rodríguez E, Bettinazzi S, et al (2026)

Mitochondrial genetic effects mediate the response to stress through development, but not adult metabolic rate in Drosophila.

The Journal of experimental biology pii:372879 [Epub ahead of print].

Energy expenditure is fundamental to physiology, behaviour, ecology, and life history, yet the mechanisms that regulate metabolic rate remain poorly understood. At the cellular level, incompatibilities between the maternally inherited mitochondrial genome and the nuclear genome can impair energy production, signalling and gene expression, with potential to disrupt a wide range of physiological processes. However, how these often-subtle genomic mismatches influence whole-organism traits such as metabolic rate, activity, and fitness remains unclear. Here, we generated mitonuclear-mismatched fly lines to test how early-life dietary and metabolic stress affect larval and adult physiology. Our results revealed sex and line-specific physiological effects, with larval development, survival and female fertility strongly contingent on the haplotypes and treatment, while adult resting metabolic rate and activity were not influenced by mitochondrial haplotype, nor by developmental stress.

RevDate: 2026-09-14

Brittain KS, Delfino LM, Thiemann OH, et al (2026)

The organization and dynamics of viral factories.

Journal of virology [Epub ahead of print].

Viral factories (VFs) are dynamic, virus-induced microcompartments that serve as centralized hubs in the host cell for viral genome replication, transcription, and virion assembly. These structures employ unique viral mechanisms for remodeling cellular architecture to create specialized replication organelles and improve the efficiency of viral propagation. VFs exhibit striking structural and functional diversity among RNA and DNA viruses, from reoviruses and poxviruses to the Nucleocytoviricota phylum. Some are enclosed by host-derived membranes, while others exist as biomolecular condensates from liquid-liquid phase separation. VFs recruit host lipids, cytoskeletal elements, and metabolic enzymes, effectively reprogramming the intracellular environment to favor viral replication. This review provides a comprehensive examination of the molecular composition, ultrastructure, and biogenesis of viral factories across a wide range of viral lineages and host systems. We describe membrane-bound and phase-separated VFs and the mechanisms by which they hijack host machinery to create these replication organelles and explore viral strategies to shield replication intermediates from host immune responses. Additional emphasis is placed on the complex VFs formed by giant viruses in the Nucleocytoviricota, whose ability to spatially compartmentalize replication and transcription, exclude ribosomes, and recruit host mitochondria and membranes blurs the line between viral and cellular organization. By integrating findings from cell biology and evolutionary virology, this review proposes that viral factories offer a conceptual framework for understanding virus-host coevolution and provides new insights into how their organization may have shaped the emergence of eukaryotic complexity.

RevDate: 2026-09-14

Hancks DC, SF Baker (2026)

The factory enters the fray: how mitochondrial protein trafficking shapes the host response to infection.

Journal of virology [Epub ahead of print].

Beyond textbook functions in homeostatic metabolism, mitochondria are now recognized as central coordinators of cell-intrinsic and cell-extrinsic immune responses to infection. Directed trafficking of proteins and other molecules between mitochondria and the rest of the cell underlies a growing catalog of these activities. Some are pro-host; others are antagonized by viral effectors or co-opted by viruses entirely. How host and viral factors rewire the mitochondrial proteome during infection to shape these outcomes remains incompletely understood. The evolutionary history of this system adds another dimension: mitochondria retain biochemical signatures of their α-proteobacterial endosymbiotic origin, and ongoing co-evolution between viral, host, and mitochondrial genomes continues to shape the proteins that traffic to and from the organelle. Using published examples, we highlight general principles, mechanisms, and consequences of host and viral protein localization to and from the mitochondria. To support discovery, we present integrated gene lists identifying host mitochondrial factors with evidence for type I interferon stimulation, interactions with viral proteins, and signatures of positive selection. Together, these resources and the principles within offer a framework for understanding mitochondria not as passive metabolic machinery but as actively contested cellular territory whose protein composition is continuously negotiated between the host and the pathogen.

RevDate: 2026-09-12
CmpDate: 2026-09-12

Yu J, Xu M, Wu XR, et al (2026)

Convergent mitochondrial impairment and apoptosis driven by simultaneous down-regulation of multiple genes at 11p11.2 in Alzheimer's disease.

Molecular psychiatry, 31(10):5862-5878.

Genome-wide association studies (GWAS) and multi-omics analyses have identified numerous risk loci and thousands of potential causal genes associated with Alzheimer's disease (AD). However, the synergistic pathogenic contributions of multiple low-risk causal genes within a single locus remain poorly understood. Polygenic synergism at the 11p11.2 locus was systematically examined in AD pathogenesis. Three causal genes (MTCH2, NDUFS3, and PSMC3) exhibited coordinated down-regulation in both AD patients and AD mouse models. Individual knockdown in cultured cells altered mitochondrial function and disrupted AD-associated pathways, as revealed by transcriptomic profiling. Integrated RNA-seq analysis and experimental validation demonstrated that the concurrent down-regulation of all three genes synergistically enhanced mitochondrial reactive oxygen species (ROS) generation and activated the caspase-7-mediated apoptotic pathway. Notably, pharmacological caspase inhibition with Q-VD-OPh attenuated neuronal apoptosis, ameliorated memory deficits, and reduced Aβ plaque deposition in APP/PS1 mice. Simultaneous down-regulation of multiple genes at the 11p11.2 locus contributed to mitochondrial dysfunction and apoptosis in AD, highlighting polygenic synergism as a key pathogenic mechanism.

RevDate: 2026-09-10
CmpDate: 2026-09-10

Fang R, Tian X, Liang D, et al (2026)

Disruption of mitonuclear coadaptation and compensatory evolution after an extreme dietary shift in carnivorous butterflies.

Molecular biology and evolution, 43(9):.

Mitochondrial function depends on tight coordination between mitochondrial and nuclear genomes, which requires long-term coevolution to maintain mitonuclear coadaptation. While mitonuclear incompatibility is typically studied in the context of hybridization, other evolutionary scenarios that may disrupt coadaptation between the two genomes remain less explored. Here, we propose that extreme ecological niche shifts may disrupt mitonuclear coadaptation, which we test in carnivorous Miletinae butterflies with an extreme dietary transition. By generating high-quality genome assemblies, we found that Miletinae exhibit extensive chromosomal rearrangements. Comparative phylogenomic analyses revealed a striking asymmetric mitonuclear evolutionary response: Miletinae exhibit elevated mitochondrial nucleotide substitution rates compared to phytophagous relatives, whereas nuclear rates remain stable. This shift reverses the typical lepidopteran pattern where nuclear rates exceed mitochondrial rates. Interestingly, this mitochondrial acceleration is driven primarily by relaxed purifying selection rather than positive selection. To sustain mitochondrial function, the nuclear genome of Miletinae underwent pervasive, multilayered compensatory evolution. We detected strong signatures of positive selection and accelerated evolution in nuclear genes directly interacting with mitochondrial components across oxidative phosphorylation (OXPHOS) complexes, the mitochondrial translation, and replication and transcription machinery. Furthermore, this nuclear compensatory response extends to systems governing mitochondrial homeostasis, including protein quality control and RNA degradation and stabilization. Our results support a model in which extreme ecological transitions can disrupt ancestral mitonuclear coadaptation and promote the emergence of a new coadapted state through systemic nuclear compensation. This study broadens the conceptual framework of mitonuclear coevolution and highlights its role in facilitating evolutionary persistence after major ecological shifts.

RevDate: 2026-09-09
CmpDate: 2026-09-09

Wang S, Meng C, Bian H, et al (2026)

Global Research Landscape of Mitochondrial Dysfunction in Sepsis: A Comprehensive Bibliometric and Visualization Analysis (2000-2025).

Journal of inflammation research, 19:636359.

OBJECTIVE: Sepsis-associated mitochondrial dysfunction represents a central but incompletely understood mechanism underlying organ failure and mortality in critically ill patients. Despite a growing body of literature, no comprehensive bibliometric analysis has systematically mapped the global research landscape, knowledge structure, and emerging frontiers of this field. This study aimed to quantify publication trends, identify key contributors, delineate thematic hotspots, and characterize the evolving knowledge base in sepsis and mitochondria research over the past 25 years.

METHODS: A systematic search of the Web of Science Core Collection was conducted using a predefined search strategy combining sepsis- and mitochondria-related terms, restricted to publications from January 1, 2000, to December 31, 2025. After sequential exclusion of retracted publications, non-article/review document types, and non-English records, a final dataset of 3545 publications was obtained. Bibliometric analyses were performed using the bibliometrix package in R, VOSviewer (version 1.6.20), and CiteSpace (version 6.2.R4). Analyses included annual publication trends, geographic and institutional distribution, Bradford's Law journal analysis, Lotka's Law author productivity, co-citation and bibliographic coupling network analysis, thematic mapping, and keyword burst detection.

RESULTS: Annual publication output increased more than nine-fold from 2000 to 2025, with a marked acceleration following the 2016 Sepsis-3 consensus definition. China led in publication volume (n = 1350; 38.1%), while the United States demonstrated the highest citation impact (52,732 total citations; 67.61 average citations per publication). Bradford's Law analysis identified 30 core journals, led by Shock, Frontiers in Immunology, and Critical Care Medicine. Lotka's Law analysis confirmed that 74.94% of contributing authors published a single article. The most cited publication was Zhang Q et al (Nature, 2010; 3080 citations). Thematic map analysis identified mitochondrial dysfunction/acute kidney injury, oxidative stress/reactive oxygen species, and inflammation/mitochondrial DNA as Motor Themes. Keyword burst analysis revealed a temporal evolution from early nitric oxide and cytochrome c research toward current hotspots including NLRP3 inflammasome activation, sepsis-associated encephalopathy, and sepsis-induced cardiomyopathy.

CONCLUSION: This comprehensive bibliometric analysis provides a systematic overview of 25 years of research at the intersection of sepsis and mitochondrial biology. The field is experiencing sustained growth, with current research frontiers focused on organ-specific mitochondrial injury, innate immune regulation, and neurological complications.

RevDate: 2026-09-07

Fang Y, Ren Z, Zheng F, et al (2026)

Directed evolution of Lantern enables rapid RNA and protein proximity labeling.

Nature chemical biology [Epub ahead of print].

In eukaryotic cells, the precise spatial localization of RNAs and proteins is essential for proper cellular function. Genetically encoded photocatalytic proximity labeling techniques have expanded our ability to map subcellular proteomes and transcriptomes, but their temporal resolution remains limited. Here we introduce Lantern, an engineered flavoprotein optimized via directed evolution, which enables sub‑minute, spatially resolved labeling of cellular biomolecules. Lantern is targetable to diverse subcellular compartments, including the endoplasmic reticulum (ER), mitochondria and stress granules (SGs), to map local transcriptomes (CAP-seq) and proteomes (CAP-MS). Using Lantern, we observed that N[6]-methyladenosine-rich RNAs are recruited to SGs within 10 minutes of stress induction, and ER‑proximal RNAs associate with G3BP1 during early SG assembly. Additionally, Lantern was adapted for cell surface tagging (CAP-CELL), enabling spatially resolved cell typing and identifying cell-cell interactions. Collectively, this study establishes Lantern as a powerful tool that offers unprecedented temporal resolution for investigating the dynamic organization of subcellular molecular networks.

RevDate: 2026-09-07
CmpDate: 2026-09-07

Siriyasatien P, Intayot P, Boonserm R, et al (2026)

A descriptive assessment of mitochondrial COI genetic diversity and dengue and chikungunya RNA detection in Aedes aegypti across eight provinces in Thailand.

Parasites & vectors, 19(1):.

BACKGROUND: Aedes aegypti is the principal vector of several medically important arboviruses, including dengue virus (DENV) and chikungunya virus (CHIKV), both of which remain endemic in Thailand. However, studies on arbovirus surveillance and mitochondrial genetic diversity of Ae. aegypti populations across broad geographic scales remain limited. This study aimed to assess the detection of DENV and CHIKV and characterize the mitochondrial genetic diversity of Ae. aegypti across multiple regions of Thailand.

METHODS: A total of 303 adult Ae. aegypti mosquitoes collected from eight provinces across five geographic regions of Thailand were screened for DENV and CHIKV RNA. Mitochondrial cytochrome c oxidase subunit I (COI) genetic diversity was assessed using haplotype network analysis and analysis of molecular variance (AMOVA).

RESULTS: CHIKV RNA was detected in 51 mosquitoes (16.8%) from four provinces, with the highest detection rates observed in Prachuap Khiri Khan and Bangkok. DENV RNA was not detected in any sample. COI analysis revealed moderate to high mitochondrial haplotype diversity and geographic variation in haplotype distribution among populations. Both widely shared and province-specific haplotypes were identified. AMOVA indicated that most genetic variation occurred within populations (93.19%), with significant genetic differentiation among populations (ΦST = 0.068, P < 0.001).

CONCLUSIONS: CHIKV RNA was detected in Ae. aegypti populations from multiple regions of Thailand, whereas DENV RNA was not detected. Mitochondrial COI analysis revealed substantial haplotype diversity and geographic variation among populations. These findings contribute to current knowledge of arbovirus occurrence and mosquito genetic diversity in Thailand and provide a foundation for future vector surveillance studies.

RevDate: 2026-09-07
CmpDate: 2026-09-07

Huang Y, Du J, Zeng X, et al (2026)

Role of the steroid hormone synthesis pathway-related gene StAR-like in gonadal development of mud crab (Scylla paramamosain).

Comparative biochemistry and physiology. Part A, Molecular & integrative physiology, 320:112064.

In vertebrates, the canonical steroidogenic acute regulatory (StAR) proteins, which lack N-terminal MENTAL domains, transport cholesterol into mitochondria to initiate steroidogenesis. However, whether a vertebrate-like steroidogenic pathway exists in crustaceans remains controversial. In this study, the complete ORF of SpStAR-like was identified from the transcriptome data of the mud crab Scylla paramamosain and subsequently cloned from testicular cDNA. Bioinformatic analysis showed that the SpStAR-like protein, consistent with other crustacean StAR-like homologs, contains an extra N-terminal MENTAL domain and exhibits higher structural homology with StAR-related lipid transfer proteins (StARLTPs) than with canonical vertebrate StAR proteins. qRT-PCR analysis revealed ubiquitous SpStAR-like expression across all mud crab tissues, with transcript levels in testes significantly higher than those in ovaries and other tissues. The gene was expressed throughout gonadal development in both sexes, peaking at testicular stage T2 and ovarian stage O3, respectively. Functional investigations were performed via RNA interference as well as in vitro and in vivo cholesterol supplementation assays. SpStAR-like knockdown significantly repressed the transcription of steroidogenic genes (Hsd3b, Hsd17b, PGMRC1, ERR, GPCR89) and gonadal development-related genes (IAG, vtg, vtgR, CYP3A24, foxl-2). Exogenous cholesterol treatment elevated ovarian pregnenolone concentrations, as determined by ELISA, and up-regulated all aforementioned target genes. In vivo cholesterol injection increased hemolymph pregnenolone levels and promoted ovarian morphological maturation. This study provides preliminary molecular evidence for steroidogenic regulatory cascades in mud crabs and advances our understanding of crustacean reproductive endocrinology.

RevDate: 2026-09-07
CmpDate: 2026-09-07

Boisard J, Williams SK, Roger AJ, et al (2026)

CoMR: an integrative scoring pipeline for comprehensive mitochondrial proteome reconstruction across eukaryotes.

Briefings in bioinformatics, 27(5):.

