@article {pmid31110007, year = {2019}, author = {Adriaense, JEC and Martin, JS and Schiestl, M and Lamm, C and Bugnyar, T}, title = {Negative emotional contagion and cognitive bias in common ravens (Corvus corax).}, journal = {Proceedings of the National Academy of Sciences of the United States of America}, volume = {}, number = {}, pages = {}, doi = {10.1073/pnas.1817066116}, pmid = {31110007}, issn = {1091-6490}, abstract = {Emotional contagion is described as an emotional state matching between subjects, and has been suggested to facilitate communication and coordination in complex social groups. Empirical studies typically focus on the measurement of behavioral contagion and emotional arousal, yet, while highly important, such an approach often disregards an additional evaluation of the underlying emotional valence. Here, we studied emotional contagion in ravens by applying a judgment bias paradigm to assess emotional valence. We experimentally manipulated positive and negative affective states in demonstrator ravens, to which they responded with increased attention and interest in the positive condition, as well as increased redirected behavior and a left-eye lateralization in the negative condition. During this emotion manipulation, another raven observed the demonstrator's behavior, and we used a bias paradigm to assess the emotional valence of the observer to determine whether emotional contagion had occurred. Observers showed a pessimism bias toward the presented ambiguous stimuli after perceiving demonstrators in a negative state, indicating emotional state matching based on the demonstrators' behavioral cues and confirming our prediction of negative emotional contagion. We did not find any judgment bias in the positive condition. This result critically expands upon observational studies of contagious play in ravens, providing experimental evidence that emotional contagion is present not only in mammalian but also in avian species. Importantly, this finding also acts as a stepping stone toward understanding the evolution of empathy, as this essential social skill may have emerged across these taxa in response to similar socioecological challenges.}, }
@article {pmid31108570, year = {2019}, author = {Miller, R and Boeckle, M and Jelbert, SA and Frohnwieser, A and Wascher, CAF and Clayton, NS}, title = {Self-control in crows, parrots and nonhuman primates.}, journal = {Wiley interdisciplinary reviews. Cognitive science}, volume = {}, number = {}, pages = {e1504}, doi = {10.1002/wcs.1504}, pmid = {31108570}, issn = {1939-5086}, support = {3399933//FP7 Ideas: European Research Council/ ; }, abstract = {Self-control is critical for both humans and nonhuman animals because it underlies complex cognitive abilities, such as decision-making and future planning, enabling goal-directed behavior. For instance, it is positively associated with social competence and life success measures in humans. We present the first review of delay of gratification as a measure of self-control in nonhuman primates, corvids (crow family) and psittacines (parrot order): disparate groups that show comparable advanced cognitive abilities and similar socio-ecological factors. We compare delay of gratification performance and identify key issues and outstanding areas for future research, including finding the best measures and drivers of delayed gratification. Our review therefore contributes to our understanding of both delayed gratification as a measure of self-control and of complex cognition in animals. This article is categorized under: Cognitive Biology > Evolutionary Roots of Cognition Psychology > Comparative Psychology.}, }
@article {pmid31107635, year = {2019}, author = {Forzán, MJ and Renshaw, RW and Bunting, EM and Buckles, E and Okoniewski, J and Hynes, K and Laverack, M and Fadden, M and Dastjerdi, A and Schuler, K and Dubovi, EJ}, title = {A NOVEL ORTHOREOVIRUS ASSOCIATED WITH EPIZOOTIC NECROTIZING ENTERITIS AND SPLENIC NECROSIS IN AMERICAN CROWS (CORVUS BRACHYRHYNCHOS).}, journal = {Journal of wildlife diseases}, volume = {}, number = {}, pages = {}, pmid = {31107635}, issn = {1943-3700}, abstract = {Epizootic mortalities in American Crows (Corvus brachyrhynchos) during the winter months, referred to as winter mortality of crows, have been recorded in North America for almost two decades. The most common postmortem findings include necrotizing enteritis, colitis, and fibrinous splenic necrosis. These findings are proposed to be due to infection with a Reovirus sp. Our objectives were to characterize the pathology and seasonality of the epizootics in New York State (NYS), confirm the causative role of an Orthoreovirus sp., and determine its phylogeny. On the basis of our proposed case definition for reovirosis, we examined case data collected by the NYS Wildlife Health Program for 16 yr. A total of 558 cases of reovirosis were recorded between 2001 and 2017. Reovirosis had a clear seasonal presentation: cases occurred almost exclusively in winter months (71% in December-January). Detailed data from a 2-yr period (2016 and 2017) demonstrated that reovirosis caused up to 70% of all recorded crow deaths during epizootic months. Crows with positive orthoreovirus isolation from the spleen or intestine were 32 times more likely to die with characteristic histologic lesions of enteritis or enterocolitis and splenic necrosis than crows with negative isolation results. An in situ hybridization probe specific to virus isolated from NYS crow reovirosis cases demonstrated a direct association between viral presence and characteristic histologic lesions. Sigma C (capsid protein) sequences of isolates from NYS crows showed high homology with Tvärminne avian virus, recently proposed as a novel Corvus orthoreovirus clade, and only distantly related to the avian orthoreovirus clade. Our study indicated that a novel orthoreovirus was the cause of winter mortality (or reovirosis) of American Crows and placed the NYS isolates in the newly proposed genus of Corvid orthoreovirus.}, }
@article {pmid31105617, year = {2019}, author = {Chuang, KY and Chen, YH and Balachandran, P and Liang, WK and Juan, CH}, title = {Revealing the Electrophysiological Correlates of Working Memory-Load Effects in Symmetry Span Task With HHT Method.}, journal = {Frontiers in psychology}, volume = {10}, number = {}, pages = {855}, doi = {10.3389/fpsyg.2019.00855}, pmid = {31105617}, issn = {1664-1078}, abstract = {Complex span task is one of the commonly used cognitive tasks to evaluate an individual's working memory capacity (WMC). It is a dual task consisting of a distractor subtask and a memory subtask. Though multiple studies have utilized complex span tasks, the electrophysiological correlates underlying the encoding and retrieval processes in working memory span task remain uninvestigated. One previous study that assessed electroencephalographic (EEG) measures utilizing complex span task found no significant difference between its working memory loads, a typical index observed in other working memory tasks (e.g., n-back task and digital span task). The following design constructs of the paradigm might have been the reason. (1) The fixed-time limit of the distractor subtask may have hindered the assessment of individual WMC precisely. (2) Employing a linear-system-favoring EEG data analysis method for a non-linear system such as the human brain. In the current study, the participants perform the Raven Advanced Progressive Matrices (RAMP) task on 1 day and the symmetry span (Sspan) task on the other. Prior to the formal Sspan task, the participants were instructed to judge 15 simple symmetry questions as quickly as possible. A participant-specific time-limit is chartered from these symmetry questions. The current study utilizes the Sspan task sequential to a distractor subtask. Instead of the fixed time-limit exercised in the previous study, the distractor subtask of the current study was equipped with the participant-specific time-limit obtained from the symmetry questions. This could provide a precise measure of individual WMC. This study investigates if the complex span task resonates EEG patterns similar to the other working memory tasks in terms of working memory-load by utilizing ensemble empirical mode decomposition (EEMD) of Hilbert-Huang transform (HHT). Prior expectations were to observe a decrement in the P300 component of event-related mode (ERM) and a decrement in the power of alpha and beta band frequency with increasing working memory-load. We observed a significantly higher P300 amplitude for the low-load condition compared to the high-load condition over the circumscribed brain network across F4 and C4 electrodes. Time-frequency analysis revealed a significant difference between the high- and low-load conditions at alpha and beta band over the frontal, central, and parietal channels. The results from our study demonstrate precise differences in EEG data pertaining to varied memory-load differences in the complex span task. Thus, assessing complex span tasks with the HHT-based analysis may aid in achieving a better signal to noise ratio and effect size for the results in working memory EEG studies.}, }
@article {pmid31104191, year = {2019}, author = {D'Agati, D and Beaudry, MB and Swartz, K}, title = {Thirteen Reasons Why Revisited: A Monograph for Teens, Parents, and Mental Health Professionals.}, journal = {The Journal of medical humanities}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10912-019-09548-y}, pmid = {31104191}, issn = {1573-3645}, abstract = {Jay Asher's novel Thirteen Reasons Why and its Netflix adaptation have enjoyed widespread popularity. While they draw needed attention to issues like bullying and teen estrangement, they may have an unintended effect: they mislead about the etiology of suicide and even glamorize it to a degree. The medical literature has shown that suicide is almost always the result of psychiatric disorder, not provocative stress, in much the same way an asthmatic crisis is primarily the result of an underlying medical condition, not an allergic stimulus. Both the novel and Netflix series ignore this premise and even belittle the idea. Thus, while the story has artistic merits, it also has the potential to be destructive if accessed by young readers and viewers seeking guidance. Approximately ten percent of teens suffer from depression, and suicide recently surpassed homicide as the second-leading cause of death among persons ages ten to twenty-four in the United States. A more balanced view addressing these misconceptions is provided for teens, parents, and mental health professionals.}, }
@article {pmid31099977, year = {2019}, author = {Krupenye, C and Call, J}, title = {Theory of mind in animals: Current and future directions.}, journal = {Wiley interdisciplinary reviews. Cognitive science}, volume = {}, number = {}, pages = {e1503}, doi = {10.1002/wcs.1503}, pmid = {31099977}, issn = {1939-5086}, support = {Synergy Grant 609819 SOMICS//H2020 European Research Council/ ; MENTALIZINGORIGINS//H2020 Marie Skłodowska-Curie Actions/ ; }, abstract = {Theory of mind (ToM; a.k.a., mind-reading, mentalizing, mental-state attribution, and perspective-taking) is the ability to ascribe mental states, such as desires and beliefs, to others, and it is central to the unique forms of communication, cooperation, and culture that define our species. As a result, for 40 years, researchers have endeavored to determine whether ToM is itself unique to humans. Investigations in other species (e.g., apes, monkeys, corvids) are essential to understand the mechanistic underpinnings and evolutionary origins of this capacity across taxa, including humans. We review the literature on ToM in nonhuman animals, suggesting that some species share foundational social cognitive mechanisms with humans. We focus principally on innovations of the last decade and pressing directions for future work. Underexplored types of social cognition have been targeted, including ascription of mental states, such as desires and beliefs, that require simultaneously representing one's own and another's conflicting motives or views of the world. Ongoing efforts probe the motivational facets of ToM, how flexibly animals can recruit social cognitive skills across cooperative and competitive settings, and appropriate motivational contexts for comparative inquiry. Finally, novel methodological and empirical approaches have brought new species (e.g., lemurs, dogs) into the lab, implemented critical controls to elucidate underlying mechanisms, and contributed powerful new techniques (e.g., looking-time, eye-tracking) that open the door to unexplored approaches for studying animal minds. These innovations in cognition, motivation, and method promise fruitful progress in the years to come, in understanding the nature and origin of ToM in humans and other species. This article is categorized under: Cognitive Biology > Evolutionary Roots of Cognition Psychology > Comparative Psychology Neuroscience > Cognition.}, }
@article {pmid31077659, year = {2019}, author = {Ong, CS and Marcum, JA and Zehr, KJ and Cameron, DE}, title = {A Century of Heparin.}, journal = {The Annals of thoracic surgery}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.athoracsur.2019.03.104}, pmid = {31077659}, issn = {1552-6259}, abstract = {2018 is the centennial of the naming of heparin by Emmett Holt and William Howell and the 102nd anniversary of Jay McLean's discovery of an anticoagulant heparphosphatide at Johns Hopkins. We discuss recently discovered historical artifacts that shed new light on heparin's christening, including McLean's unpublished letter written in 1950 that represents one of the most complete accounts of heparin's discovery prior to his untimely death. We also located a plaque dedicated to McLean and explored the circumstances of its removal from public display learned from interviews with present and former staff members.}, }
@article {pmid31063433, year = {2019}, author = {Pastore, RL and Murray, JA and Coffman, FD and Mitrofanova, A and Srinivasan, S}, title = {Physician Review of a Celiac Disease Risk Estimation and Decision-Making Expert System.}, journal = {Journal of the American College of Nutrition}, volume = {}, number = {}, pages = {1-7}, doi = {10.1080/07315724.2019.1608477}, pmid = {31063433}, issn = {1541-1087}, abstract = {OBJECTIVE: Celiac disease is a genetic disease affecting people of all ages, resulting in small intestine enteropathy. It is considered to be a clinical chameleon. Average prevalence of celiac disease is 1 out of 100 people with data indicating the risk may be as high as 22% for those with first-degree relatives with the disease. Eighty-three percent of people with celiac disease may be undiagnosed. Average duration to diagnosis is 10 years. Data indicate that there is a lack of consensus regarding diagnostics and symptomatology.<br><br>METHOD: A clinical decision support system (CDSS) was developed using Exsys Corvid for expert analysis (CD-CDSS). The CD-CDSS was divided into symptoms and manifestations with 80 points of navigation, and a serology section, and was validated by 13 experts in the field of celiac disease using a 10-statement 5-point Likert scale.<br><br>RESULTS: This scale was analyzed using Cronbach's alpha reliability coefficient, which was calculated using SPSS and revealed good internal consistency and reliability with a result of 0.813. One hundred percent of experts agreed that the CD-CDSS is capable of guiding a health care professional through the diagnostic process, contains an accurate list of symptoms based on the clinical literature, and can foster improved awareness and education about celiac disease and that there is a need for this system.<br><br>CONCLUSIONS: A celiac disease risk estimation and decision-making expert system was successfully developed and evaluated by medical professionals, with 100% agreeing that this CD-CDSS is medically accurate and can guide health care professionals through the diagnostic process.}, }
@article {pmid31062834, year = {2019}, author = {Cumbo, E and Cumbo, S and Torregrossa, S and Migliore, D}, title = {Treatment Effects of Vortioxetine on Cognitive Functions in Mild Alzheimer's Disease Patients with Depressive Symptoms: A 12 Month, Open-Label, Observational Study.}, journal = {The journal of prevention of Alzheimer's disease}, volume = {6}, number = {3}, pages = {192-197}, doi = {10.14283/jpad.2019.24}, pmid = {31062834}, issn = {2426-0266}, abstract = {BACKGROUND/OBJECTIVES: depressive symptoms are common in Alzheimer's disease(AD). Aim of the study was to investigate the efficacy of vortioxetine compared with other conventional antidepressants on cognitive functions in AD patients with depressive symptoms.<br><br>DESIGN: Prospective, randomized, 12 month, parallel-group study.<br><br>SETTING: All participants were evaluated on-site at Neurodegenerative Disorders Unit, ASP2 Caltanissetta(Italy).<br><br>PARTICIPANTS: 108(71 female, 37 male) AD patients with depression(mean age 76.7 ± 4.3).<br><br>INTERVENTION: Randomized subjects received vortioxetine, 15 mg/day(n=36) or other common antidepressants(n=72).<br><br>MEASURES: Primary outcome was change from baseline in the MMSE; secondary outcomes were change in Attentive Matrices, Raven Coloured Progressive Matrices, Digit Span, HAM-D and Cornell scale.<br><br>RESULTS: Statistically significant improvement vs. controls was observed for vortioxetine on most of the cognitive tests and showed significantly baseline-to-endpoint reduction in both HAM-D and Cornell total scores.The most commonly reported adverse events were nausea and headache for votioxetine; nausea in the control group.<br><br>CONCLUSIONS: Vortioxetine had a beneficial effect on cognition and mood in elderly AD patients and was safe and well tolerated.}, }