Mitochondrial proteome reconstruction from eukaryotic sequence data typically relies on prediction of mitochondrial targeting signals (MTSs). However, MTS predictors are primarily trained on model organisms and may perform poorly in phylogenetically divergent lineages or in organisms with atypical or reduced targeting sequences. Accurate reconstruction therefore requires integration of complementary sources of evidence beyond targeting prediction alone. We developed Comprehensive Mitochondrial Reconstructor (CoMR), an integrative workflow that combines targeting prediction, curated homology searches, large-scale similarity searches, and automated phylogenetic analysis within a unified scoring framework. Benchmarking on the model yeast Saccharomyces cerevisiae yielded strong discriminatory performance [receiver operating characteristic (ROC)-area under the curve (AUC) = 0.92], exceeding standalone prediction with TargetP2, a predictor of N-terminal targeting peptides (ROC-AUC = 0.72). In the divergent anaerobic protist Paratrimastix pyriformis, CoMR maintained robust performance (ROC-AUC = 0.86) validated with an experimental proteome despite extreme class imbalance, achieving a precision-recall AUC of 0.183 (~78-fold enrichment over random expectation and ~10-fold improvement over TargetP2). Ablation analyses demonstrate that predictive performance is robust to individual evidence-layer removal, while overlap analyses showed that homology-based searches recovered candidates missed by targeting predictors, particularly in P. pyriformis. Overall, CoMR improves mitochondrial proteome reconstruction over targeting prediction alone and provides a reproducible workflow for predicting mitochondrial and mitochondrion-related organelle protein repertoires across eukaryotes to aid investigations of organelle evolution and proteome reduction.

RevDate: 2026-09-05

Cartalemi AA, Rosano D, Ferrari C, et al (2026)

KDM6A loss enhances oxidative phosphorylation uncovering tissue-level convergent evolution.

The EMBO journal [Epub ahead of print].

The tumor suppressor KDM6A/UTX, a histone demethylase and a 2-oxoglutarate-dependent dioxygenase, is frequently lost in many cancer types. We show that KDM6A loss pervasively activates oxidative phosphorylation in several solid tumors, generating a pseudo-hyperoxic environment, opposite from the pseudo-hypoxia observed in VHL-mutated renal carcinomas. Mechanistically, KDM6A sustains the expression of the coil-coil domain gene CCDC3, which inhibits CREB1-driven transcription of the mitochondrial regulator PPARGC1A. In the hematological cancer multiple myeloma where KDM6A is frequently deleted, its loss similarly promotes oxidative phosphorylation, but via an alternative mechanism: the increased transfer of mitochondria from stromal to myeloma cells via tunneling nanotubes, triggered by the loss of the mTORC1 inhibitor TRAF3IP3. Beyond cancer, KDM6A regulates oxidative phosphorylation also during development and in adult tissues, engaging either the CCDC3-CREB1 or the TRAF3IP3-mTORC1 pathways. These mutually exclusive associations suggest a tissue-level convergent evolution, positioning KDM6A as a central modulator of mitochondrial activity through context-specific partners.

RevDate: 2026-09-03

Kannangara JR, Connallon T, Alves AN, et al (2026)

Dissecting contributions of directional and balancing selection to trajectories of mitochondrial haplotype evolution in Drosophila melanogaster.

Evolution; international journal of organic evolution pii:8781089 [Epub ahead of print].

Emerging evidence suggests mtDNA haplotypes contribute to fitness variation and local adaptation, with directional thermal selection and negative frequency-dependent selection shaping haplotype diversity. However, their interplay remains unexplored. We conducted experimental evolution using Drosophila melanogaster populations from opposite ends of an Australian latitudinal cline (Melbourne and Townsville), exposing them to contrasting temperatures (17°C versus 27°C) and varying starting frequencies of two mtDNA haplotypes (A1 and B1) that occur at appreciable frequencies in these populations. We paired this with population genetic simulations to estimate selection and its influence on haplotype trajectories. Haplotype frequencies were influenced by interactions involving temperature, starting frequency, and nuclear genomic background (Melbourne, Townsville, or admixed). Although prior work predicted A1 should be favoured at the warmer temperature and B1 at the cooler temperature, A1 was generally favoured across both temperatures. Simulations supported directional selection in populations evolving at 17°C in the Melbourne background; otherwise dynamics were best explained by balancing selection shaped by negative frequency-dependent fitness effects. Patterns also varied across nuclear backgrounds, suggestive of mito-nuclear epistasis. These findings challenge a simple thermal adaptation model of mtDNA dynamics, suggesting that mtDNA evolution is shaped by interacting effects of temperature, frequency-dependence, nuclear background and experimental environment.

RevDate: 2026-09-02
CmpDate: 2026-09-02

Krishnan N, Zachar I, Kun Á, et al (2026)

Host-initiated microbial association leads to stable ectosymbiosis in an ecological model.

PLoS computational biology, 22(9):e1014699 pii:PCOMPBIOL-D-25-01620.

Microbial symbiosis is widespread among metabolically coupled cells; it presumably gave rise to mitochondria. However, how such symbioses emerge, evolve, and stabilize are unknown, particularly in the prokaryotic domain where endosymbiosis is virtually nonexistent. Yet there is growing evidence suggesting that mitochondria originated from such a metabolically driven prokaryotic partnership rather than phagocytotic predation. While prokaryotes almost ubiquitously engage in metabolic syntrophy, it is unknown whether syntrophy alone can enable stable physical associations that could pave the road toward physical integration. Here, we tested the hypothesis that syntrophy can transition into stable ectosymbiosis, using an ecological mathematical model. Starting from an existing syntrophic partnership between free-living hosts and symbionts, we demonstrate that population-level obligate ectosymbiosis can emerge and stabilize, even in unilateral syntrophy where only the symbiont consumes a host-produced metabolite. A key assumption is that the hosts' by-product inhibits their growth when it accumulates. By consuming the toxic by-product, the symbiont locally reduces hosts' self-inhibition at the contact surface, manifesting as a private benefit providing selective advantage. Our results show that due to the direct and indirect benefits, the ectosymbiotic consortium is stable against free-living forms and the consortial cooperation is ecologically selected for. Furthermore, solid metabolic coupling promotes population-level obligacy, ultimately excluding free-living individuals under stricter conditions. Our results support the hypothesis that cooperative, syntrophic microbes (particularly prokaryotes) are capable of forming stable, physical, and species-specific ectosymbiosis through inhibition reduction, providing a plausible first step toward potential, gradual endosymbiotic integration. Our work bridges the gap between models of microbial cooperation between free-living species and models that assume already-concluded, fully integrated endosymbiosis under multilevel selection.

RevDate: 2026-09-01
CmpDate: 2026-09-01

Cao Z, Liu Z, Zhang J, et al (2026)

Functional characterization of Bcl-2-related ovarian killer (Bok) in apoptosis and antibacterial immunity in Trachinotus ovatus.

Fish & shellfish immunology, 178:111678.

Bok (Bcl-2-related ovarian killer) is a pro-apoptotic member of the Bcl-2 family that plays a critical role in the intrinsic apoptotic pathway in mammals. However, its functional characterization in teleost fish remains largely unexplored. In this study, we identified and characterized TroBok, a Bok ortholog from golden pompano (Trachinotus ovatus), and investigated its role in apoptosis and antibacterial immunity. The full-length coding sequence of TroBok is 642 bp, encoding a protein of 213 amino acids containing four conserved BH domains (BH1-BH4). TroBok was ubiquitously expressed in all tissues examined, with the highest abundance in the head kidney, and was significantly upregulated upon Vibrio harveyi challenge. Subcellular localization revealed that TroBok is predominantly distributed in the cytoplasm. Functional analysis in golden pompano snout (GPS) cells stimulated with rFla B, the flagellin protein of V. harveyi, demonstrated that TroBok overexpression significantly increased apoptosis, promoted mitochondrial membrane potential (MMP) loss, induced DNA fragmentation, and enhanced Caspase-9 and Caspase-3 activities, whereas TroBok knockdown produced opposite effects. Furthermore, TroBok overexpression upregulated pro-apoptotic genes (p53, cytochrome c, Caspase-3, Caspase-7, and Caspase-9) and downregulated the anti-apoptotic Bcl-2, indicating that TroBok activates the intrinsic mitochondrial apoptotic pathway. In vivo, TroBok overexpression significantly reduced V. harveyi burdens in the liver, spleen, and head kidney, whereas TroBok silencing markedly increased bacterial loads. Mechanistically, TroBok promoted apoptosis of head kidney macrophages and elevated Caspase-9 and Caspase-3 activities in head kidney tissues, indicating that the antibacterial effect of TroBok may be associated with its pro-apoptotic function. Our results indicate that TroBok exerts a conserved pro-apoptotic function via the mitochondrial pathway and contributes to antibacterial immunity in golden pompano, providing new insights into the role of BOK family proteins in teleost host defense.

RevDate: 2026-09-01

Montoliu-Nerin M, Strunov A, Heyworth E, et al (2026)

Evolutionary persistence of a highly prevalent multicopy mitochondrial-derived nuclear insertion (Mega-NUMT) in Neotropical Drosophila flies.

Molecular biology and evolution pii:8778761 [Epub ahead of print].

Although strict maternal transmission of mitochondria is a general feature of animals for ensuring homogeneity in mitochondrial DNA (mtDNA) across generations, exceptions were reported in the recent past. For example, some extremely rare but spectacular cases of heteroplasmy and paternal transmission in humans have questioned the universal evolutionary principle. Hence, as an alternative, the Mega-NUMT concept was coined to explain this discovery and was thereafter partly proven to exist. This concept expands on the quite common transfer of mtDNA fragments to the nucleus (NUMTs) by considering the existence of multicopy mitochondrial nuclear insertions. Mega-NUMT reports are currently restricted to a few cases in animals, including humans. However, their detailed genomic organization, natural prevalence, and potential biological functions remain unclear. Here, we discovered that up to 60 full-sized mitochondrial genomes are integrated into the nuclear genome of the neotropical Drosophila paulistorum using long-read sequencing and in situ hybridization. The copies are organized in one cluster on chromosome 3, which we designated the "Dpau Mega-NUMT". Contrary to the rarity in humans, this Mega-NUMT is found at high prevalence (40%) in both laboratory lines and natural D. paulistorum populations of different semispecies. Additionally, the Mega-NUMT copies are phylogenetically separated from the current mitotypes of D. paulistorum. Together, these observations suggest long-term maintenance of the Mega-NUMT in nature. Hence, we propose that the Dpau Mega-NUMT may have been transferred to the nuclear genome before the D. paulistorum semispecies radiation and speculate based on these findings that it possibly is maintained at relatively high prevalence in nature by balancing selection or due to a yet undetermined function.

RevDate: 2026-08-31

Yu X, Wang Y, Ju X, et al (2026)

HOXC9 promotes cell proliferation and suppresses mitochondria-dependent apoptosis through the AKT/mTOR pathway in esophageal squamous cell carcinoma.

Molecular and cellular biochemistry [Epub ahead of print].

Homeobox C9 (HOXC9) is aberrantly expressed in multiple malignancies; however, its functional role in esophageal squamous cell carcinoma (ESCC) remains elusive. This study investigated the expression, function, and underlying molecular mechanisms of HOXC9 in ESCC. HOXC9 was evaluated via immunohistochemistry in 118 ESCC and paired normal tissues. Stable cell lines with HOXC9 knockout, knockdown, and overexpression were established in KYSE70 and KYSE150 cells. Cell proliferation, apoptosis, mitochondrial membrane potential, and in vivo xenograft growth were assessed. Mechanistic studies were performed using RNA-seq, Western blotting, and PI3K inhibitor LY294002 (30 µM). IHC analysis revealed significantly elevated HOXC9 expression in ESCC versus paired adjacent normal tissues (high expression rate: 57.6% vs. 22.9%, P < 0.0001) and associated with poorer overall survival. Receiver operating characteristic (ROC) curve analysis showed favorable diagnostic value for HOXC9 (area under the curve [AUC] = 0.97). Functional assays showed that HOXC9 promoted ESCC cell proliferation and inhibited mitochondria-dependent apoptosis. Mechanistically, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment and Western blot analyses indicated that HOXC9 is associated with activation of the protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathway. Pharmacological blockade and xenograft experiment further supported the involvement of this pathway in HOXC9-driven oncogenic phenotypes. This study identifies a potential mechanism by which HOXC9 contributes to ESCC progression via AKT/mTOR-mediated inhibition of mitochondria-dependent apoptosis and promotion of cell proliferation. These findings suggest HOXC9 as a candidate prognostic biomarker and preliminary therapeutic target for ESCC, requiring further validation across clinical and molecular subtypes.

RevDate: 2026-08-31
CmpDate: 2026-08-31

Zhang Z, Zhang L, An P, et al (2026)

Single-cell profiling of mitochondrial phenotyping-coupled mtDNA genotyping.

Proceedings of the National Academy of Sciences of the United States of America, 123(36):e2531151123.

Simultaneously profiling mitochondrial DNA (mtDNA) heteroplasmy and phenotypic variability at the single-cell level remains a challenge due to the absence of integrated methods that map mitochondrial genotypes alongside their functional states. We introduce human single-cell mitochondrial phenotype-coupled mtDNA sequencing (scMPCDS), a platform that quantifies mtDNA mutations and heteroplasmy together with mitochondrial membrane potential and reactive oxygen species within individual cells. Unlike bulk sequencing or separate single-omics techniques, scMPCDS directly correlates mitochondrial genomic instability with functional outcomes. Using this approach, we demonstrate that DdCBE-mediated mtDNA editing induces cell-specific off-target mutations in the mitochondrial genome, which coincide with diverse phenotypic changes. Applying scMPCDS to HeLa cells and clear cell renal cell carcinoma tissues, we identify single-cell subpopulations exhibiting distinct mtDNA mutation burdens and altered bioenergetic profiles, implicating potential mitochondrial heterogeneity-driven tumor evolution. Overall, scMPCDS serves as a versatile tool to unravel mitochondrial genotype-phenotype relationships at the single-cell level in both normal and disease states, thereby advancing precise mitochondrial diagnostics and therapeutics.

RevDate: 2026-08-29

Li J, Zhu C, Chai G, et al (2026)

Progressive evolutionary trajectories of mitochondrion-related organelles in anaerobic ciliates (Eukaryota, Alveolata) revealed by APM ciliates and a facultatively anaerobic spirotrichean species.

Molecular phylogenetics and evolution pii:S1055-7903(26)00191-0 [Epub ahead of print].

Ciliates are an excellent model for studying convergent transitions from mitochondria to mitochondrion-related organelles (MROs) in protists. Despite our growing knowledge of adaptive evolution in ciliate MROs, the progressive evolutionary trajectories within anaerobic ciliate lineages and the MRO metabolisms of facultatively anaerobic ciliates remain unexplored. In this study, we predicted MRO metabolisms of eight species within the anaerobic monophyletic APM (Armophorea-Muranotrichea-Parablepharismea) clade and a facultative anaerobe from its sister class Spirotrichea. Our main results are as follows: (1) During their adaptation to anaerobic environments, the MRO electron transfer chain (ETC) components and their associated functions have been progressively lost in the APM clade. (2) The MRO of the last common ancestor of Armophorea likely possesses complexes Ⅰ, Ⅱ, and Ⅴ, but lacks functional complexes Ⅲ and Ⅳ. Subsequently, during their adaptation to anaerobic environments, the armophorean lineage has further lost complex Ⅴ in the order Clevelandellida and Metopida. (3) In the MRO of the facultatively anaerobic ciliate Heterodeviata sinica, complexes Ⅲ and Ⅳ are absent, and alternative oxidases (AOX) play a key role in adaptation to fluctuating dissolved oxygen levels. (4) The fused [FeFe]-hydrogenase appears to have been acquired by the last common ancestor of ciliates through horizontal gene transfer (HGT), followed by multiple independent losses. Our results provide insights into the progressive adaptations of anaerobic ciliates to the low-oxygen environments.

RevDate: 2016-12-30
CmpDate: 2016-10-06

Li Y, Lu J, Z Wang (2016)

Complete mitochondrial genome of Lasiopodomys mandarinus mandarinus (Arvicolinae, Rodentia).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(2):1459-1460.

Mandarin voles (Lasiopodomys mandarinus) is a subterranean rodent species that are often used as a model for studying subterranean hypoxic stress in mammals. Its subspecies L. m. mandarinus span in cropland in most area of north China and is regarded as an agricultural pest. In this paper, the complete mitochondrial genome of L. m. mandarinus has been determined. Our results showed that the mitochondrial genome of L. m. mandarinus is a circular molecule of 16,367 bp, which contents 13 protein-coding, 22 tRNAs and 2 rRNAs genes. The overall base composition of the heavy strand is 32.47% A, 27.04% T, 27.01% C, and 13.47% G. with an AT content of 59.51%.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Hu J, Chen Y, Zhao H, et al (2016)

Complete mitochondrial genome of Rhodeus ocellatus (Cypriniformes: Cyprinidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3489-3490.

The complete mitogenome sequence of Rhodeus ocellatus (Kner) was determined using the next-generation sequencing (NGS). The genome was 16 761 bp in length and contained 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes and a control region. The overall nucleotide composition was 30.43% A, 27.50% T, 25.94% C, and 16.13% G, with an A + T bias of 57.93%. The gene composition and the arrangement of the R. ocellatus mitochondrial genome were similar to that of most other vertebrates. The complete mitochondrial genome sequence will help to study the evolutionary relationships and population genetics of Rhodeus fish.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Wu Z, X Li (2016)

Complete mitochondrial genome of the Nemipterus virgatus (Perciformes: Nemipteridae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3485-3486.

The complete mitochondrial genome of the Nemipterus virgatus has been sequenced. The mitochondrial genome is 16 992 bp in length, containing 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and one control region. The gene order and composition of N. virgatus mitochondrial genome was similar to that of most other vertebrates. The overall nucleotides base composition of the light strand is A (27.89%), G (26.61%), C (16.45%), T (29.05%). With the exception of the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes, all other mitochondrial genes are encoded on the heavy strand. The tRNA-Ser2 gene lacked DHC arm and could not fold into a typical clover-leaf secondary structure. Seen from the phylogenetic tree, N. virgatus, Nemipterus japonicus, and Nemipterus bathybius from the same genus clustered into one branch.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Yu P, Ding S, Yang Q, et al (2016)

The complete mitochondrial genome of Sinibotia robusta (Cypriniformes: Cobitidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3471-3472.

The Sinibotia robusta mitochondrial genome (GenBank accession no. KP979711) was a circular molecule of 16 575 bp in length, with two rRNA genes, 13 protein-coding genes, 22 tRNA genes, an l-strand replication origin (OL), and a control region (D-loop). The nucleotide acid composition of the entire mitogenome was 31.91% for A, 26.90% for C, 15.56% for G, and 25.63% for T, with an A + T content of 57.54%. And the A + T content of 12S rRNA, 16S rRNA, and D-loop was 51.26%, 56.17%, and 67.73%, respectively.

RevDate: 2026-01-28
CmpDate: 2018-01-18

Luo X, Kang X, D Zhang (2016)

Complete mitochondrial genome of the American flamingo, Phoenicopterus ruber (Phoenicopteriformes, Phoenicopteridae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3519-3520.

The American flamingo, Phoenicopterus ruber (P. ruber), is a large species of flamingo closely related to the greater flamingo and Chilean flamingo. In this paper, the complete mitochondrial genome sequence of P. ruber has been assembled for the first time. It was 17 476 bp in length and consisted of 13 typical vertebrate protein-coding genes, 22 tRNA genes, 2 rRNA genes and 2 control regions. COI and ND3 genes used GTG and ATC as start codons respectively, but the remaining protein-coding genes were encoded beginning with orthodox ATG codon. Two triplet codons (TAA, AGG) and one single T base were employed as stop codons. The arrangement of the overall genes and noncoding regions was identical to the same genus flamingo Phoenicopterus roseus. The AT content (54.27%) was higher than the GC content. Phylogenetic analysis was performed using 12 protein-coding genes, combined with other 11 species from the same Neognathae, which validated the responsibility and utility of this new mitochondrial genome.

RevDate: 2026-01-28
CmpDate: 2018-01-18

Park CE, Park GS, Kim MC, et al (2016)

Complete mitochondrial genome of the Korean endemic species Microphysogobio yaluensis (Teleostei, Cypriniformes, Cyprinidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3557-3559.

In this study, we sequenced the complete mitochondrial genome of the Korean endemic species Microphysogobio yaluensis (Teleostei, Cypriniformes, Cyprinidae). The mitogenome, consisted of 16 601 base pairs (bp), encoding 13 protein-coding genes (PCGs), 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and 2 non-coding regions. The overall base composition of M. yaluensis was G + C: 43.8%, A + T: 56.2%, apparently with a slight AT bias. Phylogenetic analysis showed that M. yaluensis was close to Hemibarbus mylodon.

RevDate: 2026-01-28
CmpDate: 2018-01-18

Yang X, Xie GL, Wu XP, et al (2016)

The complete mitochondrial genome of Chinese land snail Aegista aubryana (Gastropoda: Pulmonata: Bradybaenidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3538-3539.

Aegista aubryana is an endemic land snail in China. The complete mitochondrial genome of A. aubryana was first determined using long PCR reactions and primer walking method (accession number KT192071). The genome has a length of 14 238 bp, containing 37 typical mitochondrial genes (13 protein-coding genes, 22 tRNA genes and 2 rRNA genes). The base composition of the whole heavy strand is A 31.32%, T 37.86%, C 14.46% and G 16.36%. The results of phylogenetic analyses showed that the A. aubryana is most closely related to Mastigeulota kiangsinensis. This new complete mitochondrial genome can be the basic data for further studies on mitogenome comparison, molecular taxonomy and phylogenetic analyses in bradybaenid snails and Molluscs at large.

RevDate: 2018-11-13
CmpDate: 2018-01-18

Wilson JJ, Hefner M, Walker CW, et al (2016)

Complete mitochondrial genome of the soft-shell clam Mya arenaria.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3553-3554.

We have sequenced and characterized the complete mitochondrial genome of the soft-shell clam, Mya arenaria, an important organism for environmental toxicology and aquaculture. Mya arenaria is located in the taxonomic order Myoida, which lacks any member with a completely annotated mitogenome. The M. arenaria mitochondrial genome is 17 947 bp in length. Like most marine bivalves, the circular mitogenome codes entirely on the heavy strand, with no introns. As with other bivalves, the gene order of the mitochondrion is highly rearranged. The mitogenome contains 12 protein-coding genes but ATP8 is missing, consistent with about half of all bivalve genera. Twenty-three tRNAs were identified. Phylogenetic analysis shows that M. arenaria is related most closely with the bivalves Sinonovacula constricta, and Moerella iridescens, of the infraclass Euheterodonta (unassigned). This, along with the close grouping of the phylogenetic trees, confirms a close tie between Myoida and Euheterodonta (unassigned).

RevDate: 2018-05-10
CmpDate: 2018-01-18

Zhang G, Wang R, Mao J, et al (2016)

The complete mitochondrial genome and phylogenic analysis of Pseudobagrus vachelli.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3551-3552.

The complete mitochondrial genome of Pseudobagrus vachelli has been sequenced. The mitochondrial genome is 16 529 bp in length, with the base composition of 31.61% A, 26.88% T, 26.55% C, and 14.96% G, containing 2 ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and a major non-coding control region (D-loop region). The gene order and orientation are similar with some typical fish species. The data will provide useful molecular information for phylogenetic studies concerning P. vachelli and its related species.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Li Y, Yao J, Zhao X, et al (2016)

Complete mitochondrial genome sequence of Chestnut-flanked white-eye (Zosterops erythropleurus).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3529-3530.

The Chestnut-flanked white-eye (Zosterops erythropleurus) is a species of family Zosteropidae, which is distributed widely in the world. In the present study, the complete mitochondrial genome sequence of Chestnut-flanked white-eye was determined. It has a total length of 17 811 bp, and contains 13 protein-coding genes, 22 tRNA genes, 2 ribosome RNA genes and 2 control regions. The total base composition was 30.2% for A, 31.0% for C, 14.2% for G and 24.6% for T. The phylogenetic tree of Chestnut-flanked white-eye and 13 other species belonging to the order Passeriformes was built. The molecular data presented here will be useful to study the evolutionary relationships and genetic diversity of Chestnut-flanked white-eye.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Das SP, Bit A, Patnaik S, et al (2016)

Low-depth shotgun sequencing resolves complete mitochondrial genome sequence of Labeo rohita.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3517-3518.

Labeo rohita, popularly known as rohu, is a widely cultured species in whole Indian subcontinent. In the present study, we used in-silico approach to resolve complete mitochondrial genome of rohu. Low-depth shotgun sequencing using Roche 454 GS FLX (Branford, Connecticut, USA) followed by de novo assembly in CLC Genomics Workbench version 7.0.4 (Aarhus, Denmark) revealed the complete mitogenome of L. rohita to be 16 606 bp long (accession No. KR185963). It comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNAs and 1 putative control region. The gene order and organization are similar to most vertebrates. The mitogenome in the present investigation has 99% similarity with that of previously reported mitogenomes of rohu and this is also evident from the phylogenetic study using maximum-likelihood (ML) tree method. This study was done to determine the feasibility, accuracy and reliability of low-depth sequence data obtained from NGS platform as compared to the Sanger sequencing. Thus, NGS technology has proven to be competent and a rapid in-silico alternative to resolve the complete mitochondrial genome sequence, thereby reducing labors and time.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Li W, Liu Y, Q Xu (2016)

Complete mitochondrial genome of Schizothorax nukiangensis Tsao (Cyprinidae: Schizothorax).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3549-3550.

In this work, we reported the complete mitochondrial genome sequence of the Schizothorax nukiangensis Tsao for the first time. The complete mtDNA genome sequence of S. nukiangensis Tsao was 16 585 bp in length, which contains 22 transfer RNA genes, 2 rRNA genes, 13 protein-coding genes, an origin of light-strand replication (OL) and a control region (D-Loop). The overall base composition of the mitogenome was calculated to be 29.6% for A, 27.0% for C, 17.9% for G and 25.5% for T. The complete mitogenome of the S. nukiangensis Tsao can provide an important data set for further studies on population history, molecular systematics, phylogeography and stock assessment.

RevDate: 2015-08-13
CmpDate: 2016-05-11

Kumar Singh M, Janardhan Reddy PV, Sreedhar AS, et al (2015)

Molecular characterization and expression analysis of hsp60 gene homologue of sheep blowfly, Lucilia cuprina.

Journal of thermal biology, 52:24-37.

The 60kDa heat shock protein (Hsp60) or chaperonin is one among the highly conserved families of heat shock proteins, known to be involved in variety of cellular activities, including protein folding, thermal protection, etc. In this study we sequence characterized hsp60 gene homologue of Lucilia cuprina, isolated and cloned from the genomic library as well as by genomic PCR, followed by RACE- PCR. The L. cuprina hsp60 gene/protein expression pattern was analyzed in various tissues, either at normal temperature (25±1°C) or after exposure to heat stress (42°C). The analysis of nucleotide sequence of Lchsp60 gene revealed absence of intron and the nuclear localizing signal (NLS). The deduced amino acid sequence showed presence of unique conserved sequences, such as those for mitochondrial localization, ATP binding, etc. Unlike Drosophila, Lucilia showed presence of only one isoform, i.e., hsp60A. Phylogenetic analysis of hsp60 gene homologues from different species revealed Lchsp60 to have >88.36% homology with D. melanogaster, 76.86% with L. sericata, 58.31% with mice, 57.99% with rat, and 57.72% with human. Expression analysis using Real Time PCR and fluorescence imaging showed significant enhancement in the expression level of Lchsp60 upon heat stress in a tissue specific manner, indicating its likely role in thermo-tolerance as well as in normal cellular activities.

RevDate: 2026-01-28
CmpDate: 2018-01-18

Jang YS, Kim S, Kim KY, et al (2016)

Complete mitochondrial genome of Sebastes taczanowskii (Scorpaenidae, Scorpaeniformes) from the East Sea, Korea.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3531-3533.

Sebastes taczanowskii is a subarctic species in the north-western Pacific Ocean. To obtain mitochondrial DNA sequences for phylogeny, the complete mitogenome (16 452 bp in length) of S. taczanowskii was constructed using next-generation sequencing. The circular mitogenome contains 13 protein-coding genes (PCGs), 2 rRNAs, 22 tRNAs and the control region, for which gene structure and positions were similar to those of other Scorpaenidae. The complete mitogenome composed of 27.8% A, 26.5% T, 17.3% G and 28.5% C, with a slight AT bias (54.3%). All PCGs use a typical start codon, ATG, except COX1 (GTG). The terminal codon of PCGs was mainly TAR, with the exceptions of ND4 (AGA) and Cytb (incomplete codon, T). Sebastes taczanowskii was clearly divided from other Scorpaenidae in the phylogenetic tree using 2 rRNA and 13 PCGs. The mitogenome of S. taczanowskii can be useful for constructing the molecular phylogenetic tree within Scorpaenidae.

RevDate: 2026-01-28
CmpDate: 2016-04-22

Horáková E, Changmai P, Paris Z, et al (2015)

Simultaneous depletion of Atm and Mdl rebalances cytosolic Fe-S cluster assembly but not heme import into the mitochondrion of Trypanosoma brucei.

The FEBS journal, 282(21):4157-4175.

ABC transporter mitochondrial 1 (Atm1) and multidrug resistance-like 1 (Mdl) are mitochondrial ABC transporters. Although Atm1 was recently suggested to transport different forms of glutathione from the mitochondrion, which are used for iron-sulfur (Fe-S) cluster maturation in the cytosol, the function of Mdl remains elusive. In Trypanosoma brucei, we identified one homolog of each of these genes, TbAtm and TbMdl, which were downregulated either separately or simultaneously using RNA interference. Individual depletion of TbAtm and TbMdl led to limited growth defects. In cells downregulated for TbAtm, the enzymatic activities of the Fe-S cluster proteins aconitase and fumarase significantly decreased in the cytosol but not in the mitochondrion. Downregulation of TbMdl did not cause any change in activities of the Fe-S proteins. Unexpectedly, the simultaneous downregulation of TbAtm and TbMdl did not result in any growth defect, nor were the Fe-S cluster protein activities altered in either the cytosolic or mitochondrial compartments. Additionally, TbAtm and TbMdl were able to partially restore the growth of the Saccharomyces cerevisiae Δatm1 and Δmdl2 null mutants, respectively. Because T. brucei completely lost the heme b biosynthesis pathway, this cofactor has to be obtained from the host. Based on our results, TbMdl is a candidate for mitochondrial import of heme b, which was markedly decreased in both TbMdl and TbAtm + TbMdl knockdowns. Moreover, the levels of heme a were strongly decreased in the same knockdowns, suggesting that TbMdl plays a key role in heme a biosynthesis, thus affecting the overall heme homeostasis in T. brucei.

RevDate: 2026-01-28
CmpDate: 2016-06-24

Farhadi M, Fazaeli A, A Haniloo (2015)

Genetic characterization of livestock and human hydatid cyst isolates from northwest Iran, using the mitochondrial cox1 gene sequence.

Parasitology research, 114(12):4363-4370.

Cystic echinococcosis (CE), caused by larval stages of the tapeworm Echinococcus granulosus, is one of the most important zoonoses distributed worldwide. Genotype analysis of the parasite isolates from various hosts is required to better understand the host specificity and transmission routes. The aim of this study was to identify the genotypes of E. granulosus isolated from humans and domestic animals from northwest of Iran (Zanjan Province) using the mitochondrial cox1 gene sequence. A total of 86 hydatid cysts including 49 sheep and 28 cattle isolates from the slaughterhouse and nine human isolates from surgical wards of local hospitals were collected. The isolates were subjected to DNA extraction, PCR amplification, and sequence. Eighty-two (95.35 %) isolates, including 47 sheep, 26 cattle, and all nine human isolates, were determined as G1 genotype, and the remaining four (4.65 %), including two sheep and two cattle isolates, were identified as G3 genotype. From the cox1 sequence data, 13 different haplotypes (10 G1s and three G3s) were detected and named as EGH1-EGH13 (GenBank accession numbers, KP859559-KP859571). EGH1 was the major variant among the haplotypes, and it was identified in 46 (53.49 %) isolates (31 sheep, 14 cattle, and one human). Alignment of the partial cox1 sequences showed 12 point mutations including seven (58.3 %) synonymous and five (41.7 %) non-synonymous substitutions. Based on the results, G1 was the major genotype of E. granulosus in northwest of Iran affecting sheep, cattle, and humans. In addition, a minor group of G3 genotype was found to be circulating in this region.

RevDate: 2018-11-13
CmpDate: 2016-08-16

Yu G, Xiang H, Tian J, et al (2015)

Mitochondrial Haplotypes Influence Metabolic Traits in Porcine Transmitochondrial Cybrids.

Scientific reports, 5:13118.