@article {pmid31061474, year = {2019}, author = {Ling, H and Mclvor, GE and van der Vaart, K and Vaughan, RT and Thornton, A and Ouellette, NT}, title = {Costs and benefits of social relationships in the collective motion of bird flocks.}, journal = {Nature ecology &amp; evolution}, volume = {}, number = {}, pages = {}, doi = {10.1038/s41559-019-0891-5}, pmid = {31061474}, issn = {2397-334X}, abstract = {Current understanding of collective behaviour in nature is based largely on models that assume that identical agents obey the same interaction rules, but in reality interactions may be influenced by social relationships among group members. Here, we show that social relationships transform local interactions and collective dynamics. We tracked individuals' three-dimensional trajectories within flocks of jackdaws, a species that forms lifelong pair-bonds. Reflecting this social system, we find that flocks contain internal sub-structure, with discrete pairs of individuals tied together by spring-like effective forces. Within flocks, paired birds interacted with fewer neighbours than unpaired birds and flapped their wings more slowly, which may result in energy savings. However, flocks with more paired birds had shorter correlation lengths, which is likely to inhibit efficient information transfer through the flock. Similar changes to group properties emerge naturally from a generic self-propelled particle model. These results reveal a critical tension between individual- and group-level benefits during collective behaviour in species with differentiated social relationships, and have major evolutionary and cognitive implications.}, }
@article {pmid31060242, year = {2019}, author = {Preininger, D and Schoas, B and Kramer, D and Boeckle, M}, title = {Waste Disposal Sites as All-You-Can Eat Buffets for Carrion Crows (Corvus corone).}, journal = {Animals : an open access journal from MDPI}, volume = {9}, number = {5}, pages = {}, doi = {10.3390/ani9050215}, pmid = {31060242}, issn = {2076-2615}, abstract = {In cities and densely populated areas, several corvid species are considered nuisance animals. In Austria, particularly carrion (Corvus corone) and hooded crows (C. cornix) are regarded as pests by the general public that frequently cause damage to crops, feed on human waste, and thus spread trash. We conducted a detailed one-year field survey to estimate the abundance of carrion crows in relation to potential anthropogenic food sources and reference sites in the Austrian Rhine valley. Our results demonstrated that the number and proximity of waste management facilities, animal feeding areas, and agricultural areas, and the productive capacity of agricultural areas, predominantly influenced habitat choice and abundance of carrion crows. In the current study, the probability of observing more than two carrion crows at a survey site decreased with increasing human population density. Moreover, the abundance of crows increased despite a continuous increase in crow hunting kills registered during the past 25 years. Our study suggests a regionally comprehensive waste management plan could serve as a promising strategy to manage nuisance birds. A reduction in anthropogenic food supply through improved waste management practices is required for long-term, sustainable management to limit the abundance of crow populations in and close to urban environments.}, }
@article {pmid31054314, year = {2019}, author = {Lee, DH and Killian, ML and Torchetti, MK and Brown, I and Lewis, N and Berhane, Y and Swayne, DE}, title = {Intercontinental spread of Asian-origin H7 avian influenza viruses by captive bird trade in 1990's.}, journal = {Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.meegid.2019.04.028}, pmid = {31054314}, issn = {1567-7257}, abstract = {Wild bird migration and illegal trade of infected poultry, eggs, and poultry products have been associated with the spread of avian influenza viruses (AIV). During 1992-1996, H7N1 and H7N8 low pathogenic AIV (LPAIV) were identified from captive wild birds; such as Pekin robin (Leiothrix lutea), magpie robin (Copsychus saularis), flycatcher sp. (genus Empidonax), a species of softbill and parakeet, sun conure (Aratinga solstitialis), painted conure (Pyrrhura picta), fairy bluebird (Irena puella), and common iora (Aegithina tiphia), kept in aviaries or quarantine stations in England, The Netherlands, Singapore and the United States (U.S.). In this study, we sequenced these H7 viruses isolated from quarantine facilities and aviaries using next-generation sequencing and conducted a comparative phylogenetic analysis of complete genome sequences to elucidate spread patterns. The complete genome sequencing and phylogenetic analysis suggested that H7 viruses originated from a common source, even though they were obtained from birds in distant geographical regions. All H7N1 and H7N8 viruses were LPAIV, except a H7N1 highly pathogenic AIV (HPAIV), A/Pekin robin/California/30412/1994(H7N1) virus. Our results support the continued need for regulation of the captive wild bird trade to reduce the risk of introduction and dissemination of both LPAIV and HPAIV throughout the world.}, }
@article {pmid31040366, year = {2019}, author = {Lee, VE and McIvor, GE and Thornton, A}, title = {Testing relationship recognition in wild jackdaws (Corvus monedula).}, journal = {Scientific reports}, volume = {9}, number = {1}, pages = {6710}, doi = {10.1038/s41598-019-43247-x}, pmid = {31040366}, issn = {2045-2322}, support = {NE/L002434/1//RCUK | Natural Environment Research Council (NERC)/ ; BB/H021817/1//RCUK | Biotechnology and Biological Sciences Research Council (BBSRC)/ ; BB/H021817/1//RCUK | Biotechnology and Biological Sciences Research Council (BBSRC)/ ; BB/H021817/2//RCUK | Biotechnology and Biological Sciences Research Council (BBSRC)/ ; }, abstract = {According to the social intelligence hypothesis, understanding the challenges faced by social animals is key to understanding the evolution of cognition. In structured social groups, recognising the relationships of others is often important for predicting the outcomes of interactions. Third-party relationship recognition has been widely investigated in primates, but studies of other species are limited. Furthermore, few studies test for third-party relationship recognition in the wild, where cognitive abilities are deployed in response to natural socio-ecological pressures. Here, we used playback experiments to investigate whether wild jackdaws (Corvus monedula) track changes in their own relationships and the relationships of others. Females were presented with 'infidelity simulations': playbacks of their male partner copulating with a neighbouring female, and their male neighbour copulating with another female, against a congruent control. Our results showed substantial inter-individual variation in responses, but females did not respond more strongly to infidelity playbacks, indicating that jackdaws may not attend and/or respond to relationship information in this experimental context. Our results highlight the need for further study of relationship recognition and other cognitive traits that facilitate group-living in the wild, particularly in non-primates and in a wider range of social systems.}, }
@article {pmid31039066, year = {2019}, author = {Hung, A and Gedey, R and Groeneweg, M and Jay, M}, title = {A Primer for Managed Care Residents: How to Conduct Research Using Live Medical and Pharmacy Claims Data.}, journal = {Journal of managed care &amp; specialty pharmacy}, volume = {25}, number = {5}, pages = {538-543}, doi = {10.18553/jmcp.2019.25.5.538}, pmid = {31039066}, issn = {2376-1032}, abstract = {Managed care organizations are growing more sophisticated in their ability to analyze data. There are increasing numbers of data analysts at managed care organizations, as well as more types of real-time, or &quot;live,&quot; data available. These data range from pharmacy claims and enrollment files to medical claims, medical records, and linkages to external data. Moreover, the data are often curated in a way that allows for easier data analysis. Using these data, managed care residents are often required to perform a project to evaluate a utilization management policy or clinical program. Yet, there is a lack of guidance specific to managed care organizations on how to conduct such a research study using &quot;live&quot; claims data. This Viewpoint article provides a primer for managed care residents and other managed care professionals who are seeking to use data to help inform decisions on how to manage their beneficiaries' health and costs. DISCLOSURES: There was no funding source for this manuscript. Hung reports a grant from the Agency for Healthcare Research and Quality and personal fees from Blue Cross Blue Shield Association, outside the submitted work. Gedey, Groeneweg, and Jay have nothing to disclose.}, }
@article {pmid31020476, year = {2019}, author = {Wang, W and Wang, A and Yang, Y and Wang, F and Liu, Y and Zhang, Y and Sharshov, K and Gui, L}, title = {Composition, diversity and function of gastrointestinal microbiota in wild red-billed choughs (Pyrrhocorax pyrrhocorax).}, journal = {International microbiology : the official journal of the Spanish Society for Microbiology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10123-019-00076-2}, pmid = {31020476}, issn = {1618-1905}, support = {2018-ZJ-932Q//the Natural Science Foundation of Qinghai Province of China/ ; 31701573//the National Natural Science Foundation of China/ ; 31460569//the National Natural Science Foundation of China/ ; 2016-ZJ-Y01//the Project of Qinghai Science &amp; Technology Department/ ; 2017-ZZ-21//the Open Project of State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University/ ; 2018-THY-02//the project of Tao He Yuan National Wetland Park in Qinghai Province/ ; }, abstract = {Hitherto, virtually nothing is known about the microbial communities related to the bird species in the family Corvidae. To fill this gap, the present study was conducted to provide a baseline description of the gut microbiota of wild red-billed choughs (Pyrrhocorax pyrrhocorax). In this study, microbiota from four gastrointestinal locations (oropharynx, gizzard, small intestine, and large intestine) of three wild red-billed choughs were analyzed using the Illumina MiSeq sequencing platform by targeting the V4-V5 regions of the 16S rRNA genes. The gut microbiota of the red-billed choughs were dominated by the phylum Firmicutes (59.56%), followed by Proteobacteria (16.56%), Bacteroidetes (13.86%), and Actinobacteria (7.03%), which were commonly detected in avian gut ecosystems. Genus-level compositions were found to be largely dominated by Lactobacillus (18.21%), Weissella (12.37%), Erysipelatoclostridium (6.94%), Bacteroides (6.63%), Escherichia-Shigella (5.15%), Leuconostoc (4.60%), Proteus (3.33%), Carnobacterium (2.71%), Lactococcus (1.69%), and Enterococcus (1.63%). The overall intestinal microbiota was enriched with functions related to ATP-binding cassette (ABC) transporters, DNA repair and recombination proteins, purine metabolism, ribosome, transcription factors, pyrimidine metabolism, peptidases, and two-component system. In terms of four different gastrointestinal locations, hierarchical clustering analysis and principal coordinate analysis showed that microbial communities of the oropharynx, gizzard, small intestine, and large intestine formed four separated clusters. A total of 825 OTUs and 382 genera were detected in all four gastrointestinal locations, which were considered as the major microbes in the intestines of red-billed choughs. Coexistence of lactic acid bacteria and potential pathogens in the gut environments of red-billed choughs required further investigations.}, }
@article {pmid31014599, year = {2017}, author = {Irie, T and Ikeda, T and Nakamura, T and Ichii, O and Yamada, N and Ito, T and Yamazaki, A and Takai, S and Yagi, K}, title = {First molecular detection of Sarcocystis ovalis in the intestinal mucosa of a Japanese jungle crow (Corvus macrorhynchos) in Hokkaido, Japan.}, journal = {Veterinary parasitology, regional studies and reports}, volume = {10}, number = {}, pages = {54-57}, doi = {10.1016/j.vprsr.2017.08.005}, pmid = {31014599}, issn = {2405-9390}, abstract = {Although cysts of Sarcocystis spp. have been detected in domestic and wild animals throughout Japan, their natural definitive hosts have not been fully elucidated. Additionally, in Hokkaido, several Sarcocystis spp. are highly prevalent among wild sika deer (Cervus nippon yesoensis), one of which is S. ovalis. The life cycle of S. ovalis is maintained in corvid birds. To identify the definitive host for S. ovalis in Hokkaido, we investigated its prevalence among corvid birds (Corvus macrorhynchos and C. corone). A total of 42 crow carcasses were collected during August 2015-July 2016 in southern Hokkaido. Examination for coccidian sporocysts in rectal feces and intestinal mucosa, detection of Sarcocystis DNA (18S rRNA gene) from intestinal mucosa samples, and histological observation of intestinal tissue were conducted. No Sarcocystis sporocysts were detected in fecal and mucosal samples by flotation. DNA from intestinal mucosa was positive in one crow (C. macrorhynchos). Phylogenetic analysis demonstrated the isolate clustered with S. ovalis and was closely related to isolates obtained from sika deer in Hokkaido. Histologically, S. ovalis gamogenesis (gamonts or gametes) and oocyst production were observed in the villi of the crow positive for S. ovalis DNA. However, the crow was negative for other coccidian parasites, such as Eimeria, by fecal examination. Our results suggested that crows harbor S. ovalis in the intestine and may serve as a definitive host of S. ovalis in Hokkaido. To our knowledge, this is the first report on a natural definitive host for Sarcocystis spp. prevalent among sika deer in Japan.}, }
@article {pmid31011531, year = {2019}, author = {Hildebrand, J and Pyrka, E and Sitko, J and Jeżewski, W and Zaleśny, G and Tkach, VV and Laskowski, Z}, title = {Molecular phylogeny provides new insights on the taxonomy and composition of Lyperosomum Looss, 1899 (Digenea, Dicrocoeliidae) and related genera.}, journal = {International journal for parasitology. Parasites and wildlife}, volume = {9}, number = {}, pages = {90-99}, doi = {10.1016/j.ijppaw.2019.03.020}, pmid = {31011531}, issn = {2213-2244}, abstract = {Lyperosomum Looss, 1899 is one of the largest genera of the Dicrocoeliidae and is one of the best examples of the systematic complexity and taxonomic instability within this family. We present the molecular analyses based on novel sequences of nuclear and mitochondrial genes obtained from 56 isolates of adult flukes and larval stages of dicrocoeliids belonging to Lyperosomum, Skrjabinus, Zonorchis as well as previously available sequence data. According to obtained results we propose to return Zonorchis clathratus and Z. petiolatus into Lyperosomum, and to recognize L. alagesi as a synonym of L. petiolatum. Our study shows that L. petiolatum commonly occurs in Europe in corvids as well as in several species of migratory songbirds, e.g. Sylvia atricapilla. At the same time, the Turdidae appear to host a distinct species of Lyperosomum. The phylogenetic analysis has clearly demonstrated the paraphylepic nature of Lyperosomum and indicated the need of its thorough revision preferably using specimens from type hosts and type territories of nominal species. In addition, inclusion of numerous not yet sequenced dicrocoeliid genera into future phylogenetic studies is necessary to clarify the interrelationships of taxa within the family and stabilize its system.}, }
@article {pmid31006991, year = {2019}, author = {Zurfluh, K and Albini, S and Mattmann, P and Kindle, P and Nüesch-Inderbinen, M and Stephan, R and Vogler, BR}, title = {Antimicrobial resistant and extended-spectrum β-lactamase producing Escherichia coli in common wild bird species in Switzerland.}, journal = {MicrobiologyOpen}, volume = {}, number = {}, pages = {e845}, doi = {10.1002/mbo3.845}, pmid = {31006991}, issn = {2045-8827}, support = {//Swiss Federal Office of Public Health, Division Communicable Diseases/ ; }, abstract = {A total of 294 fecal swabs from 294 wild birds in Switzerland were cultivated for antimicrobial resistant (AMR) Escherichia coli. Samples were also subcultivated to detect E. coli with extended-spectrum β-lactamases (ESBL), carbapenemases, and plasmid-mediated aminoglycoside or colistin resistance, respectively. Samples from 17 (5.8%) of the birds contained 19 AMR E. coli, whereof 26.3% were multidrug resistant. Five (1.7%) ESBL-producing E. coli were detected. The isolates harbored blaCTX-M-1 (two isolated from carrion crows and from one great spotted woodpecker, respectively), blaCTX-M-15 (originating from a grey heron), blaCTX-M-55 (from a carrion crow), and blaCTX-M-65 (from a common blackbird). Phylogenetic analysis assigned three isolates to commensal phylogroups A and B1, one to extraintestinal pathogenic group B2, and one to phylogroup F. Multilocus sequence typing identified sequence types (STs) that have been found previously in ESBL E. coli in wild birds (ST58, ST205, ST540). One isolate harboring blaCTX-M-55 was assigned to the recently emerged fluoroquinolone-resistant, extraintestinal pathogenic E. coli clone ST1193. Wild birds have the potential to disperse AMR, including clinically important resistance genes, from anthropogenic-influenced habitats to diverse areas, including vulnerable natural environments such as surface waters or mountain regions.}, }