In farm animals, mitochondrial DNA mutations exist widely across breeds and individuals. In order to identify differences among mtDNA haplotypes, two porcine transmitochondrial cybrids were generated by fusion of a Lantang pig cell line devoid of mitochondrial DNA with enucleated cytoplasm from either a Large White pig or a Xiang pig harboring potentially divergent mitochondrial haplotypes. These cybrid cells were subjected to mitochondrial genome sequencing, copy number detecting and analysis of biochemical traits including succinate dehydrogenase (SDH) activity, ATP content and susceptibility to reactive oxygen species (ROS). The Lantang and Xiang mitochondrial genomes were highly homologous with only 18 polymorphic sites, and differed radically from the Large White with 201 and 198 mutations respectively. The Large White and Xiang cybrids exhibited similar mtDNA copy numbers and different values among biochemical traits, generated greater ROS production (P < 0.05) and less SDH activity (P < 0.05) and a lesser ATP content (P < 0.05). The results show that functional differences exist between cybrid cells which differ in mitochondrial genomic background. In conclusion, transmitochondrial cybrids provide the first direct evidence on pig biochemical traits linking different mitochondrial genome haplotypes.

RevDate: 2026-01-28
CmpDate: 2018-01-18

Li G, Li W, Lv S, et al (2016)

Identification and phylogenetic analysis of the mitogenome of Sarcocheilichthys parvus Nichols (Cypriniformes: Cyprinidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3542-3543.

In the present study, the complete mitogenome sequence of a Sarcocheilichthys parvus Nichols was sequenced and identified. It contained 22 tRNA genes, 13 protein-coding genes, 2 rRNA genes and 2 non-coding regions. The phylogenetic analysis showed that the mitogenome sequence could be useful data in the field of systematics and conservation biology for S. parvus Nichols and other aquatic species.

RevDate: 2016-12-30
CmpDate: 2016-12-13

Park JS, AG Simpson (2016)

Characterization of a Deep-Branching Heterolobosean, Pharyngomonas turkanaensis n. sp., Isolated from a Non-Hypersaline Habitat, and Ultrastructural Comparison of Cysts and Amoebae Among Pharyngomonas Strains.

The Journal of eukaryotic microbiology, 63(1):100-111.

An unusual heterolobosean amoeba, isolate LO, was isolated recently from a sample with a salinity of ~4‰, from Lake Turkana in East Africa. 18S rDNA phylogenies confirm that isolate LO branches among halophilic amoeboflagellates assigned to Pharyngomonas. We examined the ultrastructure of the amoeba and cyst stages of isolate LO, as well as the amoebae and cysts of Pharyngomonas kirbyi (isolates AS12B and SD1A). The amoebae of all three isolates lacked discrete dictyosomes and had discoidal/flattened mitochondrial cristae, but the mitochondria were not enrobed by rough endoplasmic reticulum. The cysts of all three isolates showed a thick, bipartite cyst wall, and lacked cyst pores. The cysts of isolate LO were distinct in that the ectocyst was very loose-fitting, and could contain "crypts". No flagellate form of isolate LO has been observed to date, and a salinity-for-growth experiment showed that isolate LO can grow at 15-100‰ salinity, indicating that it is halotolerant. By contrast, other studied Pharyngomonas isolates are amoeboflagellates and true halophiles. Therefore, we propose isolate LO as a new species, Pharyngomonas turkanaensis n. sp. It is possible that P. turkanaensis descended from halophilic ancestors, and represents a secondary reestablishment of a physiology adapted for moderate salinity.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Mai Q, Li W, Chen H, et al (2016)

Complete mitochondrial genome and phylogenetic position of the Sicklefin weasel shark Hemigaleus microstoma.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3491-3492.

The complete mitochondrial genome of the Sicklefin weasel shark Hemigaleus microstoma was first presented in this study. It was 16 701 bp in length with the typical gene arrangement in vertebrates. A total of 25 bp short intergenic spaces and 33 bp overlaps located in 12 and 9 gene junctions, respectively. The overall nucleotide composition was 31.0% A, 26.4% C, 13.5% G and 29.1% T. Two start (ATG and GTG) and three stop (TAG, AGG and TAA/T) codons were found in the protein-coding genes. The size of 22 tRNA genes ranged from 67 to 75 bp. In the phylogenetic tree, H. microstoma (Hemigaleidae) was placed as sister to Galeocerdo cuvier (Carcharhinidae).

RevDate: 2021-12-03
CmpDate: 2016-07-20

Law YS, Zhang R, Guan X, et al (2015)

Phosphorylation and Dephosphorylation of the Presequence of Precursor MULTIPLE ORGANELLAR RNA EDITING FACTOR3 during Import into Mitochondria from Arabidopsis.

Plant physiology, 169(2):1344-1355.

The nucleus-encoded mitochondria-targeted proteins, multiple organellar RNA editing factors (MORF3, MORF5, and MORF6), interact with Arabidopsis (Arabidopsis thaliana) PURPLE ACID PHOSPHATASE2 (AtPAP2) located on the chloroplast and mitochondrial outer membranes in a presequence-dependent manner. Phosphorylation of the presequence of the precursor MORF3 (pMORF3) by endogenous kinases in wheat germ translation lysate, leaf extracts, or STY kinases, but not in rabbit reticulocyte translation lysate, resulted in the inhibition of protein import into mitochondria. This inhibition of import could be overcome by altering threonine/serine residues to alanine on the presequence, thus preventing phosphorylation. Phosphorylated pMORF3, but not the phosphorylation-deficient pMORF3, can form a complex with 14-3-3 proteins and HEAT SHOCK PROTEIN70. The phosphorylation-deficient mutant of pMORF3 also displayed faster rates of import when translated in wheat germ lysates. Mitochondria isolated from plants with altered amounts of AtPAP2 displayed altered protein import kinetics. The import rate of pMORF3 synthesized in wheat germ translation lysate into pap2 mitochondria was slower than that into wild-type mitochondria, and this rate disparity was not seen for pMORF3 synthesized in rabbit reticulocyte translation lysate, the latter translation lysate largely deficient in kinase activity. Taken together, these results support a role for the phosphorylation and dephosphorylation of pMORF3 during the import into plant mitochondria. These results suggest that kinases, possibly STY kinases, and AtPAP2 are involved in the import of protein into both mitochondria and chloroplasts and provide a mechanism by which the import of proteins into both organelles may be coordinated.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Su XH, Zhao S, Wang K, et al (2016)

Complete mitochondrial genome of the "floppy-wing" morph reproductive termite, Reticulitermes labralis (Isoptera: Rhinotermitidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3547-3548.

The complete mitochondrial genome of Reticulitermes labralis (Isoptera: Rhinotermitidae) was determined for its nucleotide sequence of 16 113 bp. Its gene content and organization were identical with other Reticulitermes species. The 13 protein-coding genes (PCGs) have typical ATN initiation codon. But, the stop codons were TAA, TAG and an incomplete termination codon (T) abutting an adjacent tRNA gene. Twenty-two tRNA genes, in addition to tRNASer(AGN) replaced lacking of the DHU stem with a simple loop, showed the typical clover-leaf secondary structure. The A + T-rich region was 1311 bp in length with 65.98% A + T content. In addition to the A + T-rich region, non-coding sequences of the mtDNA genome harbored 17 intergenic spacers. There were three complete repeats of repeat A in CR, which were not discovered in other termite species. Phylogenetic tree based on the 11 complete mitochondrial genome sequences of closely related termite species accords well with morphological phylogenetic analysis.

RevDate: 2017-11-07
CmpDate: 2016-07-27

Zhong Z, Norvienyeku J, Yu J, et al (2015)

Two different subcellular-localized Acetoacetyl-CoA acetyltransferases differentiate diverse functions in Magnaporthe oryzae.

Fungal genetics and biology : FG & B, 83:58-67.

The mevalonate pathway is an efficient biosynthesis pathway that yields isoprenoids for promoting different crucial cellular functions, including ergosterol synthesis and growth regulation. Acetoacetyl-CoA acetyltransferase (EC2.3.1.9) is the first major catalytic enzyme constituting the mevalonate pathway and catalyzes the transformation of Acetoacetyl-CoA from two molecules of acetyl-CoA enroute ergosterol production in fungi. We identified two homologous genes encoding Acetoacetyl-CoA acetyltransferase (MoAcat1 and MoAcat2) in Magnaporthe oryzae, the rice blast fungus. Phylogenetic analysis indicates these two genes have different evolutionary history. We subsequently, conducted targeted gene deletion using homologous recombination technology to ascertain the unique roles of the two MoAcat homologues during the fungal morphogenesis and pathogenesis. The findings from our investigations showed that the activity of MoAcat1 promoted virulence in the rice blast fungus as such, the ΔMoacat1 mutants generated exhibited defect in virulence, whilst ΔMoacat1 mutants did not portray growth defects. ΔMoacat2 mutants on the other hand were characterized by reduction in growth and virulence. Furthermore, MoAcat1 and MoAcat2 showed different expression patterns and subcellular localizations in M. oryzae. From our investigations we came to the conclusion that, different subcellular localization contributes to the diverse functions of MoAcat1 and MoAcat2, which helps the successful establishment of blast disease by promoting efficient development of cell morphology and effective colonization of host tissue.

RevDate: 2026-01-28
CmpDate: 2016-10-14

Ojanguren-Affilastro AA, Mattoni CI, Ochoa JA, et al (2016)

Phylogeny, species delimitation and convergence in the South American bothriurid scorpion genus Brachistosternus Pocock 1893: Integrating morphology, nuclear and mitochondrial DNA.

Molecular phylogenetics and evolution, 94(Pt A):159-170.

A phylogenetic analysis of the scorpion genus Brachistosternus Pocock, 1893 (Bothriuridae Simon, 1880) is presented, based on a dataset including 41 of the 43 described species and five outgroups, 116 morphological characters and more than 4150 base-pairs of DNA sequence from the nuclear 18S rDNA and 28S rDNA gene loci, and the mitochondrial 12S rDNA, 16S rDNA, and Cytochrome c Oxidase Subunit I gene loci. Analyses conducted using parsimony, Maximum Likelihood and Bayesian Inference were largely congruent with high support for most clades. The results confirmed the monophyly of Brachistosternus, the nominal subgenus, and subgenus Ministernus Francke, 1985, as in previous analyses based only on morphology, but differed in several other respects. Species from the plains of the Atacama Desert diverged basally whereas the high altitude Andean species radiated from a more derived ancestor, presumably as a consequence of Andean uplift and associated changes in climate. Species limits were assessed among species that contain intraspecific variation (e.g., different morphs), are difficult to separate morphologically, and/or exhibit widespread or disjunct distributions. The extent of convergence in morphological adaptation to life on sandy substrata (psammophily) and the complexity of the male genitalia, or hemispermatophores, was investigated. Psammophily evolved on at least four independent occasions. The lobe regions of the hemispermatophore increased in complexity on three independent occasions, and decreased in complexity on another three independent occasions.

RevDate: 2018-05-10
CmpDate: 2018-02-02

Bo Z, Wenping S, Kefeng L, et al (2016)

The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3663-3665.

The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. (2009). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ''OL'' region was found (Table 1). The ''OL'' region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes (Table 1). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.

RevDate: 2018-05-10
CmpDate: 2018-01-18

Ren J, Pu J, Buchinger T, et al (2016)

The mitogenomes of the pouched lamprey (Geotria australis) and least brook lamprey (Lampetra aepyptera) with phylogenetic considerations.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3560-3562.

We report the mitogenomes of the pouched lamprey (Geotria australis) and least brook lamprey (Lampetra aepyptera) in the families Geotriidae and Petromyzontidae, respectively. Both of the mitogenomes contain the 37 typical vertebrate genes. Their gene order and contents are identical to those of previously described lamprey mitogenomes. The mitogenome of G. australis (17 080 bp) is the largest among the 10 reported lamprey mitogenomes, owed to two long noncoding regions. The mitogenome of L. aepyptera is 77 bp longer (16 236 bp) than that of the congeneric European river lamprey L. fluviatilis, a size difference mostly due to different copy numbers of tandem repeats in the noncoding regions. The phylogenetic analysis supports that the pouched lamprey (Geotriidae) diverged earlier from the common ancestor of lampreys than the Petromyzonids, and the placement of the least brook lamprey in the genus Lampetra.

RevDate: 2020-09-30
CmpDate: 2016-09-19

Zeng X, Cheng N, Zheng X, et al (2015)

Molecular cloning and characterization of two manganese superoxide dismutases from Miscanthus × giganteus.

Plant cell reports, 34(12):2137-2149.

Six MnSOD genes were isolated from five Miscanthus species. MgMnSOD1 functions in mitochondria and MgMnSOD1 seems to be the main MnSOD gene involved in stress response of M. × giganteus. Miscanthus × giganteus is a promising biomass energy crop with advantages of vigorous growth, high yield, low fertilizer and pesticide inputs. However, poor overwinter ability limits its widespread cultivation. Moreover, narrow genetic base may increase the risk of susceptibility to diseases and pests. Manganese superoxide dismutase (MnSOD), an important antioxidant enzyme involved in stress tolerance is able to protect plant cells from accumulated reactive oxygen species by converting superoxide to peroxide and oxygen. In many plants, overexpression of MnSOD has shown the ability to enhance the resistance to various stresses. This article describes the studies performed in an attempt to elucidate the molecular and enzymatic properties of MnSODs in M. × giganteus. MnSOD genes from M. × giganteus (MgMnSOD1, MgMnSOD2), M. lutarioriparia (MlMnSOD), M. sacchariflora (MsaMnSOD), M. sinensis (MsiMnSOD), and M. floridulus (MfMnSOD) were cloned and sequenced. The sequence analysis and expression patterns of MgMnSOD1 and MgMnSOD2 suggest that they were orthologous genes which were inherited from the two parents, M. sacchariflora and M. sinensis, respectively. In addition, MgMnSOD1 is predicted to be the main MnSOD gene involved in stress response of M. × giganteus. The activity of purified recombinant MgMnSOD1 was 1854.79 ± 39.98 U mg(-1) (mean ± SD). Further enzymatic assays revealed that the protein exhibited an outstanding thermal stability. MgMnSOD1 is predicted to be targeted to mitochondria and involved in removing the superoxide radical generated by respiration. The presence and sequences of other SOD isozymes transcripts were also investigated in this study.

RevDate: 2022-03-11
CmpDate: 2017-10-30

Bosacchi M, Gurdon C, P Maliga (2015)

Plastid Genotyping Reveals the Uniformity of Cytoplasmic Male Sterile-T Maize Cytoplasms.

Plant physiology, 169(3):2129-2137.

Cytoplasmic male-sterile (CMS) lines in maize (Zea mays) have been classified by their response to specific restorer genes into three categories: cms-C, cms-S, and cms-T. A mitochondrial genome representing each of the CMS cytotypes has been sequenced, and male sterility in the cms-S and cms-T cytotypes is linked to chimeric mitochondrial genes. To identify markers for plastid genotyping, we sequenced the plastid genomes of three fertile maize lines (B37, B73, and A188) and the B37 cms-C, cms-S, and cms-T cytoplasmic substitution lines. We found that the plastid genomes of B37 and B73 lines are identical. Furthermore, the fertile and CMS plastid genomes are conserved, differing only by zero to three single-nucleotide polymorphisms (SNPs) in coding regions and by eight to 22 SNPs and 10 to 21 short insertions/deletions in noncoding regions. To gain insight into the origin and transmission of the cms-T trait, we identified three SNPs unique to the cms-T plastids and tested the three diagnostic SNPs in 27 cms-T lines, representing the HA, I, Q, RS, and T male-sterile cytoplasms. We report that each of the tested 27 cms-T group accessions have the same three diagnostic plastid SNPs, indicating a single origin and maternal cotransmission of the cms-T mitochondria and plastids to the seed progeny. Our data exclude exceptional pollen transmission of organelles or multiple horizontal gene transfer events as the source of the mitochondrial urf13-T (unidentified reading frame encoding 13-kD cms-T protein) gene in the cms-T cytoplasms. Plastid genotyping enables a reassessment of the evolutionary relationships of cytoplasms in cultivated maize.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Wei H, Jia Q, Chen G, et al (2016)

The complete mitogenome of lesser striped shrew Sorex bedfordiae (soricidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4290-4291.

The Sorex genus is type genus in Soricidae. Most of them lack comprehensive biological data. In this study, the complete mitochondrial genome sequence of Sorex bedfordiae was determined. The mitogenome is 17 160 base pairs in length and contains 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one control region. The nucleotide sequence data of 12 heavy-strand protein-coding genes of Sorex bedfordiae and other 10 species in Soricidae were used for phylogenetic analyses. Tree constructed using Bayesian phylogenetic methods demonstrated Sorex bedfordiae as a sister to Sorex cylindricauda. Phylogenetic analyses further confirmed that Blarinella diverged prior to Sorex and Anourosorex, but Episoriculus differentiated earlier than Neomys and Nectogale within subfamily Soricinae.

RevDate: 2026-01-27
CmpDate: 2018-01-18

López K, Angeli C, Aguilar C, et al (2016)

Extreme mitogenomic divergence between two syntopic specimens of Arremon aurantiirostris (Aves: Emberizidae) in central Panama suggests possible cryptic species.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3451-3453.

We report the complete mitochondrial genome of two specimens of Orange-billed Sparrow Arremon aurantiirostris from Colón Province, in central Panama. The two specimens were collected on the same day, and at the same locality; however, they showed substantial divergence (6.3% average pairwise divergence among coding genes). A survey of ND2 sequence variation across Panama suggests that this divergence is the result of geographic differentiation and secondary contact. This high level of mitochondrial divergence among co-occurring individuals raises the possibility of multiple biological species in Orange-billed Sparrows. Our results are yet another demonstration that much remains to be discovered regarding avian biodiversity in Panama and throughout the Neotropics.

RevDate: 2018-04-29
CmpDate: 2016-10-24

Sheiner L, Fellows JD, Ovciarikova J, et al (2015)

Toxoplasma gondii Toc75 Functions in Import of Stromal but not Peripheral Apicoplast Proteins.

Traffic (Copenhagen, Denmark), 16(12):1254-1269.

Apicomplexa are unicellular parasites causing important human and animal diseases, including malaria and toxoplasmosis. Most of these pathogens possess a relict but essential plastid, the apicoplast. The apicoplast was acquired by secondary endosymbiosis between a red alga and a flagellated eukaryotic protist. As a result the apicoplast is surrounded by four membranes. This complex structure necessitates a system of transport signals and translocons allowing nuclear encoded proteins to find their way to specific apicoplast sub-compartments. Previous studies identified translocons traversing two of the four apicoplast membranes. Here we provide functional support for the role of an apicomplexan Toc75 homolog in apicoplast protein transport. We identify two apicomplexan genes encoding Toc75 and Sam50, both members of the Omp85 protein family. We localize the respective proteins to the apicoplast and the mitochondrion of Toxoplasma and Plasmodium. We show that the Toxoplasma Toc75 is essential for parasite growth and that its depletion results in a rapid defect in the import of apicoplast stromal proteins while the import of proteins of the outer compartments is affected only as the secondary consequence of organelle loss. These observations along with the homology to Toc75 suggest a potential role in transport through the second innermost membrane.

RevDate: 2021-12-03
CmpDate: 2016-11-14

Jin JM, Hou CC, Tan FQ, et al (2016)

The potential function of prohibitin during spermatogenesis in Chinese fire-bellied newt Cynops orientalis.

Cell and tissue research, 363(3):805-822.

Prohibitin proteins are multifunctional proteins located mainly at the inner membrane of mitochondria expressed in universal species. They play a vital role in mitochondria's function, cell proteolysis, senescence, apoptosis and as a substrate for ubiquitination. In this study, we used PCR cloning, protein and nucleotide acids alignment, protein structure prediction, western blot, in situ hybridization and immunofluorescence to study the characteristics of the prohibitin gene and the potential role of prohibitin in spermatogenesis and spermiogenesis processes in the Chinese fire-bellied newt Cynops orientalis. First, we cloned a 1452-bp full-length cDNA from the testis of Cynops orientalis. Second, we found that the 272 amino acids of prohibitin have a SPFH family domain. Thirdly, the western blots showed high expression of prohibitin in testis while the protein size was approximately 32 kDa. Fourthly, the results of in situ hybridization and immunofluorescence experiments showed that most of the prohibitins travelled with the mitochondria's migration in Cynops orientalis. The quantities of mRNA decreased as spermiogenesis proceeded, although the signals of prohibitins existed during the whole period of spermatogenesis and spermiogenesis. In the mature germ cells, the signals of prohibitins were weak and aggregated at the end of the cell. Finally, we discovered that the Sertoli cells had a large quantity of prohibitins and we made several assumptions of prohibitins' potential roles in those cells. This is the first time that the relationship between mitochondria and prohibitin in different stages of the sperm cells in Cynops orientalis has been examined, which also revealed that Sertoli cells have abundant prohibitins.

RevDate: 2016-12-30
CmpDate: 2016-12-13

Guan X, Chen H, Abramson A, et al (2015)

A phosphopantetheinyl transferase that is essential for mitochondrial fatty acid biosynthesis.

The Plant journal : for cell and molecular biology, 84(4):718-732.

In this study we report the molecular genetic characterization of the Arabidopsis mitochondrial phosphopantetheinyl transferase (mtPPT), which catalyzes the phosphopantetheinylation and thus activation of mitochondrial acyl carrier protein (mtACP) of mitochondrial fatty acid synthase (mtFAS). This catalytic capability of the purified mtPPT protein (encoded by AT3G11470) was directly demonstrated in an in vitro assay that phosphopantetheinylated mature Arabidopsis apo-mtACP isoforms. The mitochondrial localization of the AT3G11470-encoded proteins was validated by the ability of their N-terminal 80-residue leader sequence to guide a chimeric GFP protein to this organelle. A T-DNA-tagged null mutant mtppt-1 allele shows an embryo-lethal phenotype, illustrating a crucial role of mtPPT for embryogenesis. Arabidopsis RNAi transgenic lines with reduced mtPPT expression display typical phenotypes associated with a deficiency in the mtFAS system, namely miniaturized plant morphology, slow growth, reduced lipoylation of mitochondrial proteins, and the hyperaccumulation of photorespiratory intermediates, glycine and glycolate. These morphological and metabolic alterations are reversed when these plants are grown in a non-photorespiratory condition (i.e. 1% CO2 atmosphere), demonstrating that they are a consequence of a deficiency in photorespiration due to the reduced lipoylation of the photorespiratory glycine decarboxylase.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Zhao M, Ma H, Ma C, et al (2016)

The complete mitochondrial genome and gene organization of Cubiceps squamiceps (Perciformes: nomeidae) with phylogenetic consideration.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4296-4297.

In this study, we reported the complete mitochondrial DNA sequence of Cubiceps squamiceps, and its phylogenetic relationship. The full length of this mitogenome was 16 510 bp, including 22 transfer RNA genes, two ribosomal RNA genes, 13 protein-coding genes, and a putative control region. The location of genes in mitochondrial genome was similar to other fish species within family Nomeidae. Twenty-eight genes were located on the heavy strand, while nine genes were located on the light strand. The nucleotide composition of this mitogenome was 27.5% for A, 28.5% for C, 17.5% for G, and 26.5% for T. From the NJ phylogenetic tree, we can find that C. squamiceps was genetically closest to C. pauciradiatus among 20 species within suborder Stromateoidei. This study could lay the basis for the future studies in population genetic diversity, taxonomic status, molecular systematics, and conservation genetics in C. squamiceps.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Guan N, Nie C, Geng R, et al (2016)

The complete mitochondrial genome of the hybrid of Megalobrama amblycephala (♀) × Megalobrama skolkovii (♂).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4294-4295.

The complete mitochondrial genome of the hybrid of Megalobrama amblycephala (♀) × Megalobrama skolkovii (♂) was characterized first in this study. The total length of the genome was identical to the female parent as 16 623 bp, and the overall base composition was 31.23% A, 24.69% T, 27.89% C, and 16.19% G, with a slight A + T bias. It contained 13 protein-coding genes (PCGs), 22 transfer RNA genes, 2 ribosomal RNA genes, and 2 main non-coding regions (the control region and the origin of the light-strand replication). This study discovered the 99.88% sequence identity between the hybrid and its female parent, which confirmed the maternal inheritance pattern followed by the mitochondrial genome of the hybrid. However, the sequence alignment of mitochondrial genomes between the hybrid and its female parent revealed a total of 20 variable sites in 10 genes or regions, especially 4 sense mutations in 2 PCGs (COX1 and ATPase6). The complete mitochondrial genome sequence of this hybrid bream may provide an important dataset for further study in mitochondrial inheritance mechanism.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Yao H, Gao M, Liu K, et al (2016)

Sequence characterization and phylogeny analysis of the complete mitochondrial genome of verreaux's sifaka, Propithecus verreauxi (primates: indriidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4431-4432.

The Verreaux's sifaka, Propithecus verreauxi, is a medium-sized lemur that inhabits in tropical dry lowland and montane forest. Here, we reported the complete mitochondrial genome sequence of this species. The mitogenome of P. verreauxi is 17 106 bp in length and composed of 13 protein-coding genes (PCGs), 2 ribosomal RNA genes, 22 transfer RNA genes and a control region. The structure about gene order and composition is identical to that of the other lemur species and related genera. The overall base composition of the heavy strand in descending order is A (32.84%), T (27.13%), C (26.95%), and G (13.08%). Most of the genes are encoded on the heavy strand except for the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes. With the exception of COX3, which terminates with an incomplete stop codon (T-), all the other PCGs initiates with a traditional ATN start codon and ends with the typical mitochondrial stop codon (TAG/TAA/AGA). The phylogenetic tree constructed using the complete mitochondrial genome sequences of P. verreauxi together with 15 other closely related species with Neighbor-Joining (NJ) method shows that P. verreauxi is closer to P. coquereli in the phylogenetic relationship.

RevDate: 2022-04-10
CmpDate: 2017-09-05

Nishimura K, Apitz J, Friso G, et al (2015)

Discovery of a Unique Clp Component, ClpF, in Chloroplasts: A Proposed Binary ClpF-ClpS1 Adaptor Complex Functions in Substrate Recognition and Delivery.

The Plant cell, 27(10):2677-2691.

Clp proteases are found in prokaryotes, mitochondria, and plastids where they play crucial roles in maintaining protein homeostasis (proteostasis). The plant plastid Clp machinery comprises a hetero-oligomeric ClpPRT proteolytic core, ATP-dependent chaperones ClpC and ClpD, and an adaptor protein, ClpS1. ClpS1 selects substrates to the ClpPR protease-ClpC chaperone complex for degradation, but the underlying substrate recognition and delivery mechanisms are currently unclear. Here, we characterize a ClpS1-interacting protein in Arabidopsis thaliana, ClpF, which can interact with the Clp substrate glutamyl-tRNA reductase. ClpF and ClpS1 mutually stimulate their association with ClpC. ClpF, which is only found in photosynthetic eukaryotes, contains bacterial uvrB/C and YccV protein domains and a unique N-terminal domain. We propose a testable model in which ClpS1 and ClpF form a binary adaptor for selective substrate recognition and delivery to ClpC, reflecting an evolutionary adaptation of the Clp system to the plastid proteome.

RevDate: 2018-12-02
CmpDate: 2016-07-18

Manna S, A Harman (2016)

Horizontal gene transfer of a Chlamydial tRNA-guanine transglycosylase gene to eukaryotic microbes.

Molecular phylogenetics and evolution, 94(Pt A):392-396.

tRNA-guanine transglycosylases are found in all domains of life and mediate the base exchange of guanine with queuine in the anticodon loop of tRNAs. They can also regulate virulence in bacteria such as Shigella flexneri, which has prompted the development of drugs that inhibit the function of these enzymes. Here we report a group of tRNA-guanine transglycosylases in eukaryotic microbes (algae and protozoa) which are more similar to their bacterial counterparts than previously characterized eukaryotic tRNA-guanine transglycosylases. We provide evidence demonstrating that the genes encoding these enzymes were acquired by these eukaryotic lineages via horizontal gene transfer from the Chlamydiae group of bacteria. Given that the S. flexneri tRNA-guanine transglycosylase can be targeted by drugs, we propose that the bacterial-like tRNA-guanine transglycosylases could potentially be targeted in a similar fashion in pathogenic amoebae that possess these enzymes such as Acanthamoeba castellanii. This work also presents ancient prokaryote-to-eukaryote horizontal gene transfer events as an untapped resource of potential drug target identification in pathogenic eukaryotes.

RevDate: 2015-12-28
CmpDate: 2016-09-30

Noguchi F, Shimamura S, Nakayama T, et al (2015)

Metabolic Capacity of Mitochondrion-related Organelles in the Free-living Anaerobic Stramenopile Cantina marsupialis.

Protist, 166(5):534-550.

Functionally and morphologically degenerate mitochondria, so-called mitochondrion-related organelles (MROs), are frequently found in eukaryotes inhabiting hypoxic or anoxic environments. In the last decade, MROs have been discovered from a phylogenetically broad range of eukaryotic lineages and these organelles have been revealed to possess diverse metabolic capacities. In this study, the biochemical characteristics of an MRO in the free-living anaerobic protist Cantina marsupialis, which represents an independent lineage in stramenopiles, were inferred based on RNA-seq data. We found transcripts for proteins known to function in one form of MROs, the hydrogenosome, such as pyruvate:ferredoxin oxidoreductase, iron-hydrogenase, acetate:succinate CoA-transferase, and succinyl-CoA synthase, along with transcripts for acetyl-CoA synthetase (ADP-forming). These proteins possess putative mitochondrial targeting signals at their N-termini, suggesting dual ATP generation systems through anaerobic pyruvate metabolism in Cantina MROs. In addition, MROs in Cantina were also shown to share several features with canonical mitochondria, including amino acid metabolism and an "incomplete" tricarboxylic acid cycle. Transcripts for all four subunits of complex II (CII) of the electron transport chain were detected, while there was no evidence for the presence of complexes I, III, IV, or F1Fo ATPase. Cantina MRO biochemistry challenges the categories of mitochondrial organelles recently proposed.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Wang FY, Wang TY, Liao TY, et al (2016)

The complete mitochondrial genome sequence of Nemateleotris decora (gobiiformes, gobiidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4274-4275.

We determined the mitochondrial genome (mitogenome) sequence of Nemateleotris decora by using a long polymerase chain reaction (PCR) method and next-generation sequence (NGS) technology. The total length of N. decora mitogenome is 16 502 bp, consisting of 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region. The overall base composition of N. decora is 25.22% for A, 25.90% for T, 30.69% for G, and 18.19% for C. Our results showed the complete mitogenome is a good marker for the phylogenetic study.

RevDate: 2018-11-13
CmpDate: 2016-06-01

Greig K, Boocock J, Prost S, et al (2015)

Complete Mitochondrial Genomes of New Zealand's First Dogs.

PloS one, 10(10):e0138536.

Dogs accompanied people in their migrations across the Pacific Ocean and ultimately reached New Zealand, which is the southern-most point of their oceanic distribution, around the beginning of the fourteenth century AD. Previous ancient DNA analyses of mitochondrial control region sequences indicated the New Zealand dog population included two lineages. We sequenced complete mitochondrial genomes of fourteen dogs from the colonisation era archaeological site of Wairau Bar and found five closely-related haplotypes. The limited number of mitochondrial lineages present at Wairau Bar suggests that the founding population may have comprised only a few dogs; or that the arriving dogs were closely related. For populations such as that at Wairau Bar, which stemmed from relatively recent migration events, control region sequences have insufficient power to address questions about population structure and founding events. Sequencing mitogenomes provided the opportunity to observe sufficient diversity to discriminate between individuals that would otherwise be assigned the same haplotype and to clarify their relationships with each other. Our results also support the proposition that at least one dispersal of dogs into the Pacific was via a south-western route through Indonesia.

RevDate: 2026-01-27
CmpDate: 2016-09-27

Marangi M, Hall MJ, Aitken A, et al (2016)

Origins of Wohlfahrtia magnifica in Italy based on the identification of mitochondrial cytochrome b gene haplotypes.

Parasitology research, 115(2):483-487.