@article {pmid31006388, year = {2019}, author = {Te Nijenhuis, J and Choi, YY and van den Hoek, M and Valueva, E and Lee, KH}, title = {Spearman's hypothesis tested comparing Korean young adults with various other groups of young adults on the items of the Advanced Progressive Matrices.}, journal = {Journal of biosocial science}, volume = {}, number = {}, pages = {1-38}, doi = {10.1017/S0021932019000026}, pmid = {31006388}, issn = {1469-7599}, abstract = {Spearman's hypothesis tested at the subtest level of an IQ battery states that differences between races on the subtests of an IQ battery are a function of the g loadings of these subtests, such that there are small differences between races on subtests with low g loadings and large differences between races on subtests with high g loadings. Jensen (1998) stated that Spearman's hypothesis is a law-like phenomenon. It has also been confirmed many times at the level of items of the Raven's Progressive Matrices. This study hypothesizes that with concern to Spearman's hypothesis, subtests and items function in fundamentally the same way, and tested whether Spearman's hypothesis is confirmed at the item level for White-East Asian comparisons. A group of Korean young adults (N=205) was compared with other groups of young adults from Canada, the US, Russia, Peru and South Africa (total N=4770) who took the Advanced Progressive Matrices. Spearman's hypothesis was strongly confirmed with a sample-size-weighted r with a value of 0.63. Computing the g loadings of the items of the Raven with either the Raven-g or the Wechsler-g led to the same conclusions. Tests of Spearman's hypothesis yielded less-strong outcomes when the 36-item Advanced Progressive Matrices were used than when the 60-item Standard Progressive Matrices were used. There is a substantial correlation between sample size and the outcome of Spearman's hypothesis. So, all four hypotheses were confirmed, showing that a part of the subtest-level nomological net replicates at the item level, strengthening the position that, with concern to Spearman's hypothesis, subtests and items function fundamentally the same. It is concluded that Spearman's hypothesis is still a law-like phenomenon. Detailed suggestions for follow-up research are made.}, }
@article {pmid30987031, year = {2019}, author = {Gryz, J and Krauze-Gryz, D}, title = {Pigeon and Poultry Breeders, Friends or Enemies of the Northern Goshawk Accipiter gentilis? A Long-Term Study of a Population in Central Poland.}, journal = {Animals : an open access journal from MDPI}, volume = {9}, number = {4}, pages = {}, doi = {10.3390/ani9040141}, pmid = {30987031}, issn = {2076-2615}, support = {240115, 240104//Ministry of Environment, Poland/ ; }, abstract = {In this study, we focused on a goshawk population in central Poland (study area 105 km²,forests 24 km², seven small forest complexes) which was monitored long-term (with high densitiesrecorded in the 1980s of 16.3 pairs/100 km² despite persecution by farmers) to analyse howenvironmental factors (prey availability and changes in the forest structure) influenced populationabundance, breeding parameters, and diet composition. The study was undertaken from 2011-2018,and the results were compared with published data from two previous study periods (1982-1992and 2001-2003). The number of breeding pairs dropped from 17.1 to 8.0; the breeding success wasaround 75% in all study periods. The selection of nesting trees followed the changes in stand speciesand age structure. More nesting attempts per one nest were recorded in the current time period (1.7 vs.1.1), which probably reflected lower anthropopressure (i.e., no cases of persecution were recordedin this study). Diet composition seemed to follow changes in the prey availability: The share ofdomestic pigeons and poultry (the main prey in the 1980s) as well as small game dropped, whilethe share of Eurasian jay and wood pigeon increased. Our studies suggested that anthropogenicfood (poultry and domestic pigeons) played a key role for the goshawk population in thetransformed habitats of the field and forest mosaic.}, }
@article {pmid30971984, year = {2019}, author = {Vibert, N and Braasch, JLG and Darles, D and Potocki, A and Ros, C and Jaafari, N and Rouet, JF}, title = {Adolescents' Developing Sensitivity to Orthographic and Semantic Cues During Visual Search for Words.}, journal = {Frontiers in psychology}, volume = {10}, number = {}, pages = {642}, doi = {10.3389/fpsyg.2019.00642}, pmid = {30971984}, issn = {1664-1078}, abstract = {Two eye-tracking experiments were conducted to assess the influence of words either looking like the target word (orthographic distractors) or semantically related to the target word (semantic distractors) on visual search for words within lists by adolescents of 11, 13, and 15 years of age. In Experiment 1 (literal search task), participants saw the target word before the search (e.g., &quot;raven&quot;), whereas in Experiment 2 (categorical task) the target word was only defined by its semantic category (e.g., &quot;bird&quot;). In both experiments, participants' search times decreased from fifth to ninth grade, both because older adolescents gazed less often at non-target words during the search and because they could reject non-target words more quickly once they were fixated. Progress in visual search efficiency was associated with a large increase in word identification skills, which were a strong determinant of average gaze durations and search times for the categorical task, but much less for the literal task. In the literal task, the presence of orthographic or semantic distractors in the list increased search times for all age groups. In the categorical task, the impact of semantic distractor words was stronger than in the literal task because participants needed to gaze at the semantic distractors longer than at the other words before rejecting them. Altogether, the data support the assumption that the progressive automation of word decoding up until the age of 12 and the better quality of older adolescents' lexical representations facilitate a flexible use of both the perceptual and semantic features of words for top-down guidance within the displays. In particular, older adolescents were better prepared to aim at or reject words without gazing at them directly. Finally, the overall similar progression of the maturation of single word visual search processes and that of more real-life information search within complex verbal documents suggests that the young adolescents' difficulties in searching the Web effectively could be due to their insufficiently developed lexical representations and word decoding abilities.}, }
@article {pmid30967467, year = {2019}, author = {Hanage, WP}, title = {Two Health or Not Two Health? That Is the Question.}, journal = {mBio}, volume = {10}, number = {2}, pages = {}, doi = {10.1128/mBio.00550-19}, pmid = {30967467}, issn = {2150-7511}, abstract = {How much drug-resistant infections in livestock contribute to disease in humans is controversial. While zoonoses are a prominent cause of emerging infections, and the profligate use of antibiotics as growth promoters is expected to lead to the spread of resistance, this resistance could remain concentrated in animal pathogens and only rarely spill over into humans. A recent paper compares genomes of Escherichia coli isolates from human bloodstream infections in England, focused on the Cambridge area, with isolates collected from farms and the food chain in the east of the country, seeking evidence of transmission (C. Ludden, K. E. Raven, D. Jamrozy, T. Gouliouris, et al., mBio 10:e02693-18, 2019, https://doi.org/10.1128/mBio.02693-18). While the human and livestock populations were clearly distinct, with very limited evidence for transmission of E. coli or resistance elements to humans, the results also illustrate our limited ability to infer historical transmission events from even the best samples. The implications for the One Health framework, aiming to unify human and veterinary medicine, are discussed.}, }
@article {pmid30964426, year = {2019}, author = {McMillan, JR and Marcet, PL and Hoover, CM and Mead, D and Kitron, U and Vazquez-Prokopec, GM}, title = {Feeding Success and Host Selection by Culex quinquefasciatus Say Mosquitoes in Experimental Trials.}, journal = {Vector borne and zoonotic diseases (Larchmont, N.Y.)}, volume = {}, number = {}, pages = {}, doi = {10.1089/vbz.2018.2381}, pmid = {30964426}, issn = {1557-7759}, abstract = {Arthropod vector feeding preferences are defined as an overutilization of a particular host species given its abundance in relationship to other species in the community. Numerous methods exist to quantify vector feeding preferences; however, controlled host choice experiments are generally an underutilized approach. In this report, we present results from controlled vector host choice experiments using Culex quinquefasciatus Say (Diptera: Culicidae) mosquitoes and wild avian hosts identified as important contributors to West Nile virus (WNv) transmission in Atlanta, Georgia, United States. In each experiment, we allowed lab-reared F1 Cx. quinquefasciatus to feed freely overnight on two avian individuals of a different species (i.e., northern cardinals, American robins, blue jays, brown thrashers, and gray catbirds). We then estimated WNv transmission potential using vectorial capacity and R0. We found that mosquito blood feeding success was extremely variable among experimental replicates and that patterns of host choice only occasionally aggregated to a particular bird species. Vectorial capacity was highest for American robins and blue jays due to these species' higher reservoir competence for WNv and greater probabilities of mosquito selection of these species. Despite species-specific differences in vectorial capacity, total community capacity was similar among species pairs. R0 estimates were qualitatively similar to capacity, and R0 was below and above unity across species pairs. Our results provide empirical evidence that C. quinquefasciatus is an opportunistic blood feeder and highlight how variability in vector-host contact rates as well as host community composition can influence the likelihood of WNv transmission in avian communities.}, }
@article {pmid30963864, year = {2019}, author = {Jelbert, SA and Miller, R and Schiestl, M and Boeckle, M and Cheke, LG and Gray, RD and Taylor, AH and Clayton, NS}, title = {New Caledonian crows infer the weight of objects from observing their movements in a breeze.}, journal = {Proceedings. Biological sciences}, volume = {286}, number = {1894}, pages = {20182332}, doi = {10.1098/rspb.2018.2332}, pmid = {30963864}, issn = {1471-2954}, abstract = {Humans use a variety of cues to infer an object's weight, including how easily objects can be moved. For example, if we observe an object being blown down the street by the wind, we can infer that it is light. Here, we tested whether New Caledonian crows make this type of inference. After training that only one type of object (either light or heavy) was rewarded when dropped into a food dispenser, birds observed pairs of novel objects (one light and one heavy) suspended from strings in front of an electric fan. The fan was either on-creating a breeze which buffeted the light, but not the heavy, object-or off, leaving both objects stationary. In subsequent test trials, birds could drop one, or both, of the novel objects into the food dispenser. Despite having no opportunity to handle these objects prior to testing, birds touched the correct object (light or heavy) first in 73% of experimental trials, and were at chance in control trials. Our results suggest that birds used pre-existing knowledge about the behaviour exhibited by differently weighted objects in the wind to infer their weight, using this information to guide their choices.}, }
@article {pmid30956930, year = {2018}, author = {Rubio, E and Sanllorente, O and Tieleman, BI and Ibáñez-Álamo, JD}, title = {Fecal sacs do not increase nest predation in a ground nester.}, journal = {Journal of ornithology}, volume = {159}, number = {4}, pages = {985-990}, doi = {10.1007/s10336-018-1566-8}, pmid = {30956930}, issn = {2193-7192}, abstract = {Most altricial birds remove their nestlings' feces from the nest, but the evolutionary forces driving this behavior are poorly understood. A possible adaptive explanation for this could be that birds avoid the attraction of nest predators to their nests due to the visual or olfactory cues produced by feces (nest predation hypothesis). This hypothesis has received contrasting support indicating that additional experimental studies are needed, particularly with respect to the visual component of fecal sacs. To test this hypothesis, we conducted an experiment manipulating the presence of fecal sacs on inactive Woodlark (Lullula arborea) nests. This ground nester has highly cryptic nests that are mainly depredated by visually oriented nest predators (i.e., corvids) in our study population, making it an excellent system to test for the nest predation hypothesis. Our results showed that the presence of fecal sacs in the nest does not seem to be an important factor explaining nest predation. Interestingly, the effect of nest concealment, the most important factor explaining nest predation in Woodlark nests, depended on whether the nest was depredated the previous year or not, supporting the importance of using different nesting sites between years. Our findings indicate that this important nest sanitation behavior is not likely motivated by nest predation and highlight the need to explore alternative selective pressures in this context.}, }
@article {pmid30956929, year = {2018}, author = {Baniukiewicz, M and Dick, ZL and Giabbanelli, PJ}, title = {Capturing the fast-food landscape in England using large-scale network analysis.}, journal = {EPJ data science}, volume = {7}, number = {1}, pages = {39}, doi = {10.1140/epjds/s13688-018-0169-1}, pmid = {30956929}, issn = {2193-1127}, abstract = {Fast-food outlets play a significant role in the nutrition of British children who get more food from such shops than the school canteen. To reduce young people's access to fast-food meals during the school day, many British cities are implementing zoning policies. For instance, cities can create buffers around schools, and some have used 200 meters buffers while others used 400 meters. But how close is too close? Using the road network is needed to precisely computing the distance between fast-food outlets (for policies limiting the concentration), or fast-food outlets and the closest school (for policies using buffers). This estimates how much of the fast-food landscape could be affected by a policy, and complementary analyses of food utilization can later translate the estimate into changes on childhood nutrition and obesity. Network analyses of retail and urban forms are typically limited to the scale of a city. However, to design national zoning policies, we need to perform this analysis at a national scale. Our study is the first to perform a nation-wide analysis, by linking large datasets (e.g., all roads, fast-food outlets and schools) and performing the analysis over a high performance computing cluster. We found a strong spatial clustering of fast-food outlets (with 80% of outlets being within 120 of another outlet), but much less clustering for schools. Results depend on whether we use the road network on the Euclidean distance (i.e. 'as the crow flies'): for instance, half of the fast-food outlets are found within 240 m of a school using an Euclidean distance, but only one-third at the same distance with the road network. Our findings are consistent across levels of deprivation, which is important to set equitable national policies. In line with previous studies (at the city scale rather than national scale), we also examined the relation between centrality and outlets, as a potential target for policies, but we found no correlation when using closeness or betweenness centrality with either the Spearman or Pearson correlation methods.}, }
@article {pmid30958132, year = {2019}, author = {Klump, BC and Cantat, M and Rutz, C}, title = {Raw-material selectivity in hook-tool-crafting New Caledonian crows.}, journal = {Biology letters}, volume = {15}, number = {2}, pages = {20180836}, doi = {10.1098/rsbl.2018.0836}, pmid = {30958132}, issn = {1744-957X}, abstract = {Animals that manufacture foraging tools face the challenge of identifying suitable raw materials among a multitude of options. New Caledonian crows exhibit strong population-specific material preferences for the manufacture of hooked stick tools, but it is unknown how they identify their favourite plants. We investigated experimentally whether crows pay attention to the stems of plants (from which the tools are made) and/or their leaves (which are usually discarded during manufacture but may enable rapid and reliable species identification at a distance). Subjects were highly selective in choice trials with multiple plant species. Two additional treatments with experimental leaf-stem combinations revealed that birds can identify their preferred plant species by its stems alone, and possibly also its leaves. These findings encourage future experiments that investigate whether New Caledonian crows attend to features of the stem that are required for the production of efficient hooked stick tools. Our study provides one of the most detailed assessments to date of how non-human animals identify raw materials for tool manufacture.}, }
@article {pmid30956237, year = {2019}, author = {Muigai, W}, title = {&quot;Something Wasn't Clean&quot;: Black Midwifery, Birth, and Postwar Medical Education in All My Babies.}, journal = {Bulletin of the history of medicine}, volume = {93}, number = {1}, pages = {82-113}, doi = {10.1353/bhm.2019.0003}, pmid = {30956237}, issn = {1086-3176}, abstract = {Set in rural Georgia, the 1953 health film All My Babies: A Midwife's Own Story was a government-sponsored project intended as a training tool for midwives. The film was unique to feature a black midwife and a live birth at a time when southern health officials blamed midwives for the region's infant mortality rates. Produced by the young filmmaker George Stoney, All My Babies was praised for its educational value and, as this article demonstrates, was a popular feature in postwar medical education. Yet as it drew acclaim, the film also sparked debates within and beyond medical settings concerning its portrayal of midwifery, birth, and health care for African Americans. In tracing the controversies over the film's messages and representations, this article argues that All My Babies exemplified the power and limits of health films to address the complexities of race and health during an era of Jim Crow segregation.}, }
@article {pmid30944451, year = {2019}, author = {Bocanegra, BR and Poletiek, FH and Ftitache, B and Clark, A}, title = {Intelligent problem-solvers externalize cognitive operations.}, journal = {Nature human behaviour}, volume = {3}, number = {2}, pages = {136-142}, doi = {10.1038/s41562-018-0509-y}, pmid = {30944451}, issn = {2397-3374}, abstract = {Humans are nature's most intelligent and prolific users of external props and aids (such as written texts, slide-rules and software packages). Here we introduce a method for investigating how people make active use of their task environment during problem-solving and apply this approach to the non-verbal Raven Advanced Progressive Matrices test for fluid intelligence. We designed a click-and-drag version of the Raven test in which participants could create different external spatial configurations while solving the puzzles. In our first study, we observed that the click-and-drag test was better than the conventional static test at predicting academic achievement of university students. This pattern of results was partially replicated in a novel sample. Importantly, environment-altering actions were clustered in between periods of apparent inactivity, suggesting that problem-solvers were delicately balancing the execution of internal and external cognitive operations. We observed a systematic relationship between this critical phasic temporal signature and improved test performance. Our approach is widely applicable and offers an opportunity to quantitatively assess a powerful, although understudied, feature of human intelligence: our ability to use external objects, props and aids to solve complex problems.}, }
@article {pmid30935605, year = {2019}, author = {Mostafiz, WR and Carley, DW and Viana, MGC and Ma, S and Dalci, O and Darendeliler, MA and Evans, CA and Kusnoto, B and Masoud, A and Galang-Boquiren, MTS}, title = {Changes in sleep and airway variables in patients with obstructive sleep apnea after mandibular advancement splint treatment.}, journal = {American journal of orthodontics and dentofacial orthopedics : official publication of the American Association of Orthodontists, its constituent societies, and the American Board of Orthodontics}, volume = {155}, number = {4}, pages = {498-508}, doi = {10.1016/j.ajodo.2018.05.022}, pmid = {30935605}, issn = {1097-6752}, abstract = {INTRODUCTION: Obstructive sleep apnea (OSA) is an extensive public health problem that imposes considerable morbidity. Mandibular advancement splint (MAS) therapy is a well tolerated treatment, but success rates are difficult to predict. Our objective was to investigate the relationship of oropharyngeal airway dimensions, sleep characteristics, patient biometrics, and treatment response within an OSA patient sample.<br><br>METHODS: Records of 33 adults were assessed retrospectively with the use of Dolphin 3D and Image J to measure the airway on pretreatment supine cone-beam computed tomography images and derived lateral cephalograms. The patients used Somnodent (Somnomed; Crows Nest, Australia) MAS appliances, which were titrated over 6-8 weeks. Appliance titration measurements and pre- and posttreatment polysomnograms were assessed. Respiratory disturbance index (RDI), absolute and percentage changes in RDI, non-rapid eye movement (NREM) RDI, rapid eye movement (REM) RDI, supine and nonsupine NREM and REM RDI, and minimal blood-oxygen saturation variables were evaluated. The associations of measurements from 2D and 3D minimal anterior-posterior linear distance and 3D airway variables with MAS treatment response were estimated.<br><br>RESULTS AND CONCLUSIONS: Combined effects of baseline total airway volume, body mass index, neck circumference, location of minimal cross sectional area, and OSA severity were associated with treatment response. Patients with higher initial OSA and more superiorly located airway constriction showed enhanced treatment response to MAS therapy. Airway constriction due to maxillofacial disproportions rather than soft tissue obstruction also showed better treatment response. No significant relationships were found in lateral cephalogram measurements.}, }
@article {pmid30934749, year = {2019}, author = {Hamner, S and Brown, BL and Hasan, NA and Franklin, MJ and Doyle, J and Eggers, MJ and Colwell, RR and Ford, TE}, title = {Metagenomic Profiling of Microbial Pathogens in the Little Bighorn River, Montana.}, journal = {International journal of environmental research and public health}, volume = {16}, number = {7}, pages = {}, doi = {10.3390/ijerph16071097}, pmid = {30934749}, issn = {1660-4601}, support = {n/a//United for Health Innovation/ ; }, abstract = {The Little Bighorn River is the primary source of water for water treatment plants serving the local Crow Agency population, and has special significance in the spiritual and ceremonial life of the Crow tribe. Unfortunately, the watershed suffers from impaired water quality, with high counts of fecal coliform bacteria routinely measured during run-off events. A metagenomic analysis was carried out to identify potential pathogens in the river water. The Oxford Nanopore MinION platform was used to sequence DNA in near real time to identify both uncultured and a coliform-enriched culture of microbes collected from a popular summer swimming area of the Little Bighorn River. Sequences were analyzed using CosmosID bioinformatics and, in agreement with previous studies, enterohemorrhagic and enteropathogenic Escherichia coli and other E. coli pathotypes were identified. Noteworthy was detection and identification of enteroaggregative E. coli O104:H4 and Vibrio cholerae serotype O1 El Tor, however, cholera toxin genes were not identified. Other pathogenic microbes, as well as virulence genes and antimicrobial resistance markers, were also identified and characterized by metagenomic analyses. It is concluded that metagenomics provides a useful and potentially routine tool for identifying in an in-depth manner microbial contamination of waterways and, thereby, protecting public health.}, }
@article {pmid30930524, year = {2019}, author = {Boucherie, PH and Loretto, MC and Massen, JJM and Bugnyar, T}, title = {What constitutes &quot;social complexity&quot; and &quot;social intelligence&quot; in birds? Lessons from ravens.}, journal = {Behavioral ecology and sociobiology}, volume = {73}, number = {1}, pages = {12}, doi = {10.1007/s00265-018-2607-2}, pmid = {30930524}, issn = {0340-5443}, abstract = {In the last decades, the assumption that complex social life is cognitively challenging, and thus can drive mental evolution, has received much support from empirical studies in nonhuman primates. While extending the scope to other mammals and birds, different views have been adopted on what constitutes social complexity and which specific cognitive skills are selected for. Notably, many avian species form &quot;open&quot; groups as non-breeders (i.e., seasonally and before sexual maturity) that have been largely ignored as potential sources of social complexity. Reviewing 30 years of research on ravens, we illustrate the socio-ecological conditions faced by these birds as non-breeders and discuss how these relate to their socio-cognitive skills. We argue that the non-breeding period is key to understand raven social life and, to a larger extent, avian social life in general. We furthermore emphasize how the combination of the large-scale perspective (defining social system components: e.g., social organization, mating system) and the individual-scale perspective on social systems allows to better capture the complete set of social challenges experienced by individuals throughout their life, ultimately resulting on a more comprehensive understanding of species' social complexity.}, }
@article {pmid30916391, year = {2019}, author = {Maron, JL and Agrawal, AA and Schemske, DW}, title = {Plant-herbivore coevolution and plant speciation.}, journal = {Ecology}, volume = {}, number = {}, pages = {e02704}, doi = {10.1002/ecy.2704}, pmid = {30916391}, issn = {1939-9170}, abstract = {More than five decades ago, Ehrlich and Raven (1964) proposed a revolutionary idea-that the evolution of novel plant defense could spur adaptive radiation in plants. Despite motivating much work on plant-herbivore coevolution and defense theory, Ehrlich and Raven never proposed a mechanism for their &quot;escape and radiate&quot; model. Recent intriguing proposals by Marquis et al. (2016) include sympatric divergence, pleiotropic effects of plant defense traits on reproductive isolation, and strong postzygotic isolation, but these may not be general features of herbivore-mediated speciation. An alternate view is that herbivores may impose strong divergent selection on defenses in allopatric plant populations, with plant-herbivore coevolution driving local adaptation resulting in plant speciation. Building on these ideas, we propose three scenarios that consider the role of herbivores in plant speciation. These include: 1) vicariance, subsequent coevolution within populations and adaptive divergence between geographically isolated populations, 2) colonization of a new habitat lacking effective herbivores followed by loss of defense and then re-evolution and coevolution of defense in response to novel herbivores, and 3) evolution of a new defense followed by range expansion, vicariance and coevolution. We discuss the general role of coevolution in plant speciation and consider outstanding issues related to understanding: 1) the mechanisms behind cospeciation of plants and insects, 2) geographic variation in defense phenotypes, 3) how defensive traits and geography map on plant phylogenies, and 4) the role of herbivores in driving character displacement in defense phenotypes of related species in sympatry. This article is protected by copyright. All rights reserved.}, }
@article {pmid30913135, year = {2019}, author = {Matsui, H and Izawa, EI}, title = {Control of bill-grasping aperture with varying food size in crows.}, journal = {Neuroreport}, volume = {}, number = {}, pages = {}, doi = {10.1097/WNR.0000000000001240}, pmid = {30913135}, issn = {1473-558X}, abstract = {Grasping movement in primates is known to be a visually guided behavior and the aperture of hand opening is adjusted to the target size on the basis of visual information. The analogous behavior can be found in birds, called 'pecking', consisting of head-reaching and bill-grasping. Bill-grasping has been investigated mainly in pigeons and an aperture adjustment as seen in primates has been reported. This study focused on kinematics of pecking in crows, known to possess dexterous visuomotor skills, to examine whether crows adjust the grasping aperture to food diameter with a kinematic mechanism similar to that in pigeons. The pecking at a small piece of food was video recorded to analyze the grasping aperture. The results showed that the grasping aperture was proportional to food diameter. Kinematic analysis showed that the aperture adjustment was mediated by grasping velocity and grasping duration, which is consistent with the findings of previous research on pecking in pigeons. However, the relative contribution of grasping velocity was much higher than that of grasping duration. Our findings suggest the different sensorimotor mechanisms to control bill-grasping between the avian species with different foraging ecology.}, }
@article {pmid30911146, year = {2019}, author = {Knief, U and Bossu, CM and Saino, N and Hansson, B and Poelstra, J and Vijay, N and Weissensteiner, M and Wolf, JBW}, title = {Epistatic mutations under divergent selection govern phenotypic variation in the crow hybrid zone.}, journal = {Nature ecology &amp; evolution}, volume = {}, number = {}, pages = {}, doi = {10.1038/s41559-019-0847-9}, pmid = {30911146}, issn = {2397-334X}, abstract = {The evolution of genetic barriers opposing interspecific gene flow is key to the origin of new species. Drawing from information on over 400 admixed genomes sourced from replicate transects across the European hybrid zone between all-black carrion crows and grey-coated hooded crows, we decipher the interplay between phenotypic divergence and selection at the molecular level. Over 68% of plumage variation was explained by epistasis between the gene NDP and a ~2.8-megabase region on chromosome 18 with suppressed recombination. Both pigmentation loci showed evidence for divergent selection resisting introgression. This study reveals how few, large-effect loci can govern prezygotic isolation and shield phenotypic divergence from gene flow.}, }
@article {pmid30911140, year = {2019}, author = {Dobson, AE and Schmidt, DJ and Hughes, JM}, title = {Heritability of plumage colour morph variation in a wild population of promiscuous, long-lived Australian magpies.}, journal = {Heredity}, volume = {}, number = {}, pages = {}, doi = {10.1038/s41437-019-0212-4}, pmid = {30911140}, issn = {1365-2540}, abstract = {Colour polymorphisms have evolutionary significance for the generation and maintenance of species diversity. Demonstrating heritability of polymorphic traits can be challenging for wild populations of long-lived species because accurate information is required on trait expression and familial relationships. The Australian magpie Cracticus tibicen has a continent-wide distribution featuring several distinct plumage morphs, differing primarily in colour of back feathers. Black or white-backed morphs occur in eastern Australia, with intermediate morphs common in a narrow hybrid zone where the two morphs meet. This study investigated heritability of back colour phenotypes in a hybrid zone population (Seymour, Victoria) based on long-term observational data and DNA samples collected over an 18 year period (1993-2010). High extra-pair paternity (~ 36% offspring), necessitated verification of parent-offspring relationships by parentage analysis. A total of 538 birds (221 parents and 317 offspring) from 36 territories were analysed. Back colour was a continuous trait scored on a five-morph scale in the field (0-4). High and consistent estimates of back colour heritability (h2) were obtained via weighted mid-parent regression (h2 = 0.94) and by animal models (h2 = 0.92, C.I. 0.80-0.99). Single-parent heritability estimates indicated neither maternal nor paternal non-genetic effects (e.g., parent body condition) played a large role in determining offspring back colour, and environmental effects of territory group and cohort contributed little to trait heritability. Distinctive back colouration of the Australian magpie behaves as a quantitative trait that is likely polygenic, although mechanisms responsible for maintaining these geographically structured morphs and the hybrid zone where they meet are unknown.}, }
@article {pmid30906673, year = {2018}, author = {Milakovich, J and Simonds, VW and Held, S and Picket, V and LaVeaux, D and Cummins, J and Martin, C and Kelting-Gibson, L}, title = {Children as Agents of Change: Parent Perceptions of Child-driven Environmental Health Communication in the Crow Community.}, journal = {Journal of health disparities research and practice}, volume = {11}, number = {3}, pages = {115-127}, pmid = {30906673}, issn = {2166-5222}, }
@article {pmid30905182, year = {2019}, author = {Wu, T and Shen, H and Sheng, Y and Zhao, F and Guo, N and Liao, L and Li, L and Li, Y and Dong, X}, title = {Use of cognitive correction training improves learning for children with mathematics learning disability.}, journal = {Applied neuropsychology. Child}, volume = {}, number = {}, pages = {1-7}, doi = {10.1080/21622965.2018.1552866}, pmid = {30905182}, issn = {2162-2973}, abstract = {Children with normal intelligence may experience varying degrees of mathematics learning disabilities (MD). This study aims to conduct training to improve the brain's cognitive ability for mathematics learning by focusing on two important mathematical cognitive abilities. This was a prospective study of 70 children in grades 2-5 from two primary schools in Changzhou and with MD enrolled from June 2015 to February 2017. The children were randomized 1:1 to the training and control groups. A training cycle included 40 sessions (5/weeks) (30 min each session). The efficacy of learning was assessed by assessing number learning and graph reasoning, and by using the Raven standard reasoning test score. In the training group, backward number memory (from 6.1 ± 1.8 to 6.7 ± 1.3, P = 0.02), number sequential connection (from 54.4 ± 14.5 to 47.1 ± 12.1, P < 0.01), and rapid graph judgment (from 531.9 ± 76.3 to 557.8 ± 85.7, P = 0.04) were improved by training, while there was no effect on forward number memory (P = 0.13). There were significant differences in total score and scores of b, c, and e series before and after training (all P < 0.05). The children in the control group had no improvement after 8 weeks. There was a correlation between the ability of rapid graphic judgment before and after training and the score of the Raven E series (r = 0.384, P = 0.024), and between the score of the Raven C series and the score of the Raven D series (r = 0.468, P = 0.013). Cognitive correction training improved the sensitivity to numbers and mathematics learning in children with MD.}, }