To identify the geographical origins of larvae of Wohlfahrtia magnifica (Diptera: Sarcophagidae) causing myiasis of sheep in Italy, comparative DNA sequence analysis of the mitochondrial cytochrome b gene was performed, based on gene fragments amplified by PCR from genomic DNA isolated from individual specimens. DNA extractions of 19 larvae from Lazio, Molise, Puglia, and Sicilia generated 17 readable sequences homologous to 2 haplotypes, either CB_magn01 or CB_magn02; DNA extracts from 4 adult flies from Calabria (reared from larvae) produced 4 readable sequences belonging to the haplotype CB_magn01. The two haplotypes found represent both the East and West phylogenetic lineages of W. magnifica, which is consistent with the species' arrival from central/southeast Europe (East lineage) and/or from southwest Europe/northwest Africa (West lineage). This is the first report of the sympatric occurrence of the two lineages, which could have resulted from natural or human-assisted dispersal. Polymorphic nuclear loci will have to be characterized in order to explain the origins and lack of mitochondrial haplotype diversity of this pest in Italy, where it poses increasing veterinary problems.

RevDate: 2018-05-11
CmpDate: 2018-01-18

Liu F, Bao X, Fan Y, et al (2016)

Sequencing and analysis of the complete mitochondrial genome of Brown Shrike, Lanius cristatus (Passeriformes, Laniidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3544-3546.

The complete mitochondrial genome of the Brown Shrike (Lanius cristatus) was 16 821 bp in length. The accession number was KT004451 and the contents of A, T, C, and G were 31.10%(5237 bp), 25.60%(4309 bp), 28.60%(4814 bp), and 14.60%(2461 bp), respectively. Gene organization and length was similar to other species of birds. It comprises of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. All protein-coding genes use the typical initiation codon ATG, except for COX1 which was initiated with GTG. All the complete stop codon was coincident with the Black-headed Gull (Chroicocephalus ridibundus) and the Grey-backed Shrike (Lanius tephronotus), except for ND2, which was terminated with TAG. In addition, the phylogenetic relationships of Passeriformes based on complete mitochondrial genomes showed that the genetic distance of Laniidae and Corvidae was closer than others.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Sun Z, Wang B, Sun X, et al (2016)

Phylogenetic studies of Anas clypeata (Anatidae: Anas) based on complete mitochondrial DNA sequences.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4320-4321.

Northern shoveler (Anas clypeata) is a middle-sized duck living in an extremely geographical range in northern hemisphere. Here, the complete mitochondrial genome of A. clypeata (16 599 bp in length) has been analyzed for building the database. Similar to the typical mtDNA of vertebrates, it contained 37 genes (13 protein-coding genes, 2 rRNA genes and 22 tRNA genes) and a non-coding region (D-loop). Overall base composition of the complete mitochondrial DNA is A (29.4%), G (15.7%), C (32.5%) and T (22.4%), the percentage of A and T (51.8%) is slightly higher than G and C (48.2%). All the genes in A. clypeata were distributed on the H-strand, except for the ND6 subunit gene and 9 tRNA genes which were encoded on the L-strand. The phylogenetic relationships of 12 Anatidae species were reconstructed based on the complete mtDNA sequences using the Bayesian inference method.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Hao RC, Wang GH, Yang GZ, et al (2016)

The complete mitochondrial genome sequence of Zebrias crossolepis (pleuronectiformes: soleidae) and Acrossocheilus monticola (cypriniformes: cyprinidae) and phylogenetic studies.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4326-4327.

In this study, two complete mitogenome sequences of Zebrias crossolepis and Acrossocheilus monticola were determined and the phylogenetic relationship were constructed based on concatenated nucleotide sequences of 12 mitochondrial protein-coding genes. The length of the complete mitogenome sequence are 16 775 bp and 16 605 bp in Z. crossolepis and A. monticola, respectively, both containing 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a putative control region (CR), and a light-strand replication origin (OL). The overall base composition is 28.3% A, 26.3% T, 30.0% C, 15.5% G, with a slight AT bias (54.6%) in Z. crossolepis, while 31.4% A, 24.5% T, 28.2% C, 15.9% G, with an slight AT bias (55.9%) in A. monticola. All the protein-coding genes use the initiation codon ATG except COI uses GTG. Most of them have TAA or TAG as the stop codon, while ND4 and Cytb in Z. crossolepis and COII, ND4, and Cytb in A. monticola use an incomplete stop codon T. These results are expected to provide useful molecular data for species identification and further phylogenetic studies.

RevDate: 2026-01-27
CmpDate: 2018-01-29

Doña J, Ruiz-Ruano FJ, R Jovani (2016)

DNA barcoding of Iberian Peninsula and North Africa Tawny Owls Strix aluco suggests the Strait of Gibraltar as an important barrier for phylogeography.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4475-4478.

Eight subspecies have been proposed within the Tawny Owl (Strix aluco) species. However, recent molecular data have challenged this view, encouraging further work in this species complex. Here we reevaluated the taxonomic status between the North-Western African Tawny Owl, S. a. mauritanica, and its closest Iberian Tawny Owl population (from the S. a. sylvatica to S. a. aluco clade) separated by the Strait of Gibraltar. The Tawny Owl is a non-migratory and territorial species, and juvenile dispersal is restricted to a few kilometers around the natal site. This limited dispersal and the barrier imposed by the Strait of Gibraltar predicted a strong differentiation between the two populations. We tested this using DNA barcoding, Bayesian phylogenetic and species delimitation analysis. We found that an 81.1% of variation is due to the intergroups variation. In addition, the inter-intraspecific distances distribution revealed a barcoding gap among the two subspecies. Also, posterior probabilities and the PAB value allowed to reject the hypothesis that observed degree of distinctiveness is due to random coalescence processes. These findings clearly support the Strait of Gibraltar as an isolating barrier for this species. The subspecific status is confirmed and species status is even suggested for S. a. mauritanica.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Chen D, Zhang K, Liu S, et al (2016)

The complete mitochondrial genome of the Dipodomys ordii (Ord's kangaroo rat).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4322-4323.

Ord's kangaroo rat is a kangaroo rat native to western North America. In this study, we first reported the complete mitochondrial genome of Dipodomys ordii that the first has the complete mitochondrial genome in the genus of Heteromyidae. The mitogenome is a circular molecule of 16 257 bp in length, containing 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs and a putative displacement loop region. All protein-coding genes started with a traditional ATN codon and terminated with the mitochondria stop codon (TAA/TAG/AGA) or a single T base. The gene order and composition of mitogenome was similar to that of most other Sciurognathi species and its GC content was 36.73%. Thirteen protein-coding genes of D. ordii together with eight other closely species were used to construct the species phylogenetic tree for verification of the accuracy of new determined mitogenome sequences.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Yang H, Bao X, Wang B, et al (2016)

The complete mitochondrial genome of Chirolophis japonicus (Perciformes: Stichaeidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4419-4420.

The complete mitochondrial genome of Chirolophis japonicus was sequenced for the first time in this study. It is a closed-circular molecule of 16 521 bp in length and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, an origin of light strand replication (OL), and a control region (CR). The overall base composition of the heavy-strand is 25.5% A, 28.6% T, 18.3% G, and 27.6% C, and the lengths of 2 rRNA genes are 946 and 1692 bp, respectively. Maximum likelihood tree based on all the amino acid sequences of 13 mitochondrial PCGs was constructed, in which C. japonicus is close to three species of infraorder Zoarcales. These results are expected to provide useful molecular data for species identification and further phylogenetic studies of genus Chirolophis.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Li Z, Chen Z, Gao J, et al (2016)

The complete mitochondrial genome of the Symphysodon aequifasciatus (Pellegrin, 1904).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4425-4426.

In this study, the complete mitogenome sequence of the Symphysodon aequifasciatus has been sequenced by next-generation sequencing method. The mitogenome consists of 16 545 bp, including 13 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs genes. The overall base composition of the fish is 28.8% for A, 30.1% for C, 15.0% for G, and 26.1% for T, suggesting a 99% identity to S. discus Heckel and a 98% identity to S. haraldi. It provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for Symphysodon phylogeny.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Liu J, Jin W, C Wu (2016)

The first complete mitochondrial genome of Serranidae sp. (Percoidea, Serranidae) and phylogenetic analysis based on Bayesian.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4436-4438.

In the present study, the complete mitochondrial genome of Serranidae sp. was determined first. The entire mitochondrial genome of Serranidae sp. is 16 512 bp in length, containing 13 protein-coding genes and 2 ribosomal RNA genes (rRNA), 22 transfer RNA genes (tRNA) and 2 main non-coding regions (the control region and the origin of the light-strand replication). The gene arrangement, base composition and tRNA structures of Serranidae sp. are similar to most of the bony fishes. The central conserved sequence blocks (CSB-1, CSB-2, and CSB-3) and the core sequence (ACATATATGT) of terminal-associated sequences were recognized in the control region. Meanwhile, the conserved motif 5'-GCCGG-3' was identified in the origin of light-strand replication of Serranidae sp. Phylogenetic tree, which is constructed based on the complete mitochondrial genome sequences of Serranidae sp., shows that Serranidae sp. is clustered with the fishes of the family Pentacerotidae. We expect that the mitochondrial genome of Serranidae sp. would play a key role in phylogenetic analysis of Serranidae.

RevDate: 2026-01-27
CmpDate: 2018-01-23

Liu JB, Zeng YF, Yuan C, et al (2016)

The complete mitochondrial genome sequence of the dwarf blue sheep, Pseudois schaeferi haltenorth in China.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4411-4413.

The dwarf blue sheep (Pseudois schaeferi haltenorth) belongs the subfamily Caprinae, which is distributed in Sichuan, Tibet, Yunnan, and Qinghai in China. In this study, the complete mitochondrial genome of Pseudois schaeferi haltenorth was sequenced. The mitogenome was 16 741 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region (D-loop region). As in other mammals, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the Pseudois schaeferi haltenorth is 33.54% A, 26.37% T, 26.91% C, and 13.18% G, A + T (59.91%) was higher than G + C (40.09%). The phylogenetic relationships was analyzed using the complete mitogenome sequence, results show that P. schaeferi haltenorth should be a different species differ from the Genus pseudois hodgson. These information provide useful data for further study on the protection of genetic resources and the taxonomy of Caprinae.

RevDate: 2018-11-13
CmpDate: 2016-10-07

Nuralitha S, Siregar JE, Syafruddin D, et al (2016)

Within-Host Selection of Drug Resistance in a Mouse Model of Repeated Incomplete Malaria Treatment: Comparison between Atovaquone and Pyrimethamine.

Antimicrobial agents and chemotherapy, 60(1):258-263.

The evolutionary selection of malaria parasites within individual hosts is an important factor in the emergence of drug resistance but is still not well understood. We have examined the selection process for drug resistance in the mouse malaria agent Plasmodium berghei and compared the dynamics of the selection for atovaquone and pyrimethamine. Resistance to these drugs has been shown to be associated with genetic lesions in the dihydrofolate reductase gene in the case of pyrimethamine and in the mitochondrial cytochrome b gene for atovaquone. A mouse malaria model for the selection of drug resistance, based on repeated incomplete treatment (RICT) with a therapeutic dose of antimalarial drugs, was established. The number of treatment cycles for the development of stable resistance to atovaquone (2.47 ± 0.70; n = 19) was found to be significantly lower than for pyrimethamine (5.44 ± 1.46; n = 16; P < 0.0001), even when the parental P. berghei Leiden strain was cloned prior to the resistance selection. Similar results were obtained with P. berghei Edinburgh. Mutational changes underlying the resistance were identified to be S110N in dihydrofolate reductase for pyrimethamine and Y268N, Y268C, Y268S, L271V-K272R, and G280D in cytochrome b for atovaquone. These results are consistent with the rate of mitochondrial DNA mutation being higher than that in the nucleus and suggest that mutation leading to pyrimethamine resistance is not a rare event.

RevDate: 2026-01-27
CmpDate: 2016-12-13

Ogata T, Senoo T, Kawano S, et al (2016)

Mitochondrial superoxide dismutase deficiency accelerates chronological aging in the fission yeast Schizosaccharomyces pombe.

Cell biology international, 40(1):100-106.

A mitochondrial superoxide dismutase (SOD2) is the first line of antioxidant defense against mitochondrial superoxide. Even though the involvement of SOD2 in lifespan has been studied extensively in several organisms, characterization of the aging process has not been performed for the sod2 mutant (sod2Δ) of a prominent model Schizosaccharomyces pombe. In this study, we measured the chronological lifespan of sod2Δ cells by their ability to survive in long-term culture. SOD2 deficiency drastically decreased cell viability in the stationary phase. The mutation frequency of nuclear DNA in sod2Δ was elevated in the stationary phase, and cellular proteins and nuclear DNA were extensively degraded, concurrent with cell death. The sod2 gene in wild-type cells could be induced by an increase in endogenous oxidative stresses, after which, SOD2 activity was substantially elevated during the stationary phase. Culture in a lower glucose concentration (calorie restriction) prominently extended the sod2Δ lifespan. Therefore, S. pombe SOD2 plays a critical role in longevity through its upregulation in the non-dividing phase.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Yu P, Yang QC, Ding SQ, et al (2016)

The complete sequence of mitochondrial genome of Sinibotia pulchra (Cypriniformes: Cobitidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4318-4319.

Sinibotia pulchra (Cypriniformes: Cobitidae) is a small cyprinid fish. In this study, the complete mitochondrial genome sequence of S. pulchra is sequenced. The S. pulchra complete mitochondrial genome (GenBank accession no. KT362179) was a circular molecule of 16 568 bp in length, with 13 protein-coding genes (PCGs), 2 ribosome RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, an L-strand replication origin (OL) and a control region (D-loop). The nucleotide acid composition of the entire mitogenome was 31.69% for A, 25.63% for T, 26.94% for C and 15.74% for G, with an AT content of 57.32%. The AT content of 12S rRNA, 16S rRNA and D-loop was 50.21%, 56.86% and 66.74%, respectively.

RevDate: 2025-05-29
CmpDate: 2016-08-31

Schaedler TA, Faust B, Shintre CA, et al (2015)

Structures and functions of mitochondrial ABC transporters.

Biochemical Society transactions, 43(5):943-951.

A small number of physiologically important ATP-binding cassette (ABC) transporters are found in mitochondria. Most are half transporters of the B group forming homodimers and their topology suggests they function as exporters. The results of mutant studies point towards involvement in iron cofactor biosynthesis. In particular, ABC subfamily B member 7 (ABCB7) and its homologues in yeast and plants are required for iron-sulfur (Fe-S) cluster biosynthesis outside of the mitochondria, whereas ABCB10 is involved in haem biosynthesis. They also play a role in preventing oxidative stress. Mutations in ABCB6 and ABCB7 have been linked to human disease. Recent crystal structures of yeast Atm1 and human ABCB10 have been key to identifying substrate-binding sites and transport mechanisms. Combined with in vitro and in vivo studies, progress is being made to find the physiological substrates of the different mitochondrial ABC transporters.

RevDate: 2019-01-09
CmpDate: 2016-09-26

Wagner S, Behera S, De Bortoli S, et al (2015)

The EF-Hand Ca2+ Binding Protein MICU Choreographs Mitochondrial Ca2+ Dynamics in Arabidopsis.

The Plant cell, 27(11):3190-3212.

Plant organelle function must constantly adjust to environmental conditions, which requires dynamic coordination. Ca(2+) signaling may play a central role in this process. Free Ca(2+) dynamics are tightly regulated and differ markedly between the cytosol, plastid stroma, and mitochondrial matrix. The mechanistic basis of compartment-specific Ca(2+) dynamics is poorly understood. Here, we studied the function of At-MICU, an EF-hand protein of Arabidopsis thaliana with homology to constituents of the mitochondrial Ca(2+) uniporter machinery in mammals. MICU binds Ca(2+) and localizes to the mitochondria in Arabidopsis. In vivo imaging of roots expressing a genetically encoded Ca(2+) sensor in the mitochondrial matrix revealed that lack of MICU increased resting concentrations of free Ca(2+) in the matrix. Furthermore, Ca(2+) elevations triggered by auxin and extracellular ATP occurred more rapidly and reached higher maximal concentrations in the mitochondria of micu mutants, whereas cytosolic Ca(2+) signatures remained unchanged. These findings support the idea that a conserved uniporter system, with composition and regulation distinct from the mammalian machinery, mediates mitochondrial Ca(2+) uptake in plants under in vivo conditions. They further suggest that MICU acts as a throttle that controls Ca(2+) uptake by moderating influx, thereby shaping Ca(2+) signatures in the matrix and preserving mitochondrial homeostasis. Our results open the door to genetic dissection of mitochondrial Ca(2+) signaling in plants.