@article {pmid30891367, year = {2019}, author = {Policht, R and Hart, V and Goncharov, D and Surový, P and Hanzal, V and Červený, J and Burda, H}, title = {Vocal recognition of a nest-predator in black grouse.}, journal = {PeerJ}, volume = {7}, number = {}, pages = {e6533}, doi = {10.7717/peerj.6533}, pmid = {30891367}, issn = {2167-8359}, abstract = {Corvids count among the important predators of bird nests. They are vocal animals and one can expect that birds threatened by their predation, such as black grouse, are sensitive to and recognize their calls. Within the framework of field studies, we noticed that adult black grouse were alerted by raven calls during periods outside the breeding season. Since black grouse are large, extremely precocial birds, this reaction can hardly be explained by sensitization specifically to the threat of nest predation by ravens. This surprising observation prompted us to study the phenomenon more systematically. According to our knowledge, the response of birds to corvid vocalization has been studied in altricial birds only. We tested whether the black grouse distinguishes and responds specifically to playback calls of the common raven. Black grouse recognized raven calls and were alerted, displaying typical neck stretching, followed by head scanning, and eventual escape. Surprisingly, males tended to react faster and exhibited a longer duration of vigilance behavior compared to females. Although raven calls are recognized by adult black grouse out of the nesting period, they are not directly endangered by the raven. We speculate that the responsiveness of adult grouse to raven calls might be explained as a learned response in juveniles from nesting hens that is then preserved in adults, or by a known association between the raven and the red fox. In that case, calls of the raven would be rather interpreted as a warning signal of probable proximity of the red fox.}, }
@article {pmid30889388, year = {2019}, author = {Bugnyar, T}, title = {Tool Use: New Caledonian Crows Engage in Mental Planning.}, journal = {Current biology : CB}, volume = {29}, number = {6}, pages = {R200-R202}, doi = {10.1016/j.cub.2019.01.059}, pmid = {30889388}, issn = {1879-0445}, abstract = {New Caledonian crows are able to flexibly use different tools in a sequence to retrieve food, whereby each step is out-of-sight of the others. Mental planning is thus not a human-specific trait.}, }
@article {pmid30877719, year = {2019}, author = {Triantafyllidou, E and Moraitou, D and Kaklamanaki, E and Georgiadou, T and Athanasaki, M and Malliopoulou, E and Schina, C and Hamoli, M and Moschou, S and Petropoulou, Z and Mpoulakis, P and Douli, E and Pagoni, K and Nikolaidou, S and Nouli, CD and Masoura, E and Tsolaki, M and Papantoniou, G}, title = {Retrogenetic models of working memory: Preliminary multi-group analysis.}, journal = {Hellenic journal of nuclear medicine}, volume = {22 Suppl}, number = {}, pages = {4-16}, pmid = {30877719}, issn = {1790-5427}, abstract = {AIM: The aim of the present study was the qualitative comparison of working memory capacity of young children and older adults through the investigation of the latent structure stability or change in Working Memory capacity (WM) in childhood and aging, using Multiple Group Confirmatory Factor Analysis (MGCFA).<br><br>METHOD: The sample consisted of 62 kindergarten and 56 elementary school students (age range: 4-8 years) and 52 young-old adults and 54 old-old adults (age range: 60-94 years). Adults were asked to complete the Mini-Mental State Examination (MMSE) and the Geriatric Depression Scale-15 (GDS-15) as screening tests. The children were examined via the Raven Colored Progressive Matrix (CMP) test for the same reason. WM was examined via four measures of Working Memory Test Battery for Children (WMTB-C).<br><br>RESULTS: MGCFA applied to the data of the kindergarten students' subsample, elementary school students' subsample, young-old and old-old adults' subsamples as well as of older adults with low (0-9 years of education) educational level. Initially, through MGCFA, four &quot;models&quot; were confirmed, one for each age-related subsample, and they were different from each other. However, when the same method was applied exclusively to young-old and old-old adults with low educational level, the models that emerged were similar to the kindergarten students' model.<br><br>CONCLUSION: When we &quot;keep&quot; the educational level equal (low) for all, the hypothesis of retrogenesis is confirmed. Cognitive reserve appears to be protective, keeping differentiated WM's components in every age group other than that of kindergarten students. The results support the &quot;retrogenetic&quot; hypothesis, mainly due to the finding of a delay in WM components' development in the group of kindergarten students, and their dedifferentiation in the low-educated young-old and old-old adults.}, }
@article {pmid30867014, year = {2019}, author = {Gutiérrez-López, R and Martínez-de la Puente, J and Gangoso, L and Soriguer, R and Figuerola, J}, title = {Effects of host sex, body mass and infection by avian Plasmodium on the biting rate of two mosquito species with different feeding preferences.}, journal = {Parasites &amp; vectors}, volume = {12}, number = {1}, pages = {87}, doi = {10.1186/s13071-019-3342-x}, pmid = {30867014}, issn = {1756-3305}, support = {CGL2012-30759//Ministerio de Economía, Industria y Competitividad, Gobierno de España (ES)/ ; CGL2015-65055-P//Ministerio de Economía, Industria y Competitividad, Gobierno de España/ ; 2017 Leonardo Grant for Researchers//Fundación BBVA/ ; Cultural Creators//Fundación BBVA/ ; 747729 &quot;EcoEvoClim&quot;//H2020 Marie Skłodowska-Curie Actions/ ; P11-RNM-7038//Agencia de Innovación y Desarrollo de Andalucía/ ; }, abstract = {BACKGROUND: The transmission of mosquito-borne pathogens is strongly influenced by the contact rates between mosquitoes and susceptible hosts. The biting rates of mosquitoes depend on different factors including the mosquito species and host-related traits (i.e. odour, heat and behaviour). However, host characteristics potentially affecting intraspecific differences in the biting rate of mosquitoes are poorly known. Here, we assessed the impact of three host-related traits on the biting rate of two mosquito species with different feeding preferences: the ornithophilic Culex pipiens and the mammophilic Ochlerotatus (Aedes) caspius. Seventy-two jackdaws Corvus monedula and 101 house sparrows Passer domesticus were individually exposed to mosquito bites to test the effect of host sex, body mass and infection status by the avian malaria parasite Plasmodium on biting rates.<br><br>RESULTS: Ochlerotatus caspius showed significantly higher biting rates than Cx. pipiens on jackdaws, but non-significant differences were found on house sparrows. In addition, more Oc. caspius fed on female than on male jackdaws, while no differences were found for Cx. pipiens. The biting rate of mosquitoes on house sparrows increased through the year. The bird infection status and body mass of both avian hosts were not related to the biting rate of both mosquito species.<br><br>CONCLUSIONS: Host sex was the only host-related trait potentially affecting the biting rate of mosquitoes, although its effect may differ between mosquito and host species.}, }
@article {pmid30850691, year = {2019}, author = {Shimmura, T and Tamura, M and Ohashi, S and Sasaki, A and Yamanaka, T and Nakao, N and Ihara, K and Okamura, S and Yoshimura, T}, title = {Cholecystokinin induces crowing in chickens.}, journal = {Scientific reports}, volume = {9}, number = {1}, pages = {3978}, doi = {10.1038/s41598-019-40746-9}, pmid = {30850691}, issn = {2045-2322}, abstract = {Animals that communicate using sound are found throughout the animal kingdom. Interestingly, in contrast to human vocal learning, most animals can produce species-specific patterns of vocalization without learning them from their parents. This phenomenon is called innate vocalization. The underlying molecular basis of both vocal learning in humans and innate vocalization in animals remains unknown. The crowing of a rooster is also innately controlled, and the upstream center is thought to be localized in the nucleus intercollicularis (ICo) of the midbrain. Here, we show that the cholecystokinin B receptor (CCKBR) is a regulatory gene involved in inducing crowing in roosters. Crowing is known to be a testosterone (T)-dependent behavior, and it follows that roosters crow but not hens. Similarly, T-administration induces chicks to crow. By using RNA-sequencing to compare gene expression in the ICo between the two comparison groups that either crow or do not crow, we found that CCKBR expression was upregulated in T-containing groups. The expression of CCKBR and its ligand, cholecystokinin (CCK), a neurotransmitter, was observed in the ICo. We also showed that crowing was induced by intracerebroventricular administration of an agonist specific for CCKBR. Our findings therefore suggest that the CCK system induces innate vocalization in roosters.}, }
@article {pmid30846892, year = {2019}, author = {Uhl, F and Ringler, M and Miller, R and Deventer, SA and Bugnyar, T and Schwab, C}, title = {Counting crows: population structure and group size variation in an urban population of crows.}, journal = {Behavioral ecology : official journal of the International Society for Behavioral Ecology}, volume = {30}, number = {1}, pages = {57-67}, doi = {10.1093/beheco/ary157}, pmid = {30846892}, issn = {1045-2249}, abstract = {Social complexity arises from the formation of social relationships like social bonds and dominance hierarchies. In turn, these aspects may be affected by the degree of fission-fusion dynamics, i.e., changes in group size and composition over time. Whilst fission-fusion dynamics has been studied in mammals, birds have received comparably little attention, despite some species having equally complex social lives. Here, we investigated the influence of environmental factors on aspects of fission-fusion dynamics in a free-ranging population of carrion and hooded crows (Corvus corone ssp.) in the urban zoo of Vienna, Austria over a 1-year period. We investigated 1) the size and 2) spatio-temporal structure of the local flock, and 3) environmental influences on local flock and subgroup size. The local flock size varied considerably over the year, with fewest birds being present during the breeding season. The spatio-temporal structure of the local flock showed 4 distinct presence categories, of which the proportions changed significantly throughout the year. Environmental effects on both local flock and subgroup size were time of day, season, temperature, and weather, with additional pronounced effects of the structure of the surroundings and age class on subgroup size. Our findings show environmental influences on party size at the local flock and subgroup level, as well as indications of structured party composition in respect to the 4 presence categories. These results suggest that environmental factors have significant effects on fission-fusion dynamics in free-ranging crows, thereby influencing social complexity.}, }
@article {pmid30842442, year = {2019}, author = {Jelbert, SA and Hosking, RJ and Taylor, AH and Gray, RD}, title = {Publisher Correction: Mental template matching is a potential cultural transmission mechanism for New Caledonian crow tool manufacturing traditions.}, journal = {Scientific reports}, volume = {9}, number = {1}, pages = {4151}, doi = {10.1038/s41598-018-37178-2}, pmid = {30842442}, issn = {2045-2322}, abstract = {A correction to this article has been published and is linked from the HTML and PDF versions of this paper. The error has been fixed in the paper.}, }
@article {pmid30832245, year = {2019}, author = {Cortes-Rodriguez, N and Campana, MG and Berry, L and Faegre, S and Derrickson, SR and Ha, RR and Dikow, RB and Rutz, C and Fleischer, RC}, title = {Population Genomics and Structure of the Critically Endangered Mariana Crow (Corvus kubaryi).}, journal = {Genes}, volume = {10}, number = {3}, pages = {}, doi = {10.3390/genes10030187}, pmid = {30832245}, issn = {2073-4425}, support = {BB/G023913/2//Biotechnology and Biological Sciences Research Council (BBSRC) David Phillips Fellowship/ ; F14AF00120, F14AF01145, F15AF01118//U.S. Fish and Wildlife/ ; }, abstract = {The Mariana Crow, or Åga (Corvus kubaryi), is a critically endangered species (IUCN -International Union for Conservation of Nature), endemic to the islands of Guam and Rota in the Mariana Archipelago. It is locally extinct on Guam, and numbers have declined dramatically on Rota to a historical low of less than 55 breeding pairs throughout the island in 2013. Because of its extirpation on Guam and population decline on Rota, it is of critical importance to assess the genetic variation among individuals to assist ongoing recovery efforts. We conducted a population genomics analysis comparing the Guam and Rota populations and studied the genetic structure of the Rota population. We used blood samples from five birds from Guam and 78 birds from Rota. We identified 145,552 candidate single nucleotide variants (SNVs) from a genome sequence of an individual from Rota and selected a subset of these to develop an oligonucleotide in-solution capture assay. The Guam and Rota populations were genetically differentiated from each other. Crow populations sampled broadly across their range on Rota showed significant genetic structuring ⁻ a surprising result given the small size of this island and the good flight capabilities of the species. Knowledge of its genetic structure will help improve management strategies to help with its recovery.}, }
@article {pmid30800378, year = {2019}, author = {McCune, KB and Jablonski, P and Lee, SI and Ha, RR}, title = {Captive jays exhibit reduced problem-solving performance compared to wild conspecifics.}, journal = {Royal Society open science}, volume = {6}, number = {1}, pages = {181311}, doi = {10.1098/rsos.181311}, pmid = {30800378}, issn = {2054-5703}, abstract = {Animal cognitive abilities are frequently quantified in strictly controlled settings, with laboratory-reared subjects. Results from these studies have merit for clarifying proximate mechanisms of performance and the potential upper limits of certain cognitive abilities. Researchers often assume that performance on laboratory-based assessments accurately represents the abilities of wild conspecifics, but this is infrequently tested. In this experiment, we quantified the performance of wild and captive corvid subjects on an extractive foraging task. We found that performance was not equivalent, and wild subjects were faster at problem-solving to extract the food reward. By contrast, there was no difference in the time it took for captive and wild solvers to repeat the behaviour to get additional food rewards (learning speed). Our findings differ from the few other studies that have statistically compared wild and captive performance on assessments of problem-solving and learning. This indicates that without explicitly testing it, we cannot assume that captive animal performance on experimental tasks can be generalized to the species as a whole. To better understand the causes and consequences of a variety of animal cognitive abilities, we should measure performance in the social and physical environment in which the ability in question evolved.}, }
@article {pmid30800374, year = {2019}, author = {L'Herpiniere, KL and O'Neill, LG and Russell, AF and Duursma, DE and Griffith, SC}, title = {Unscrambling variation in avian eggshell colour and patterning in a continent-wide study.}, journal = {Royal Society open science}, volume = {6}, number = {1}, pages = {181269}, doi = {10.1098/rsos.181269}, pmid = {30800374}, issn = {2054-5703}, abstract = {The evolutionary drivers underlying marked variation in the pigmentation of eggs within many avian species remains unclear. The leading hypotheses proposed to explain such variation advocate the roles of genetic differences, signalling and/or structural integrity. One means of testing among these hypotheses is to capitalize on museum collections of eggs obtained throughout a broad geographical range of a species to ensure sufficient variation in predictors pertaining to each hypothesis. Here, we measured coloration and patterning in eggs from 272 clutches of Australian magpies (Cracticus tibicen) collected across most of their geographical range of ca 7 million km2; encompassing eight subspecies, variation in environmental parameters, and the presence/absence of a brood parasite. We found considerable variation in background colour, as well as in the extent and distribution of patterning across eggs. There was little evidence that this variation was explained by subspecies or the contemporary presence of a brood parasite. However, measures of maximum temperature, leaf area index and soil calcium all contributed to variation in egg appearance, although their explanatory power was relatively low. Our results suggest that multiple factors combine to influence egg appearance in this species, and that even in species with highly variable eggs, coloration is not readily explained.}, }
@article {pmid30782863, year = {2019}, author = {Anderson, YC and Kirkpatrick, K and Dolan, GMS and Wouldes, TA and Grant, CC and Cave, TL and Wild, CEK and Derraik, JGB and Cutfield, WS and Hofman, PL}, title = {Do changes in weight status affect cognitive function in children and adolescents with obesity? A secondary analysis of a clinical trial.}, journal = {BMJ open}, volume = {9}, number = {2}, pages = {e021586}, doi = {10.1136/bmjopen-2018-021586}, pmid = {30782863}, issn = {2044-6055}, abstract = {OBJECTIVES: It is unclear whether an association exists between obesity in children/adolescents and cognitive function, and whether the latter can be altered by body mass index (BMI) standard deviation score (SDS) reductions. We aimed to determine whether an association exists between BMI SDS and cognitive function in children/adolescents with obesity engaged in an obesity intervention. Second, we sought to determine if BMI SDS reduction at 12 months was associated with improved cognitive function.<br><br>DESIGN: Secondary analysis of a clinical trial.<br><br>PARTICIPANTS: Participants (n=69) were recruited from an obesity intervention. Eligible participants (recruited June 2013 to June 2015) were aged 6-16 years, with a BMI ≥98th centile or BMI >91st centile with weight-related comorbidities.<br><br>OUTCOME MEASURES: Primary outcome measure was change in BMI SDS from baseline at 12 months. Dependent variables of cognitive functioning and school achievement were assessed at baseline and 12 months, using dependent variables of cognitive functioning (elements of Ravens Standard Progressive Matrices, Wide Range Achievement Test-fourth edition and Wechsler Intelligence Scale for Children-fourth edition).<br><br>RESULTS: At baseline, BMI SDS was not associated with all aspects of cognitive function tested (n=69). Reductions in BMI SDS over time did not alter cognitive function overall. However, there was a greater reduction in comprehension standard scores in participants who increased their BMI SDS (adjusted estimated difference -6.1, 95% CI -11.6 to -0.6; p=0.03).<br><br>CONCLUSIONS: There were no observed associations between BMI SDS and cognitive function in participants, apart from comprehension in the exploratory analyses, which may have been a random finding. Further studies need to include larger longitudinal cohorts incorporating a wider BMI range at entry to determine whether our findings persist.<br><br>TRIAL REGISTRATION NUMBER: ANZCTR12611000862943; Pre-results.}, }
@article {pmid30773853, year = {2019}, author = {Hong, K and Wong, IYH and Singh, K and Chang, RT}, title = {Corneal Biomechanics Using a Scheimpflug-Based Noncontact Device in Normal-Tension Glaucoma and Healthy Controls.}, journal = {Asia-Pacific journal of ophthalmology (Philadelphia, Pa.)}, volume = {}, number = {}, pages = {}, doi = {10.22608/APO.2018334}, pmid = {30773853}, issn = {2162-0989}, abstract = {PURPOSE: To determine if a novel biomechanical parameter, corneal applanation velocity, as measured by the Corvis ST, is associated with a diagnosis of normal-tension glaucoma (NTG).<br><br>DESIGN: Prospective, cross-sectional study.<br><br>METHODS: Study and control subjects were recruited from the ophthalmology clinic of a university teaching hospital in Hong Kong over an 8-week period in 2013. A total of 80 eyes with NTG diagnosis and 155 healthy eyes randomly selected to be in the control group were included in the final analysis. All subjects underwent corneal biomechanical testing with the Oculus Corvis ST non-contact tonometer. Logistic regression analysis adjusted for age and central corneal thickness was conducted to assess the relationship between inward and outward applanation velocity and the risk of NTG. Secondary outcome variables included corneal applanation time, length, amplitude, and highest concavity.<br><br>RESULTS: Inward applanation velocity was faster in the NTG eyes (0.15 ± 0.02 m/s) than in the control eyes (0.14 ± 0.02 m/s) (P = 0.016). The odds ratio for a 0.01 m/s increase in inward applanation velocity when comparing NTG eyes with control eyes adjusted for age and central corneal thickness was 1.15 (95% confidence interval, 1.03-1.30) (P = 0.016). There was no evidence that outward applanation velocity or any secondary corneal biomechanical variable differed between the NTG and control eyes.<br><br>CONCLUSIONS: Normal-tension glaucoma eyes demonstrated a small, statistically significant faster corneal inward applanation velocity than normal control eyes.}, }
@article {pmid30763308, year = {2019}, author = {Bauch, C and Boonekamp, JJ and Korsten, P and Mulder, E and Verhulst, S}, title = {Epigenetic inheritance of telomere length in wild birds.}, journal = {PLoS genetics}, volume = {15}, number = {2}, pages = {e1007827}, doi = {10.1371/journal.pgen.1007827}, pmid = {30763308}, issn = {1553-7404}, abstract = {Telomere length (TL) predicts health and survival across taxa. Variation in TL between individuals is thought to be largely of genetic origin, but telomere inheritance is unusual, because zygotes already express a TL phenotype, the TL of the parental gametes. Offspring TL changes with paternal age in many species including humans, presumably through age-related TL changes in sperm, suggesting an epigenetic inheritance mechanism. However, present evidence is based on cross-sectional analyses, and age at reproduction is confounded with between-father variation in TL. Furthermore, the quantitative importance of epigenetic TL inheritance is unknown. Using longitudinal data of free-living jackdaws Corvus monedula, we show that erythrocyte TL of subsequent offspring decreases with parental age within individual fathers, but not mothers. By cross-fostering eggs, we confirmed the paternal age effect to be independent of paternal age dependent care. Epigenetic inheritance accounted for a minimum of 34% of the variance in offspring TL that was explained by paternal TL. This is a minimum estimate, because it ignores the epigenetic component in paternal TL variation and sperm TL heterogeneity within ejaculates. Our results indicate an important epigenetic component in the heritability of TL with potential consequences for offspring fitness prospects.}, }
@article {pmid30744978, year = {2019}, author = {Gruber, R and Schiestl, M and Boeckle, M and Frohnwieser, A and Miller, R and Gray, RD and Clayton, NS and Taylor, AH}, title = {New Caledonian Crows Use Mental Representations to Solve Metatool Problems.}, journal = {Current biology : CB}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.cub.2019.01.008}, pmid = {30744978}, issn = {1879-0445}, abstract = {One of the mysteries of animal problem-solving is the extent to which animals mentally represent problems in their minds. Humans can imagine both the solution to a problem and the stages along the way [1-3], such as when we plan one or two moves ahead in chess. The extent to which other animals can do the same is far less clear [4-25]. Here, we presented New Caledonian crows with a series of metatool problems where each stage was out of sight of the others and the crows had to avoid either a distractor apparatus containing a non-functional tool or a non-functional apparatus containing a functional tool. Crows were able to mentally represent the sub-goals and goals of metatool problems: crows kept in mind the location and identities of out-of-sight tools and apparatuses while planning and performing a sequence of tool behaviors. This provides the first conclusive evidence that birds can plan several moves ahead while using tools.}, }
@article {pmid30733635, year = {2019}, author = {de Luna-Dias, C and de Carvalho-E-Silva, SP}, title = {Calls of Boanalatistriata (Caramaschi &amp; Cruz, 2004) (Amphibia, Anura, Hylidae), an endemic tree frog from the State of Minas Gerais, Brazil.}, journal = {ZooKeys}, volume = {}, number = {820}, pages = {83-94}, doi = {10.3897/zookeys.820.30711}, pmid = {30733635}, issn = {1313-2989}, abstract = {Bioacoustical data are useful for studying amphibians, especially their conservation, taxonomy, and evolution, among others. Of the 12 species of the Boanapolytaenia clade, only B.buriti and B.latistriata have no published information about their advertisement calls. We recorded four males of B.latistriata in its type locality at Parque Nacional do Itatiaia, south-eastern Brazil. We used a Roland R26 digital recorder with a Sennheiser ME-67 microphone and analysed the recordings using the Raven Pro 1.5 software. We recorded two different types of calls (call A and call B). Both were composed of one pulsed note and presented a slightly ascending-descending frequency modulation. Call A was more frequent, having durations between 0.042 and 0.093 s with the dominant frequency ranging from 3375.0 to 3937.5 Hz, and was composed of 11 to 21 pulses separated by intervals that were not fully silent. Call B had durations between 0.711 and 1.610 s, with dominant frequency from 3281.2 to 3750.0 Hz, and was composed of 11 to 29 pulses separated by fully silent intervals. Among the B.polytaenia clade, the calls of B.latistriata are more similar to those of B.bandeirantes, B.beckeri, B.polytaenia, and B.aff.beckeri. The calls of B.latistriata differ from these species in its lower dominant frequency. Boanalatistriata present a short, single-note call with a lower pulse period (call A) and a long call with higher pulse period (call B), which differ from the other species of the clade. The coefficients of variation for the various bioacoustical attributes were calculated within- and between-males and these have been discussed. We also report a fight event between two males of B.latistriata. This is the first report of a fight in members of the B.polytaenia clade.}, }
@article {pmid30727944, year = {2019}, author = {Veiga, IMB and Lüschow, D and Gutzer, S and Hafez, HM and Mühldorfer, K}, title = {Phylogenetic relationship of Ornithobacterium rhinotracheale isolated from poultry and diverse avian hosts based on 16S rRNA and rpoB gene analyses.}, journal = {BMC microbiology}, volume = {19}, number = {1}, pages = {31}, doi = {10.1186/s12866-019-1395-9}, pmid = {30727944}, issn = {1471-2180}, support = {BK20160064//Natural Science Foundation of Jiangsu Province/ ; 31802222//National Natural Science Foundation of China/ ; 2017YFD0500804//National Key Research and Development Program of China/ ; }, abstract = {BACKGROUND: Ornithobacterium (O.) rhinotracheale is an emerging bacterial pathogen in poultry and not fully understood to date. Because of its importance particularly for the global turkey meat industry, reliable diagnostic and characterization methods are needed for early treatment and in future for better vaccine production. The host range of birds infected by O. rhinotracheale or carrying the bacterium in their respiratory tract has constantly increased raising important epidemiological and taxonomic questions for a better understanding of its diversity, ecology and transmission cycles. The purpose of this study was to introduce partial rpoB gene sequencing for O. rhinotracheale into routine diagnostics to differentiate strains isolated from poultry and more diverse avian hosts (i.e., birds of prey, corvids and pigeons) and to compare phylogenetic relationships with results from 16S rRNA gene analysis and multilocus sequence typing (MLST).<br><br>RESULTS: Partial 16S rRNA gene analysis revealed a high level of homogeneity among the 65 investigated O. rhinotracheale sequences with similarity values ranging from 98.6 to 100% between sequences from non-galliform and poultry species. The corresponding rpoB gene sequences were heterogeneous and ranged in their similarity values from 85.1 to 100%. The structure of the rpoB tree was in strong correlation with previous MLST results revealing three main clusters A (poultry and birds of prey), B (poultry, birds of prey and corvids) and C (pigeons), which were clearly separated from each other.<br><br>CONCLUSIONS: By using partial sequences from a single gene, the rpoB gene analysis is in good agreement with MLST results with a slight decrease in resolution to distinguish more similar strains. The present results provide strong evidence that traditional phenotypic and genetic methods may not properly represent the heterogeneous group of bacteria classified as O. rhinotracheale. From housekeeping gene analyses, it is very likely that the genus Ornithobacterium includes additional species and partial rpoB gene sequencing can be recommended as fast, cost-effective and readily available method to identify strains and differentiate between O. rhinotracheale and Ornithobacterium-like bacteria.}, }
@article {pmid30722626, year = {2013}, author = {Shaver, JB and Agudelo, P and Martin, SB}, title = {First Report of Stubby Root Caused by Trichodorus obtusus on Zoysiagrass and Bermudagrass in South Carolina.}, journal = {Plant disease}, volume = {97}, number = {6}, pages = {852}, doi = {10.1094/PDIS-10-12-0932-PDN}, pmid = {30722626}, issn = {0191-2917}, abstract = {In September 2011, diagnostic samples were taken from 'Tifway' Bermudagrass (Cynodon dactylon × C. transvaalensis) tees and from 'Emerald' Zoysia (Zoysia japonica) roughs of a golf course in Charleston, SC. Additional samples were taken from a sod farm located near Charleston, SC from a field of 'Empire' Zoysia. The soil was sandy loam and the samples were taken at a depth of 10 to 15 cm from symptomatic turf. Symptoms on bermudagrass and zoysiagrass included stubby roots and lightly to severely chlorotic or dead patches of irregular sizes and shapes. Nematodes were extracted by sugar centrifugal-flotation and counted. The predominant nematode species recovered was Trichodorus obtusus Cobb, 1913: syn. T. proximus Allen, 1957, n.syn. (3). Nematode densities (per 100 cm3 of soil) were 30 to 170 (average 94, n = 5) at the sod farm, and 30 to 230 (average 107, n = 7) at the golf course. This nematode has been reported as a pathogen of bermudagrass in Florida, where it is more damaging than Paratrichodorus minor, the other stubby root nematode commonly associated with turfgrass (1). In Florida, 120 T. obtusus individuals per 100 cm3 is considered high risk (2). We have encountered several additional samples from across South Carolina with comparable densities since our first diagnosis. Infested soil (94 individuals per 100 cm3) collected from the sod farm was put into columns and planted with 'Empire' sod and maintained in the greenhouse. After 140 days, the population density increased to an average of 230 individuals per 100 cm3. Plants were prone to wilting and new root growth showed symptoms similar to those observed in the field. Morphologic and morphometric identification of T. obtusus was made by examining male and female specimens in temporary water mounts. Males had ventrally curved spicules with three ventral precloacal papillae, with the posterior papilla just anterior to the head of the retracted spicules, one ventromedian cervical papilla anterior to the excretory pore, and tail with non-thickened terminal cuticle. Females had a deep, barrel-shaped, pore-like vulva, and one or two postadvulvar lateral body pores on each side. Males and females had distinctly offset esophagus. Females (n = 10) were 1,100 to 1,440 (1,250) μm long, body width 40 to 53 (45) μm, onchiostyle 63 to 75 (67) μm, and V 583 to 770 (673) μm. Males (n = 10) were 1,076 to 1,353 (1,222) μm long, body width 33 to 45 (39) μm, onchiostyle 62 to 69 (65) μm, and spicule 55 to 63 (59) μm. From individuals representing the two locations, an 898-bp section of the 18S rDNA region was sequenced using primers 37F (5'-GCCGCGAAAAGCTCATTACAAC-3') and 932R (5'-TATCTGATCGCTGTCGAACC-3') (4). A BLASTn search revealed no similar sequences to those of our two populations (Accessions JX289834 and JX279930). As such, it appears that these are the first sequences of this portion of the 18S rDNA for T. obtusus, although a different, non-overlapping portion of 18S was found in GenBank (AY146460) under the synonym T. proximus. To our knowledge, this is the first report of T. obtusus on zoysiagrass and the first report of the species on bermudagrass in South Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. T. Crow et al. Florida Nematode Management Guide. SP-54. University of Florida, Gainesville, 2003. (3) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands. Pp. 27-30, 1995. (4) I. Duarte et al. Nematology 12:171, 2010.}, }
@article {pmid30723505, year = {2018}, author = {Titah, HS and Abdullah, SRS and Idris, M and Anuar, N and Basri, H and Mukhlisin, M and Tangahu, BV and Purwanti, IF and Kurniawan, SB}, title = {Arsenic Resistance and Biosorption by Isolated Rhizobacteria from the Roots of Ludwigia octovalvis.}, journal = {International journal of microbiology}, volume = {2018}, number = {}, pages = {3101498}, doi = {10.1155/2018/3101498}, pmid = {30723505}, issn = {1687-918X}, abstract = {Certain rhizobacteria can be applied to remove arsenic in the environment through bioremediation or phytoremediation. This study determines the minimum inhibitory concentration (MIC) of arsenic on identified rhizobacteria that were isolated from the roots of Ludwigia octovalvis (Jacq.) Raven. The arsenic biosorption capability of the was also analyzed. Among the 10 isolated rhizobacteria, five were Gram-positive (Arthrobacter globiformis, Bacillus megaterium, Bacillus cereus, Bacillus pumilus, and Staphylococcus lentus), and five were Gram-negative (Enterobacter asburiae, Sphingomonas paucimobilis, Pantoea spp., Rhizobium rhizogenes, and Rhizobium radiobacter). R. radiobacter showed the highest MIC of >1,500 mg/L of arsenic. All the rhizobacteria were capable of absorbing arsenic, and S. paucimobilis showed the highest arsenic biosorption capability (146.4 ± 23.4 mg/g dry cell weight). Kinetic rate analysis showed that B. cereus followed the pore diffusion model (R2 = 0.86), E. asburiae followed the pseudo-first-order kinetic model (R2 = 0.99), and R. rhizogenes followed the pseudo-second-order kinetic model (R2 = 0.93). The identified rhizobacteria differ in their mechanism of arsenic biosorption, arsenic biosorption capability, and kinetic models in arsenic biosorption.}, }