RevDate: 2015-11-05
CmpDate: 2016-08-17

Andrade BS, A Góes-Neto (2015)

Phylogenetic analysis of DNA and RNA polymerases from a Moniliophthora perniciosa mitochondrial plasmid reveals probable lateral gene transfer.

Genetics and molecular research : GMR, 14(4):14105-14114 pii:gmr6904.

The filamentous fungus Moniliophthora perniciosa is a hemibiotrophic basidiomycete that causes witches' broom disease of cacao (Theobroma cacao L.). Many fungal mitochondrial plasmids are DNA and RNA polymerase-encoding invertrons with terminal inverted repeats and 5'-linked proteins. The aim of this study was to carry out comparative and phylogenetic analyses of DNA and RNA polymerases for all known linear mitochondrial plasmids in fungi. We performed these analyses at both gene and protein levels and assessed differences between fungal and viral polymerases in order to test the lateral gene transfer (LGT) hypothesis. We analyzed all mitochondrial plasmids of the invertron type within the fungal clade, including five from Ascomycota, seven from Basidiomycota, and one from Chytridiomycota. All phylogenetic analyses generated similar tree topologies regardless of the methods and datasets used. It is likely that DNA and RNA polymerase genes were inserted into the mitochondrial genomes of the 13 fungal species examined in our study as a result of different LGT events. These findings are important for a better understanding of the evolutionary relationships between fungal mitochondrial plasmids.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Shi X, Zhu Q, Wu N, et al (2016)

The complete nucleotide sequence of the mitochondrial genome of Drosophila formosana (Diptera: Drosophilidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4316-4317.

Drosophila formosana (Diptera: Drosophilidae) belongs to the Drosophilidae group of Drosophila. The mitochondrial genome sequence of Drosophila formosana is determined in this study. Mitochondrion of D. formosana is a circular DNA molecule of the 16 100 nucleotide pairs (bp) that contains one encoding region including 37 genes and 1 non-coding A + T-rich region. The similarity and typicality have been showed by the structure and organization analysis. All genes are arranged in the circular DNA molecule. In addition to DN5 that use GTG start codon, all other protein-coding genes (PCGs) start with an ATN start codon. Ten protein-coding genes stop with the termination codon TAN, while other protein-coding genes (PCGs) used incomplete termination codon TA- (cox2, nad5, nad1). The A + T-rich region with a length of 1088 bp is located between rrnS and trnI. The mitochondrial genome of D. formosana has been completely sequenced for the first time in this study.

RevDate: 2019-08-16
CmpDate: 2015-12-08

Titov VN (2015)

[THE BIOLOGICAL FUNCTION OF NUTRITION, BIOLOGICAL REACTION OF EXOTROPHY, DEPOSITING AND ENDOTROPHY. THE VISCERAL FATTY CELLS AND ADIPOCYTES - PHYLOGENETICALLY, FUNCTIONALLY AND REGULATORY DIFFERENT POOLS OF FATTY TISSUE].

Klinicheskaia laboratornaia diagnostika, 60(8):14-23.

For billions years, two phylogenetically, functionally and regulatory different pools of fatty cells - visceral fatty acids and adipocytes coexist in vivo. Their becoming occurred at different degrees of phylogenesis. The phylogenetically earlier pool of visceral fatty acids is meant to supply with fatty acids-substrates for gaining energy by those cells which implement biological function of nutrition (trophology), homeostasis, endoecology biological function of adaptation and continuation of species. They have no receptors to phylogenetically later insulin. The adipocytes, later in phylogenesis, implement one biological function - the function of locomotion and they are as insulin-dependent as skeletal myocytes, cardiomyocytes, adipocytes and periportal hepatocytes. The difference in regulation is traced on all levels of "biological perfection " - autocrine (cellular) level, in humoral regulated paracrin cenosises of cells and on the level of organism. In biological function of trophology, paracrin cenosises of visceral fatty acids and adipocytes implement subsequently three biological reactions: exotrophy, deposit of fatty acids and endotrophy. In conditions of humoral regulation of three functionally different biological reactions in paracrin cenosises synthesis of so many humoral mediators is required. The humoral mediators of mechanism of feedback at autocrine level, in paracrin cenosises and at the level of organism are leptin of visceral fatty acids and adiponectin of adipocytes. At the level of organism, phylogenetically earlier paracrin cenosises of fatty cells are regulated by endocrine system. The phylogenetically later paracrin cenosises are regulated by insulin and nuclei of hypothalamus. The metabolic syndrome is a pathology of phylogenetically earlier insulin-independent visceral fatty acids. The obesity is a pathology of phylogenetically later pool of insulin-dependent adipocytes.

RevDate: 2026-01-27
CmpDate: 2016-10-24

Sherrard-Smith E, Stanton DW, Cable J, et al (2016)

Distribution and molecular phylogeny of biliary trematodes (Opisthorchiidae) infecting native Lutra lutra and alien Neovison vison across Europe.

Parasitology international, 65(2):163-170.

The recent identification of Pseudamphistomum truncatum, (Rudolphi, 1819) (Trematoda: Opisthorchiidae) and Metorchis bilis (Braun, 1790) Odening, 1962 (synonymous with Metorchis albidus (Braun, 1893) Loos, 1899 and Metorchis crassiusculus (Rudolphi, 1809) Looss, 1899 (Trematoda: Opisthorchiidae)) in otters from Britain caused concern because of associated biliary damage, coupled with speculation over their alien status. Here, we investigate the presence, intensity and phylogeny of these trematodes in mustelids (principally otters) across Europe (Czech Republic, Denmark, France, Germany, Norway, Poland and Sweden and Britain). The trematodes were identified to species using the internal transcribed spacer II (ITS2) locus. Both parasites were found across Europe but at unequal frequency. In the German state of Saxony, eight out of eleven (73%) otters examined were infected with P. truncatum whilst this parasite was not found in either mink from Scotland (n=40) or otters from Norway (n=21). Differences in the phylogenies between the two species suggest divergent demographic histories possibly reflecting contrasting host diet or competitive exclusion, with M. bilis exhibiting greater mitochondrial diversity than P. truncatum. Shared haplotypes within the ranges of both parasite species probably reflect relatively unrestricted movements (both natural and anthropogenic) of intermediate and definitive hosts across Europe.

RevDate: 2015-12-02
CmpDate: 2016-09-12

Janardan N, Harijan RK, Kiema TR, et al (2015)

Structural characterization of a mitochondrial 3-ketoacyl-CoA (T1)-like thiolase from Mycobacterium smegmatis.

Acta crystallographica. Section D, Biological crystallography, 71(Pt 12):2479-2493.

Thiolases catalyze the degradation and synthesis of 3-ketoacyl-CoA molecules. Here, the crystal structures of a T1-like thiolase (MSM-13 thiolase) from Mycobacterium smegmatis in apo and liganded forms are described. Systematic comparisons of six crystallographically independent unliganded MSM-13 thiolase tetramers (dimers of tight dimers) from three different crystal forms revealed that the two tight dimers are connected to a rigid tetramerization domain via flexible hinge regions, generating an asymmetric tetramer. In the liganded structure, CoA is bound to those subunits that are rotated towards the tip of the tetramerization loop of the opposing dimer, suggesting that this loop is important for substrate binding. The hinge regions responsible for this rotation occur near Val123 and Arg149. The Lα1-covering loop-Lα2 region, together with the Nβ2-Nα2 loop of the adjacent subunit, defines a specificity pocket that is larger and more polar than those of other tetrameric thiolases, suggesting that MSM-13 thiolase has a distinct substrate specificity. Consistent with this finding, only residual activity was detected with acetoacetyl-CoA as the substrate in the degradative direction. No activity was observed with acetyl-CoA in the synthetic direction. Structural comparisons with other well characterized thiolases suggest that MSM-13 thiolase is probably a degradative thiolase that is specific for 3-ketoacyl-CoA molecules with polar, bulky acyl chains.

RevDate: 2015-12-04
CmpDate: 2016-09-15

Xu X, Tan YP, Cheng G, et al (2015)

Genomic survey and gene expression analysis of the VDAC gene family in rice.

Genetics and molecular research : GMR, 14(4):15683-15696 pii:gmr6735.

The voltage-dependent anion channel (VDAC), also known as a mitochondrial porin, plays an important role in the regulation of metabolic and energetic functions of mitochondria, as well as in mitochondria-mediated apoptosis. Cytoplasmic male sterility (CMS) is of major economic importance for commercial hybrid production and a research model for the interaction be-tween nuclear and cytoplasmic genomes. Recent research has revealed that CMS is associated with programmed cell death. Here, we used the Honglian (HL)-CMS line of rice (Oryza sativa) as material to investigate the association of O. sativa VDAC (OsVDAC) expression to CMS. Eight VDACs were extracted from rice in this study. Bioinformatic analysis of the rice VDACs was conducted at the DNA, cDNA, and protein level. Expression patterns of OsVDACs were analyzed in different organs and during different stages of pollen development using sterile line YuetaiA (YTA), and its maintainer line YuetaiB (YTB). Differential expression of OsVDACs between YTA and YTB was observed, suggesting that VDACs may be involved in the formation of HL-CMS.

RevDate: 2023-07-26
CmpDate: 2016-05-16

Huchon D, Szitenberg A, Shefer S, et al (2015)

Mitochondrial group I and group II introns in the sponge orders Agelasida and Axinellida.

BMC evolutionary biology, 15:278.

BACKGROUND: Self-splicing introns are present in the mitochondria of members of most eukaryotic lineages. They are divided into Group I and Group II introns, according to their secondary structure and splicing mechanism. Being rare in animals, self-splicing introns were only described in a few sponges, cnidarians, placozoans and one annelid species. In sponges, three types of mitochondrial Group I introns were previously described in two demosponge families (Tetillidae, and Aplysinellidae) and in the homoscleromorph family Plakinidae. These three introns differ in their insertion site, secondary structure and in the sequence of the LAGLIDADG gene they encode. Notably, no group II introns have been previously described in sponges.

RESULTS: We report here the presence of mitochondrial introns in the cytochrome oxidase subunit 1 (COI) gene of three additional sponge species from three different families: Agelas oroides (Agelasidae, Agelasida), Cymbaxinella (p) verrucosa (Hymerhabdiidae, Agelasida) and Axinella polypoides (Axinellidae, Axinellida). We show, for the first time, that sponges can also harbour Group II introns in their COI gene, whose presence in animals' mitochondria has so far been described in only two phyla, Placozoa and Annelida. Surprisingly, two different Group II introns were discovered in the COI gene of C. verrucosa. Phylogenetic analysis indicates that the Group II introns present in C. verrucosa are related to red algae (Rhodophyta) introns.

CONCLUSIONS: The differences found among intron secondary structures and the phylogenetic inferences support the hypothesis that the introns originated from independent horizontal gene transfer events. Our results thus suggest that self-splicing introns are more diverse in the mitochondrial genome of sponges than previously anticipated.

RevDate: 2018-05-11
CmpDate: 2018-01-18

Huang R, Zhou Y, Yao Y, et al (2016)

Complete mitochondrial genome and phylogenetic relationship analysis of Garrulax affinis (Passeriformes, Timaliidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(5):3502-3503.

Garrulax affinis was a medium-sized bird of Timaliidae, and we got its complete mitochondrial genome by the polymerase chain reaction method (PCR). The genome (17 856 in length), it contained 13 protein-coding genes, 2 rRNA (12S and 16S) genes, 2 tRNA genes, 2 control regions (D-loop). All protein-coding, rRNA, and tRNA genes were similar to other Passeriformes in gene arrangement and composition. In 13 PCGs, 12 were initiated with ATG, only COI was GTG, and stopped by five types of stop codons. We constructed a phylogenetic tree based on 13 PCGs of G. affinis and other nine Timaliidae species, found that the species belong to the same Passeriformes all cluster together.

RevDate: 2018-05-14
CmpDate: 2018-05-03

Chen X, Chen Y, Yu M, et al (2017)

The complete mitochondrial genome of the Azuma emmnion.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(1):77-78.

The complete mitochondrial genome of the Azuma emmnion has been determined. The total length of a complete nucleotide sequence of the mitochondria is 16 522 bp, which contained 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and one D-loop region. Its nucleotide sequence and composition of A. emmnion mitochondrion was similar to most other vertebrates. Nucleotide base composition of mitochondrial genome was the following: 25.58% for A, 18.22% for G, 27.67% for C, 28.53% for T. The phylogenetic analysis result, which based on the complete mitogenomes of of A. emmnion and other 11 fish species, indicated that A. emmnion and Pholis crassispina clustered into one branch.

RevDate: 2018-03-13
CmpDate: 2018-01-23

Konovalova O, M Logacheva (2016)

Mitochondrial genome of two marine fungal species.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 27(6):4280-4281.

Here is a first record for a mitochondrial genome of marine fungus Acremonium fuci and closely related species Emericellopsis sp. One strain for each species, differentiated by morphological features was studied. Complete mitochondrial sequences are 24 565 and 24 951 bp in length. The circular molecule encodes all genes typical for fungal mitochondrial genomes: 15 protein-coding genes, 28 tRNAs, and large and small subunits of RNA. All structural genes are located on one strand and transcribed in one direction. Mitogenomes of species have 99% identity in protein-coding genes, but differ in some structural features: one of them has additional ORF with a similarity to cox1 gene, and another one has an intron in nad5 gene.

RevDate: 2018-12-02
CmpDate: 2018-04-05

Lütz-Meindl U, Luckner M, Andosch A, et al (2016)

Structural stress responses and degradation of dictyosomes in algae analysed by TEM and FIB-SEM tomography.

Journal of microscopy, 263(2):129-141.

Stress-induced physiological deficiencies in cells are reflected in structural, morphological and functional reactions of organelles. Although numerous investigations have focused on chloroplasts and mitochondria as main targets of different stressors in plant cells, there is insufficient information on the plant Golgi apparatus as stress sensor. By using the advantages of field emission scanning electron microscopy tomography in combination with classical ultrathin sectioning and transmission electron microscopic analyses, we provide structural evidence for common stress responses of the large and highly stable dictyosomes in the algal model system Micrasterias. Stress is induced by different metals such as manganese and lead, by starvation in 9 weeks of darkness or by inhibiting photosynthesis or glycolysis and by disturbing ionic homeostasis via KCl. For the first time a stress-induced degradation pathway of dictyosomes is described that does not follow "classical" autophagy but occurs by disintegration of cisternae into single membrane balls that seem to be finally absorbed by the endoplasmic reticulum (ER). Comparison of the morphological features that accompany dictyosomal degradation in Micrasterias to similar reactions observed during the same stress application in Nitella indicates an ubiquitous degradation process at least in algae. As the algae investigated belong to the closest relatives of higher land plants these results may also be relevant for understanding dictyosomal stress and degradation responses in the latter phylogenetic group. In addition, this study shows that two-dimensional transmission electron microscopy is insufficient for elucidating complex processes such as organelle degradation, and that information from three-dimensional reconstructions as provided by field emission scanning electron microscopy tomography is absolutely required for a comprehensive understanding of the phenomenon.

RevDate: 2026-01-27
CmpDate: 2018-05-03

Guo C, Zhang Q, Y Huang (2017)

The complete mitochondrial genome of the Oedaleus infernalis sauss (Orthoptera: Oedipodidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(1):89-90.

The Oedaleus infernalis sauss (Orthoptera: Oedipodidae) is one of the main pests at the rice production area in China, and they mainly feed on leaves and grain of rice. The mitogenome was 15 898 bp long and composed of 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and one putative control region. Most protein-coding genes started with a traditional ATN codon, and terminated with the mitochondria stop codon (TAA/TAG) or a single T-- base. The average A + T content of the O. infernalis sauss mitochondrial genome protein-coding sequence, rRNA, tRNA gene, and A + T-rich region was corresponding well to the A + T bias generally observed in insect mitochondrial genomes. Using the 12 protein-coding genes of O. infernalis sauss in this study, together with 15 other closely species, a preliminary phylogenetic analysis has been carried out.