@article {pmid30718374, year = {2019}, author = {Wu, CC and Klaesson, A and Buskas, J and Ranefall, P and Mirzazadeh, R and Söderberg, O and Wolf, JBW}, title = {In situ quantification of individual mRNA transcripts in melanocytes discloses gene regulation of relevance to speciation.}, journal = {The Journal of experimental biology}, volume = {}, number = {}, pages = {}, doi = {10.1242/jeb.194431}, pmid = {30718374}, issn = {1477-9145}, abstract = {Functional validation of candidate genes involved in adaptation and speciation remains challenging. We here exemplify the utility of a method quantifying individual mRNA transcripts in revealing the molecular basis of divergence in feather pigment synthesis during early-stage speciation in crows. Using a padlock probe assay combined with rolling circle amplification, we quantified cell type specific gene expression in the histological context of growing feather follicles. Expression of Tyrosinase Related Protein 1 (TYRP1), Solute Carrier Family 45 member 2 (SLC45A2) and Hematopoietic Prostaglandin D Synthase (HPGDS) was melanocyte-limited and significantly reduced in follicles from hooded crow explaining the substantially lower eumelanin content in grey vs. black feathers. The central upstream Melanocyte Inducing Transcription Factor (MITF) only showed differential expression specific to melanocytes - a feature not captured by bulk RNA-seq. Overall, this study provides insight into the molecular basis of an evolutionary young transition in pigment synthesis, and demonstrates the power of histologically explicit, statistically substantiated single-cell gene expression quantification for functional genetic inference in natural populations.}, }
@article {pmid30711042, year = {2019}, author = {Asghari, A and Sadraei, J and Pirestani, M and Mohammadpour, I}, title = {First molecular identification and subtype distribution of Blastocystis sp. isolated from hooded crows (Corvus cornix) and pigeons (Columba livia) in Tehran Province, Iran.}, journal = {Comparative immunology, microbiology and infectious diseases}, volume = {62}, number = {}, pages = {25-30}, doi = {10.1016/j.cimid.2018.11.013}, pmid = {30711042}, issn = {1878-1667}, abstract = {Blastocystis is a common intestinal parasite among humans and animals such as non-human primates, pigs, cattle, birds, amphibians, and less frequently, rats, reptiles and insects. Since Blastocystis is a widely transmissible parasite between humans and mammals or birds, it is prominent to determine whether newly secluded non-human isolates are zoonotic. There are no comprehensive studies in Iran assessing the prevalence and molecular identification of Blastocystis infection in birds, especially in pigeons and crows. So, the aim of this study was to identify Blastocystis subtypes (STs) in crows and pigeons in Tehran province, Iran, using Nested PCR-RFLP and sequencing. Overall, 300 Blastocystis isolates from birds (156 pigeons and 144 crows) were subtyped by PCR, and the homology among isolates was then confirmed by RFLP analysis of the 18S rRNA gene. The prevalence of Blastocystis infection was detected 42.9% in pigeons and 44.4% in crows. All positive pigeons were owned by ST13 (100%). Among crows, 46 samples (71.8%) like pigeons were ST13, and 13 samples (20.3%) were ST14. Five samples (7.9%) remained unknown. This study was the first report of ST13 and ST14 of Blastocystis from birds. In the present study, our data revealed a high prevalence of Blastocystis sp. in pigeon's and crow's samples and the isolates from these birds were classified into two genetically distinct STs. Therefore, birds appear to be infected with various STs. It is important to determine the phylogenetic relationships between unknown STs from these birds and the multiple STs of Blastocystis.}, }
@article {pmid30694341, year = {2019}, author = {Ruiz-Ripa, L and Gómez, P and Alonso, CA and Camacho, MC and de la Puente, J and Fernández-Fernández, R and Ramiro, Y and Quevedo, MA and Blanco, JM and Zarazaga, M and Höfle, U and Torres, C}, title = {Detection of MRSA of Lineages CC130-mecC and CC398-mecA and Staphylococcus delphini-lnu(A) in Magpies and Cinereous Vultures in Spain.}, journal = {Microbial ecology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s00248-019-01328-4}, pmid = {30694341}, issn = {1432-184X}, support = {SAF2016-76571-R//Ministerio de Econom?a, Industria y Competitividad, Gobierno de Espa?a/ ; }, abstract = {The aim of this study was to determine the carriage rate of coagulase-positive staphylococci (CoPS) in wild birds and to characterize recovered isolates. Tracheal samples from 324 wild birds, obtained in different Spanish regions during 2015-2016, were screened for CoPS carriage. The antimicrobial resistance profile and the virulence gene content were investigated. Molecular typing was performed by spa, agr, MLST, SCCmec, and S. delphini group classification. CoPS were recovered from 26 samples of wild birds (8.3%), and 27 isolates were further characterized. Two CoPS species were detected: S. aureus (n = 15; eight cinereous vultures and seven magpies) and S. delphini (n = 12; 11 cinereous vultures and one red kite). Thirteen S. aureus were methicillin-resistant (MRSA) and the remaining two strains were methicillin-susceptible (MSSA). Twelve MRSA were mecC-positive, typed as t843-ST1583/ST1945/ST1581/ST1571 (n = 11) and t1535-ST1945 (n = 1) (all of clonal-complex CC130); they were susceptible to the non-β-lactams tested. The remaining MRSA strain carried the mecA gene, was typed as t011-ST398-CC398-agrI-SCCmec-V, and showed a multiresistance phenotype. MSSA isolates were ascribed to lineages ST97-CC97 and ST425-CC425. All S. aureus lacked the studied virulence genes (lukS/F-PV, tst, eta, etb, and etd), and the IEC type E (with scn and sak genes) was detected in four mecC-positive and one MSSA isolates. S. delphini strains were methicillin-susceptible but showed resistance to at least one of the antimicrobials tested, with high penicillin (75%, with blaZ gene) and tetracycline [58%, with tet(K)± tet(L)] resistance rates. All S. delphini isolates presented the virulence genes lukS-I, siet, and se-int, and four carried the clindamycin-resistance lnu(A) gene.}, }
@article {pmid30703978, year = {2014}, author = {Barnes, I and Walla, JA and Bergdahl, A and Wingfield, MJ}, title = {Four New Host and Three New State Records of Dothistroma Needle Blight Caused by Dothistroma pini in the United States.}, journal = {Plant disease}, volume = {98}, number = {10}, pages = {1443}, doi = {10.1094/PDIS-06-14-0606-PDN}, pmid = {30703978}, issn = {0191-2917}, abstract = {During 2010 and 2011, Dothistroma needle blight (DNB), also known as red band needle blight, was observed for the first time in Cass and Pembina counties in North Dakota (ND). In Pembina Co., DNB was observed in two sites in the Jay V. Wessels Wildlife Management Area (JWWMA). In September 2009, yellow spots on green needles were observed on some trees along the western edge of one planting. By June 2010, DNB was found on third- and fourth-year needles in both JWWMA plantings. Symptoms had developed into dark brown bands or spots on necrotic needles that contained erumpent black acervuli. In June 2011, similar DNB symptoms were observed on Pinus nigra, P. flexilis, P. ponderosa, P. cembra, and P. albicaulis in the Dale E. Herman Research Arboretum, Cass Co., ND. DNB was collected in July 2011 in Brookings Co., South Dakota (SD), from a seed source provenance planting of P. ponderosa. To identify the species causing the infections, symptomatic needles were collected in 2010 from both sites in JWWMA and then again from all four locations in 2011 on all pine species infected. Needles of P. nigra from a private residence near Fairland in Shelby County, Indiana (IN), were also included in the sample set. The rDNA-ITS was PCR-amplified either directly from conidia obtained from acervuli on the needles or from cultures obtained from isolations. Amplicons were sequenced and a BLAST search was performed in GenBank. The sequences of samples obtained from P. nigra, P. flexilis, P. cembra, and P. albicaulis in ND, P. ponderosa in SD, and P. nigra from IN showed 100% sequence homology with Dothistroma pini (Accession No. AY808302). These isolates were identical to all previously assayed isolates of D. pini from Nebraska, Minnesota, and Michigan in the United States. The P. ponderosa isolates from all three sites in ND differed from the other isolates and contained a 1-bp point mutation from a C to a T at site 72 (sequence deposited in GenBank, accession KJ933441). Mating type was determined using species-specific mating type primers for D. pini (3). All 26 samples from ND and SD were of the MAT-1 idiomorph, while the sample from IN contained the MAT-2 idiomorph. All cultures are maintained at FABI, University of Pretoria, South Africa. The two species that cause DNB, D. septosporum (G. Dorog.) M. Morelet and D. pini Hulbary, are morphologically indistinguishable and molecular characterization remains essential for correct species identification (1). Host and geographical distribution range determinations of Dothistroma spp. made without molecular methods are not valid. To date, species confirmed using DNA sequences in the United States include D. septosporum in the Pacific Northwest states of Oregon and Idaho on P. ponderosa, in Montana on P. contorta v. latifolia, and D. pini in the North Central states of Nebraska, Minnesota, and Michigan on P. nigra (1). This study documents the presence of D. pini in three additional states, including a first report of DNB in ND and SD. It also includes new records of D. pini infecting P. flexilis, P. cembra, P. albicaulis, and P. ponderosa. Results of this study have expanded the documented host range of D. pini in the United States from one (P. nigra) to five species. Globally, D. pini is now known to infect a total of 10 pine hosts (2,4,5). References: (1) I. Barnes et al. Stud. Mycol. 50:551, 2004. (2) I. Barnes et al. For. Pathol. 41:361, 2011. (3) M. Groenewald et al. Phytopathology 97:825, 2007. (4) D. Piou et al. Plant Dis. 98:841, 2014. (5) B. Piskur et al. For. Pathol. 43:518, 2013.}, }
@article {pmid30704017, year = {2019}, author = {Gryz, J and Krauze-Gryz, D}, title = {Indirect Influence of African Swine Fever Outbreak on the Raven (Corvus corax) Population.}, journal = {Animals : an open access journal from MDPI}, volume = {9}, number = {2}, pages = {}, doi = {10.3390/ani9020041}, pmid = {30704017}, issn = {2076-2615}, support = {240115, 240104//MInistry of Environment/ ; }, abstract = {Carrion plays a crucial role in the raven's diet. In the past, domestic pig carrion was widely available in Poland. This changed with an African swine fever (ASF) outbreak and the introduction of strict procedures aimed at stopping the virus from spreading. We compared data from Central Poland (field and forest mosaic, study area of 105 km²) for two periods, i.e., before (2011⁻2014) and after the ASF outbreak (2015⁻2018). In breeding seasons, nests of ravens were found, juveniles were counted, and the time when juveniles left their nests was recorded. Diet composition data were based on pellet analysis and direct observations of feeding birds. The number of breeding pairs dropped from 12.3 to 7.5 in the second period. Breeding parameters were similar. However, birds in the second period had fewer fledglings per successful pair. Domestic pig carrion was found to be an important food item, and with its limited supply, ravens changed their diet, i.e., they fed on the carrion of dogs and cats or preyed on small vertebrates more often. Overall, our study points to a crucial role of the availability of the carrion of big farm animals (i.e., domestic pig) in maintaining the high density of breeding raven populations.}, }
@article {pmid30699582, year = {2015}, author = {Ye, W and Zeng, Y and Kerns, J}, title = {First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.}, journal = {Plant disease}, volume = {99}, number = {2}, pages = {291}, doi = {10.1094/PDIS-08-14-0830-PDN}, pmid = {30699582}, issn = {0191-2917}, abstract = {In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5' GCTTGTCTCAAAGATTAAGCC 3'), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.}, }
@article {pmid30697741, year = {2019}, author = {Sen, S and Parishar, P and Pundir, AS and Reiner, A and Iyengar, S}, title = {The Expression of Tyrosine Hydroxylase and DARPP-32 in the House Crow (Corvus splendens) brain.}, journal = {The Journal of comparative neurology}, volume = {}, number = {}, pages = {}, doi = {10.1002/cne.24649}, pmid = {30697741}, issn = {1096-9861}, abstract = {Birds of the family Corvidae which includes diverse species such as crows, rooks, ravens, magpies, jays and jackdaws are known for their amazing abilities at problem-solving. Since the catecholaminergic system, especially the neurotransmitter dopamine, plays a role in cognition, we decided to study the distribution of tyrosine hydroxylase (TH), the rate-limiting enzyme in the synthesis of catecholamines in the brain of house crows (Corvus splendens). We also studied the expression of DARPP-32 (dopamine and cAMP-regulated phosphoprotein), which is expressed in dopaminoceptive neurons. Our results demonstrated that as in other avian species, the expression of both TH and DARPP-32 was highest in the house crow striatum. The caudolateral nidopallium (NCL, the avian analogue of the mammalian prefrontal cortex) could be differentiated from the surrounding pallial regions based on a larger number of TH-positive 'baskets' of fibers around neurons in this region and greater intensity of DARPP-32 staining in the neuropil in this region. House crows also possessed distinct nuclei in their brains which corresponded to song control regions in other songbirds. Whereas immunoreactivity for TH was higher in the vocal control region Area X compared to the surrounding MSt (medial striatum) in house crows, staining in RA and HVC was not as prominent. Further, the arcopallial song control regions RA (nucleus robustus arcopallialis) and AId (intermediate arcopallium) were strikingly negative for DARPP-32 staining, in contrast to the surrounding arcopallium. Patterns of immunoreactivity for TH and DARPP-32 in 'limbic' areas such as the hippocampus, septum and extended amygdala have also been described. This article is protected by copyright. All rights reserved.}, }
@article {pmid30683665, year = {2019}, author = {Matsui, H and Izawa, EI}, title = {Rapid adjustment of pecking trajectory to prism-induced visual shifts in crows as compared to pigeons.}, journal = {The Journal of experimental biology}, volume = {}, number = {}, pages = {}, doi = {10.1242/jeb.182345}, pmid = {30683665}, issn = {1477-9145}, abstract = {Pecking in birds is analogous to reaching and grasping movements in primates. Earlier studies on visuomotor control in birds, which were conducted mostly in pigeons, suggested that avian pecking is controlled feedforwardly, and is out of the control of visual guidance during movement. However, recent studies using crows suggested a role of vision in pecking control during movement. To unveil what visuomotor mechanisms underlie the flexibility of pecking in crows, the current study examined whether pigeons and crows adjust their pecking to the visual distortion induced by prisms. Because prisms induce visual shifts of object positions, birds were required to adjust their movements. Pecking kinematics were examined before and after attaching prisms in front of the birds' eyes. Analysis of lateral deviation caused by the prisms showed that crows rapidly adjusted their pecking trajectories, but pigeons did slowly. Angular displacement also increased in pigeons after attachment of the prism but decreased in crows. These responses to prisms were consistent among individuals in pigeons but varied in crows, though the adjustment of pecking commonly succeeded in crows. These results suggest that pecking in pigeons predominantly involves feedforward control and that the movement is determined depending on the visual information available before the initiation of pecking. In contrast, the results from crows suggest that their pecking trajectories are corrected during the movement, supporting on-line visual control. Our findings were the first evidence to suggest the on-line visual control of pecking in birds.}, }