RevDate: 2020-12-09
CmpDate: 2016-02-18

Zhang Y, Guo L, Zhang S, et al (2015)

[Determining mitochondrial molecular markers suitable for genetic diversity analysis of Cordyceps militaris].

Wei sheng wu xue bao = Acta microbiologica Sinica, 55(7):826-833.

OBJECTIVE: To screen efficient molecular markers suitable for genetic diversity analysis of Cordyceps militaris from mitochondrial DNA.

METHODS: We amplified 12 mitochondrial DNA fragments and 3 nuclear DNA fragments from each of 20 C. militaris isolates and analyzed nucleotide variations on these DNA fragments.

RESULTS: We revealed a greatly higher genetic variation in mitochondrial DNA fragments than in nuclear DNA fragments. Specifically, C. militaris isolates exhibited intron presence/absence diversity in some mitochondrial fragments, and more variable sites were found in mitochondrial fragments than in nuclear fragments. The extent of nucleotide variations also varied by mitochondrial fragment, and intronic proteins seemed to be more vulnerable to amino acid changes than exonic proteins. Genetic diversity increased with the number of molecular markers used.

CONCLUSION: We recommended using (in order) nad3-cox2. cox2-nad5, cox2, cox3, cob, and cox1 for future genetic diversity and population genetic studies of C. militaris.

RevDate: 2018-06-13
CmpDate: 2018-06-04

Liu Y, L Jiang (2017)

The complete mitochondrial genome sequence of the Himalayan goral, Naemorhedus goral (Cetartiodactyla: Caprinae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(2):233-235.

The Himalayan goral (Naemorhedus goral) belongs to the subfamily Caprinae, which is distributed across the Himalayas including Bhutan, northern India including Sikkim and Arunachal Pradesh, Nepal, southern Tibet, and possibly western Myanmar. In this study, the complete mitochondrial genome of N. goral was sequenced. The mitogenome was 16 533 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region. As in other mammals, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the N. goral is 33.7% A, 27.2% T, 26.0% C, and 13.1% G. Phylogenetic analysis based on the mitogenome sequences using the Bayesian inferences method showed that Naemorhedus and Capricornis formed a monophyletic group and the N. goral was closely related to N. griseus. We expect that the present results will facilitate further investigation of the phylogenetic relationships and population genetics of genus Naemorhedus.

RevDate: 2026-01-27
CmpDate: 2018-06-04

Jiang L, Zhao L, Liu Y, et al (2017)

The complete mitochondrial genome sequence of the Dark-spotted frog Pelophylax nigromaculatus (Amphibia, Anura, Ranidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(2):236-237.

The dark-spotted frog (Pelophylax nigromaculatus) belongs to Ranidae. This species is known from the Russian Far East, central, northern and north-eastern China, the Democratic People's Republic of Korea, the Republic of Korea, and Japan. In this study, the complete mitochondrial genome of P. nigromaculatus was sequenced. The mitogenome was 17 567 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region. As in other vertebrates, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the P. nigromaculatus is 29.2% A, 27.4% T, 28.4% C, and 15.0% G. Phylogenetic analysis showed P. nigromaculatus was closely related to P. plancyi and P. chosenicus. The complete mitogenome of P. nigromaculatus can provide important data for the studies on phylogenetic relationship and population genetics to further explore the taxonomic status of this species.

RevDate: 2018-06-13
CmpDate: 2018-06-04

Wang P, Chen S, Ou Y, et al (2017)

Complete mitochondrial genome of Toxabramis houdemeri (Cypriniformes; Cyprinidae) and its phylogenetic analysis.

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(2):292-293.

Toxabramis houdemeri belongs to the genus Toxabramis in the subfamily of Cultrinae (Cyprinidae). We first determine the complete mitochondrial genome of T. houdemeri in this study. It is 16 618 bp in length, with the base composition on the heavy strand: 30.79% A, 16.61% G, 27.29% C, and 25.31% T. It has the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and a D-loop region. Phylogenetic analysis showed that T. houdemeri was clustered into one branch of the subfamily of Cultrinae, and closely related to Hemiculter leucisculus. The present study will contribute to genetic resources conservation of T. houdemeri and studying its population genetic structure and phylogenetic relationships.

RevDate: 2018-06-13
CmpDate: 2018-06-04

Urantowka AD, P Mackiewicz (2017)

Complete mitochondrial genome of Blue-winged Macaw (Primolius maracana).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(2):275-276.

abtract The presence of bare facial area distinguishes Macaws from other members of the Arini tribe. Genera and species of the Macaw group differ in pattern of this bare skin as well as in body size. Individuals of the genera: Diopsittaca, Orthopsittaca, and Primolius are significantly smaller than the members of the genera: Anodorhynchus, Cyanopsitta, and the most species of the genus Ara. The genus Primolius contains three species: P. auricollis, P. couloni, and P. maracana, which are classified as medium-sized Macaws. So far, mitochondrial genome representative for the genus was sequenced only for Primolius couloni species. Primolius maracana mitogenome, which was sequenced in this study, will be indispensable to refine the phylogenetic relationships between Primolius species, as results of molecular researches seems to be inconsistent with Primolius species morphology.

RevDate: 2018-05-17
CmpDate: 2018-03-26

Jebb D, Foley NM, Puechmaille SJ, et al (2017)

The complete mitochondrial genome of the Greater Mouse-Eared bat, Myotis myotis (Chiroptera: Vespertilionidae).

Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis, 28(3):347-349.

In this study, we report the complete mitochondrial genome of the Greater Mouse-Eared Bat, Myotis myotis. The mitogenome is 17 213 bp with base composition A (34.2%), G (13%), C (22.4%), and T (30.5%). The genome shows conserved synteny with other mammalian mitogenomes, containing 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and 1 control region (D-Loop). The majority of the genes are encoded on the H-Strand, except for ND6 and eight tRNAs. All protein-coding genes start with the ATG start codon, except for ND2, ND3, and ND5 which begin with ATT or ATA. Seven protein-coding genes terminated in a canonical stop codon, TAA or TAG, five contain incomplete stop codons, T or TA. Cytochrome b terminates in the mitochondria specific stop codon AGA. This mitogenome provides a valuable resource for future studies of M. myotis and other bat and mammal species.

RevDate: 2019-02-22
CmpDate: 2016-06-28

Ye YY, Wu CW, JJ Li (2015)

Genetic Population Structure of Macridiscus multifarius (Mollusca: Bivalvia) on the Basis of Mitochondrial Markers: Strong Population Structure in a Species with a Short Planktonic Larval Stage.

PloS one, 10(12):e0146260.

The clam Macridiscus multifarius with a planktonic larval stage of about 10 days is an ecologically and economically important species in the coastal regions of China. In this study, 3 mt-DNA markers (COI, 12S rRNA, and ND1) were used to investigate the population structure and demography of wild M. multifarius populations in 3 coastal localities of the East China Sea (ZS and ZP populations) and Beibu Gulf in the South China Sea (BH population). Sequences of 685 bp in COI, 350 bp in 12S rRNA, and 496 bp in ND1 were determined. High level and significant FST values were obtained among the different localities on the basis of either COI (FST = 0.100-0.444, p < 0.05) or 12S rRNA (FST = 0.199-0.742, p < 0.05) gene, indicating a high degree of genetic differentiation among the populations. FST values were significant but weak for the ND1 gene because it is highly conservative. The median-joining network suggested an obvious genetic differentiation between ZS and BH populations, and the finding is consistent with the results of our demographic analyses using the unweighted pair group method with arithmetic mean. Our study unraveled the extant population genetic structure of M. multifarius and explained the strong population structure of a species with a short planktonic larval stage species; this information could be useful for fishery management measures, including artificial breeding and conservation.

RevDate: 2019-02-22
CmpDate: 2016-06-30

Mallela SK, Almeida R, Ejsing CS, et al (2016)

Functions of Ceramide Synthase Paralogs YPR114w and YJR116w of Saccharomyces cerevisiae.

PloS one, 11(1):e0145831.

Ceramide is synthesized in yeast by two redundant acyl-CoA dependent synthases, Lag1 and Lac1. In lag1∆ lac1∆ cells, free fatty acids and sphingoid bases are elevated, and ceramides are produced through the redundant alkaline ceramidases Ypc1 and Ydc1, working backwards. Even with all four of these genes deleted, cells are surviving and continue to contain small amounts of complex sphingolipids. Here we show that these residual sphingolipids are not synthesized by YPR114w or YJR116w, proteins of unknown function showing a high degree of homology to Lag1 and Lac1. Indeed, the hextuple lag1∆ lac1∆ ypc1∆ ydc1∆ ypr114w∆ yjr116w∆ mutant still contains ceramides and complex sphingolipids. Yjr116w∆ exhibit an oxygen-dependent hypersensitivity to Cu2+ due to an increased mitochondrial production of reactive oxygen species (ROS) and a mitochondrially orchestrated programmed cell death in presence of copper, but also a general copper hypersensitivity that cannot be counteracted by the antioxidant N-acetyl-cysteine (NAC). Myriocin efficiently represses the synthesis of sphingoid bases of ypr114w∆, but not its growth. Both yjr116w∆ and ypr114w∆ have fragmented vacuoles and produce less ROS than wild type, before and after diauxic shift. Ypr114w∆/ypr114w∆ have an increased chronological life span. Thus, Yjr116w and Ypr114w are related, but not functionally redundant.

RevDate: 2016-12-30
CmpDate: 2016-12-13

Patra AK, Kwon YM, Kang SG, et al (2016)

The complete mitochondrial genome sequence of the tubeworm Lamellibrachia satsuma and structural conservation in the mitochondrial genome control regions of Order Sabellida.

Marine genomics, 26:63-71.

The control region of the mitochondrial genomes shows high variation in conserved sequence organizations, which follow distinct evolutionary patterns in different species or taxa. In this study, we sequenced the complete mitochondrial genome of Lamellibrachia satsuma from the cold-seep region of Kagoshima Bay, as a part of whole genome study and extensively studied the structural features and patterns of the control region sequences. We obtained 15,037 bp of mitochondrial genome using Illumina sequencing and identified the non-coding AT-rich region or control region (354 bp, AT=83.9%) located between trnH and trnR. We found 7 conserved sequence blocks (CSB), scattered throughout the control region of L. satsuma and other taxa of Annelida. The poly-TA stretches, which commonly form the stem of multiple stem-loop structures, are most conserved in the CSB-I and CSB-II regions. The mitochondrial genome of L. satsuma encodes a unique repetitive sequence in the control region, which forms a unique secondary structure in comparison to Lamellibrachia luymesi. Phylogenetic analyses of all protein-coding genes indicate that L. satsuma forms a monophyletic clade with L. luymesi along with other tubeworms found in cold-seep regions (genera: Lamellibrachia, Escarpia, and Seepiophila). In general, the control region sequences of Annelida could be aligned with certainty within each genus, and to some extent within the family, but with a higher rate of variation in conserved regions.

RevDate: 2016-12-30
CmpDate: 2016-10-11

Yin SL, Lan C, Pei H, et al (2015)

Mitochondrial transfer RNA mutations and hypertension.

Genetics and molecular research : GMR, 14(4):17692-17698 pii:gmr7199.

Mutations in mitochondrial DNA have been found to be associated with hypertension. Of these, mitochondrial transfer RNA (mt-tRNA) is a hot spot for these pathogenic mutations. It is generally believed that these mutations may result in the failure of mt-tRNA metabolism, thereby worsening mitochondrial dysfunction and resulting in hypertension. mt-tRNA is known for its high frequency of polymorphisms and mutations, and the number of reports regarding mt-tRNA mutations and hypertension is increasing significantly. To better understand the molecular basis of maternally inherited hypertension, we reassessed the link between four mt-tRNA mutations (G15927A in tRNA(Thr), C7492T in tRNA(Ser(UCN)), A4386G in tRNA(Gln), and C14686T in tRNA(Glu)) and hypertension. We first used the phylogenetic approach to investigate the deleterious roles of these mutations, then we used RNA Fold Web Server to predict the minimum free energy of these mt-tRNAs with and without mutations. Using the pathogenicity scoring system, we found that the G15927A and C7492T mutations are classified as pathogenic while all other studied mutations are neutral polymorphisms. Our study provides valuable information for the detection of pathogenic mt-tRNA mutations in hypertension.

LOAD NEXT 100 CITATIONS

RJR Experience and Expertise

Researcher

Robbins holds BS, MS, and PhD degrees in the life sciences. He served as a tenured faculty member in the Zoology and Biological Science departments at Michigan State University. He is currently exploring the intersection between genomics, microbial ecology, and biodiversity — an area that promises to transform our understanding of the biosphere.

Educator

Robbins has extensive experience in college-level education: At MSU he taught introductory biology, genetics, and population genetics. At JHU, he was an instructor for a special course on biological database design. At FHCRC, he team-taught a graduate-level course on the history of genetics. At Bellevue College he taught medical informatics.

Administrator

Robbins has been involved in science administration at both the federal and the institutional levels. At NSF he was a program officer for database activities in the life sciences, at DOE he was a program officer for information infrastructure in the human genome project. At the Fred Hutchinson Cancer Research Center, he served as a vice president for fifteen years.

Technologist

Robbins has been involved with information technology since writing his first Fortran program as a college student. At NSF he was the first program officer for database activities in the life sciences. At JHU he held an appointment in the CS department and served as director of the informatics core for the Genome Data Base. At the FHCRC he was VP for Information Technology.

Publisher

While still at Michigan State, Robbins started his first publishing venture, founding a small company that addressed the short-run publishing needs of instructors in very large undergraduate classes. For more than 20 years, Robbins has been operating The Electronic Scholarly Publishing Project, a web site dedicated to the digital publishing of critical works in science, especially classical genetics.

Speaker

Robbins is well-known for his speaking abilities and is often called upon to provide keynote or plenary addresses at international meetings. For example, in July, 2012, he gave a well-received keynote address at the Global Biodiversity Informatics Congress, sponsored by GBIF and held in Copenhagen. The slides from that talk can be seen HERE.

Facilitator

Robbins is a skilled meeting facilitator. He prefers a participatory approach, with part of the meeting involving dynamic breakout groups, created by the participants in real time: (1) individuals propose breakout groups; (2) everyone signs up for one (or more) groups; (3) the groups with the most interested parties then meet, with reports from each group presented and discussed in a subsequent plenary session.

Designer

Robbins has been engaged with photography and design since the 1960s, when he worked for a professional photography laboratory. He now prefers digital photography and tools for their precision and reproducibility. He designed his first web site more than 20 years ago and he personally designed and implemented this web site. He engages in graphic design as a hobby.

Support this website:
Order from Amazon
We will earn a commission.

In 1994 Bryan Sykes was called in as an expert to examine the frozen remains of a man trapped in glacial ice in northern Italy for over 5000 years―the Ice Man. Sykes succeeded in extracting DNA from the Ice Man, but even more important, writes Science News, was his "ability to directly link that DNA to Europeans living today." In this groundbreaking book, Sykes reveals how the identification of a particular strand of DNA — mitochondrial DNA — that passes unbroken through the maternal line allows scientists to trace our genetic makeup all the way back to prehistoric times―to seven primeval women, the "seven daughters of Eve."

963 Red Tail Lane
Bellingham, WA 98226

206-300-3443

E-mail: RJR8222@gmail.com

Collection of publications by R J Robbins

Reprints and preprints of publications, slide presentations, instructional materials, and data compilations written or prepared by Robert Robbins. Most papers deal with computational biology, genome informatics, using information technology to support biomedical research, and related matters.

Research Gate page for R J Robbins

ResearchGate is a social networking site for scientists and researchers to share papers, ask and answer questions, and find collaborators. According to a study by Nature and an article in Times Higher Education , it is the largest academic social network in terms of active users.

Curriculum Vitae for R J Robbins

short personal version

Curriculum Vitae for R J Robbins

long standard version

RJR Picks from Around the Web (updated 11 MAY 2018 )