@article {pmid30679660, year = {2019}, author = {Umbers, KDL and White, TE and De Bona, S and Haff, T and Ryeland, J and Drinkwater, E and Mappes, J}, title = {The protective value of a defensive display varies with the experience of wild predators.}, journal = {Scientific reports}, volume = {9}, number = {1}, pages = {463}, doi = {10.1038/s41598-018-36995-9}, pmid = {30679660}, issn = {2045-2322}, support = {HSF14/3//The Hermon Slade Foundation/ ; }, abstract = {Predation has driven the evolution of diverse adaptations for defence among prey, and one striking example is the deimatic display. While such displays can resemble, or indeed co-occur with, aposematic 'warning' signals, theory suggests deimatic displays may function independently of predator learning. The survival value of deimatic displays against wild predators has not been tested before. Here we used the mountain katydid Acripeza reticulata to test the efficacy of a putative deimatic display in the wild. Mountain katydids have a complex defence strategy; they are camouflaged at rest, but reveal a striking red-, blue-, and black-banded abdomen when attacked. We presented live katydids to sympatric (experienced) and allopatric (naive) natural predators, the Australian magpie Cracticus tibicen, and observed bird reactions and katydid behaviors and survival during repeated interactions. The efficacy of the katydids' defence differed with predator experience. Their survival was greatest when faced with naïve predators, which provided clear evidence of the protective value of the display. In contrast, katydid survival was consistently less likely when facing experienced predators. Our results suggest that sympatric predators have learned to attack and consume mountain katydids despite their complex defense, and that their post-attack display can be an effective deterrent, particularly against naïve predators. These results suggest that deimatism does not require predator learning to afford protection, but that a predator can learn to expect the display and subsequently avoid it or ignore it. That sympatric predators learn to ignore the defense is a possible explanation for the mountain katydid's counter-intuitive behavior of revealing warning colors only after tactile stimuli from predator attack.}, }
@article {pmid30679066, year = {2019}, author = {Dresow, M}, title = {Macroevolution evolving: Punctuated equilibria and the roots of Stephen Jay Gould's second macroevolutionary synthesis.}, journal = {Studies in history and philosophy of biological and biomedical sciences}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.shpsc.2019.01.003}, pmid = {30679066}, issn = {1879-2499}, }
@article {pmid30678427, year = {2019}, author = {S, P and N, KV and S, S}, title = {Breast Cancer Detection using Crow Search Optimization based Intuitionistic Fuzzy Clustering with Neighborhood Attraction.}, journal = {Asian Pacific journal of cancer prevention : APJCP}, volume = {20}, number = {1}, pages = {157-165}, doi = {10.31557/APJCP.2019.20.1.157}, pmid = {30678427}, issn = {2476-762X}, }
@article {pmid30668633, year = {2019}, author = {Wouters, H and Hilmer, SN and Gnjidic, D and Van Campen, JP and Teichert, M and Van Der Meer, HG and Schaap, LA and Huisman, M and Comijs, HC and Denig, P and Lamoth, CJ and Taxis, K}, title = {Long-term exposure to anticholinergic and sedative medications and cognitive and physical function in later life.}, journal = {The journals of gerontology. Series A, Biological sciences and medical sciences}, volume = {}, number = {}, pages = {}, doi = {10.1093/gerona/glz019}, pmid = {30668633}, issn = {1758-535X}, abstract = {Background: Anticholinergic and sedative medications are frequently prescribed to older individuals. These medications are associated with short-term cognitive and physical impairment, but less is known about long-term associations. We therefore examined over twenty years whether cumulative exposure to these medications was related to poorer cognitive and physical functioning.<br><br>Methods: Older adult participants of the Longitudinal Aging Study Amsterdam (LASA) were followed from 1992-2012. On 7 measurement occasions, cumulative exposure to anticholinergic and sedative medications was quantified with the Drug Burden Index (DBI), a linear additive pharmacological dose-response model. Cognitive functioning was assessed with the Mini Mental State Examination (MMSE), Alphabet Coding Task (ACT, 3 trials), Auditory Verbal Learning Test (AVLT, learning and retention condition), and Raven Colored Progressive Matrices (RCPM, 2 trials). Physical functioning was assessed with the Walking Test (WT), Cardigan Test (CT), Chair Stands Test (CST), Balance Test (BT), and self-reported Functional Independence (FI). Data were analyzed with linear mixed models adjusted for age, education, sex, living with a partner, BMI, depressive symptoms, co-morbidities (cardiovascular disease, diabetes, cancer, COPD, osteoarthritis, CNS diseases), and prescribed medications.<br><br>Results: Longitudinal associations were found of the DBI with poorer cognitive functioning (less items correct on the 3 ACT trials, AVLT learning condition, and the 2 RCPM trials) and with poorer physical functioning (longer completion time on the CT, CST, and lower self-reported FI).<br><br>Conclusions: This longitudinal analysis of data collected over 20 years, showed that higher long-term cumulative exposure to anticholinergic and sedative medications was associated with poorer cognitive and physical functioning.}, }
@article {pmid30663512, year = {2019}, author = {Kleider-Offutt, HM}, title = {Afraid of one afraid of all: When threat associations spread across face-types.}, journal = {The Journal of general psychology}, volume = {}, number = {}, pages = {1-18}, doi = {10.1080/00221309.2018.1540397}, pmid = {30663512}, issn = {1940-0888}, abstract = {Fear can be acquired for objects not inherently associated with threat (e.g. birds), and this threat may generalize from prototypical to peripheral category members (e.g. crows vs. penguins). When categorizing people, pervasive stereotypes link Black men to assumed violence and criminality. Faces with Afrocentric features (prototypical) are more often associated with threat and criminality than non-Afrocentric (peripheral) faces regardless of whether the individual is Black or White. In this study, using a priming paradigm, threat associations related to negative racial stereotypes were tested as a vehicle for spreading fear across face-type categories. Results showed more negative than positive judgments for White face targets but only when the prime was primarily non-Afrocentric (i.e. Eurocentric). Black face targets were judged more negatively than positively regardless of prime. This suggests some cognitive processes related to threat generalizations of objects extend to complex social categories.}, }
@article {pmid30650339, year = {2019}, author = {Rubi, TL and Clark, DL and Keller, JS and Uetz, GW}, title = {Courtship behavior and coloration influence conspicuousness of wolf spiders (Schizocosa ocreata (Hentz)) to avian predators.}, journal = {Behavioural processes}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.beproc.2018.12.023}, pmid = {30650339}, issn = {1872-8308}, abstract = {Signalers must balance the benefits of detection by intended receivers with the costs of detection by eavesdroppers. This trade-off is exemplified by sexual signaling systems, in which signalers experience sexual selection for conspicuousness to mates as well as natural selection for crypsis to predators. In this study, we examined how courtship behavior and body coloration influenced the conspicuousness of males to avian predators in the well-studied brush-legged wolf spider system (Schizocosa ocreata (Hentz)). We focused on three behaviors (courtship, walking, and freezing) and two coloration schemes (natural coloration and idealized background-matching coloration). We presented captive blue jays (Cyanocitta cristata) with video playbacks of male spiders in a presence-absence detection task and characterized conspicuousness by measuring response latency and detectability. We found that any type of motion significantly increased detectability, and that body coloration and behavior interacted to determine detectability while the spiders were in motion. Among spiders in motion, courting spiders were detected faster than walking spiders. Stationary (frozen) spiders, in contrast, were rarely detected. These results illustrate that male S. ocreata can be both highly conspicuous and highly cryptic to avian predators. Thus, while we find that courtship is conspicuous to avian predators in this system, we suggest that behavioral plasticity may mitigate some of the predation costs of the sexual signal.}, }
@article {pmid30647419, year = {2019}, author = {}, title = {Clever crows size up objects blowing in the wind.}, journal = {Nature}, volume = {565}, number = {7739}, pages = {269}, doi = {10.1038/d41586-019-00032-0}, pmid = {30647419}, issn = {1476-4687}, }
@article {pmid30643560, year = {2016}, author = {Papadimitrakopoulou, VA}, title = {AURA3 trial: does Tagrisso (osimertinib) have the potential to become the new standard of care for second-line treatment of patients with EGFR T790M mutation-positive locally advanced or metastatic NSCLC.}, journal = {Lung cancer management}, volume = {5}, number = {4}, pages = {159-162}, doi = {10.2217/lmt-2017-0001}, pmid = {30643560}, issn = {1758-1974}, abstract = {Vassiliki A Papadimitrakopoulou speaks to Roshaine Wijayatunga, Managing Commissioning Editor: Dr Papadimitrakopoulou is the Jay and Lori Eisenberg Distinguished Professor of Medicine and Chief of the section of Thoracic Medical Oncology in the Department of Thoracic/Head and Neck Medical Oncology at the University of Texas/MD Anderson Cancer Center. Her areas of expertise include design and development of novel therapeutic clinical trials for lung and head and neck neoplasms, personalized genomics-driven lung cancer therapy and translational research and cancer chemoprevention. Her extensive experience in design, development and implementation of translational research in the context of multidisciplinary research teams has led to research funding from National Cancer Institute (NCI), American Society of Clinical Oncology (ASCO) and Department of Defense (DOD) both independently and as a member of a research team in the Head and Neck SPORE program. Currently, she serves as the principal investigator and leads numerous clinical and translational research projects with a focus on the development of biomarker-based targeted therapy to overcome therapeutic resistance in advanced disease and immunotherapy. Most notably, she has led the multidisciplinary clinical and translational research infrastructure dedicated to the treatment of metastatic refractory NSCLC as part of the BATTLE-2 program, designed and developed the first-in-the-world comprehensive genomics-driven umbrella approach in Squamous Lung Cancer, the Lung Master protocol, jointly sponsored by NCI-Cancer Therapy Evaluation Program (CTEP) and Foundation for the National Institutes of Health (FNIH)/industry, aiming at bringing personalized medicine to patients with this disease. She is the Co-PI of an R01 award focusing on the role of KRAS mutations and targeting in lung cancer. She is the lead author or coauthor of over 150 published articles, book chapters and reviews, and numerous abstracts involving cancer therapeutics, prevention and translational research and she has received several awards including the ASCO Young Investigator and Career Development Award. On this R01 application, she will serve as Co-PI, working closely with Roy Herbst (Yale Cancer Center) and Don Gibbons (UT/MD Anderson Cancer Center), building on the recently completed BATTLE-2 program, and capitalizing on both laboratory findings supporting MEK targeted therapy and clinical effectiveness of immunotherapy and their combinations in addressing KRAS mutated lung cancer.}, }
@article {pmid30645758, year = {2018}, author = {Morreale, M}, title = {A Handy Primer for Medical Educators : The College Classroom Assessment Compendium: A Practical Guide to the College Instructor's Daily Assessment. By Jay Parkes and Dawn Zimmaro; Routledge; New York; 2018; ISBN: 978-1-138-24026-7; pp. 218; $31.96 (paperback).}, journal = {Academic psychiatry : the journal of the American Association of Directors of Psychiatric Residency Training and the Association for Academic Psychiatry}, volume = {42}, number = {5}, pages = {690}, doi = {10.1007/s40596-018-0956-9}, pmid = {30645758}, issn = {1545-7230}, }
@article {pmid30631293, year = {2018}, author = {Tian, Y and Fang, Y and Li, J}, title = {The Effect of Metacognitive Knowledge on Mathematics Performance in Self-Regulated Learning Framework-Multiple Mediation of Self-Efficacy and Motivation.}, journal = {Frontiers in psychology}, volume = {9}, number = {}, pages = {2518}, doi = {10.3389/fpsyg.2018.02518}, pmid = {30631293}, issn = {1664-1078}, abstract = {Metacognition, self-efficacy, and motivation are important components of interaction in self-regulated learning (SRL). However, the psychological mechanism underlying the association among them in mathematical learning remained ambiguous. The present study investigated whether the relationship between metacognitive knowledge (MK) and mathematics performance can be mediated by self-efficacy and motivation. The sample comprised 569 students (245 male, Mage = 16.39, SD = 0.63) of Grade 10 in China. The MK in mathematics questionnaire, the self-efficacy questionnaire, the academic motivation scale, Raven advanced progressive matrix, and mathematics tests were used for data collection. Our results suggested that the mathematics performance could be predicted by MK, self-efficacy and intrinsic motivation. Moreover, the association between MK and mathematics performance was mediated by self-efficacy and intrinsic motivation, as revealed by a multiple mediation analysis. Additionally, there were sex differences in MK, self-efficacy and intrinsic motivation. The findings highlight the psychological mechanism in the mathematics of Chinese students and will help teachers to improve students' mathematical learning in SRL framework more effectively. Implications for education and further studies are discussed.}, }
@article {pmid30628856, year = {2019}, author = {Vazquez, A and Gustafson, KD and Harmeling, B and Ernest, HB}, title = {GENETIC DIVERSITY OF YELLOW-BILLED MAGPIES (PICA NUTALLI) BEFORE AND AFTER A WEST NILE VIRUS EPIDEMIC.}, journal = {Journal of wildlife diseases}, volume = {}, number = {}, pages = {}, doi = {10.7589/2018-01-023}, pmid = {30628856}, issn = {1943-3700}, abstract = {The appearance of West Nile virus (WNV) coincided with declines in California bird populations beginning in 2004, and particularly affected corvid populations, including Yellow-billed Magpies (Pica nutalli), an endemic species to California. Our objective was to determine if the timing of the WNV epidemic correlated with changes in the genetic diversity or population structure of magpies. We hypothesized the declines in magpie abundance from WNV would lead to genetic bottlenecks and reduced genetic diversity, but not to changes in population genetic structure. To test these hypotheses, we genetically typed magpie samples collected during the Dead Bird Survey before WNV arrived (2002-2004), immediately after WNV arrived in late 2004 (2006-2008), and several generations after the onset of the epidemic (2009-2011). For each of these three time periods, we tested for genetic bottlenecks, estimated genetic heterozygosity, allelic richness, relatedness, effective population sizes, and genetic structure, with the use of 10 nuclear microsatellite loci. Although there was no evidence for spatial or temporal genetic structure, genetic-diversity estimates were similar or below estimates for endangered corvid species. Measures of genetic diversity were consistent across time periods. In contrast to our expectation, we detected a genetic bottleneck prior to the WNV epidemic, which may have coincided with severe drought conditions in California, increasing human population size in magpie range, and an estimated 33% decrease in population size. We found weak evidence to support a bottleneck after the introduction of WNV in California. Our results suggest the WNV epidemic did not have additional catastrophic effects on the neutral genetic diversity of P. nutalli in the sampled areas. However, because we detected lower heterozygosity in Yellow-billed Magpies than has been reported in closely related endangered species, this species is of conservation concern and should be monitored to detect further population declines or loss of genetic diversity.}, }
@article {pmid30613892, year = {2019}, author = {Luo, J and Wang, Y and Wang, Z and Gao, Z}, title = {Assessment of Pb and Cd contaminations in the urban waterway sediments of the Nen River (Qiqihar section), Northeastern China, and transfer along the food chain.}, journal = {Environmental science and pollution research international}, volume = {}, number = {}, pages = {}, doi = {10.1007/s11356-018-04087-w}, pmid = {30613892}, issn = {1614-7499}, abstract = {The increasing anthropogenic inputs of Pb and Cd into China's Nen River (Qiqihar section) owing to rapid urbanization in the past 50 years may pose ecological risks to the river's aquatic system. To confirm this hypothesis, we determined the Pb and Cd concentrations in the sediments of the Nen River flowing across Qiqihar City by comparing the control group (samplings in the Nen River branch bypassing the city) and bioaccumulation along the food chain. We found significantly higher Pb concentrations in the sediments than in the control group (39.21 mg kg-1 dry weight [dw] vs. 22.44 mg kg-1 dw; p < 0.05). However, the difference between the Cd contents of the two groups was nonsignificant (0.33 mg kg-1 dw vs. 0.30 mg kg-1 dw) (p = 0.07). Accumulated Pb and Cd in the sediments pose a medium risk to the system of Nen River according to the result of risk assessment code analysis. The increased Pb and Cd levels along the food chain had adverse health effects in the species at the top level of the food chain. For example, the feathers of Corvus frugilegus and Sterna hirundo contained 0.28-2.25 mg kg-1 dw of Cd. These values are considered potentially toxic to common avian species. The bone Pb level of C. frugilegus ranged from 4.82 to 7.41 mg kg-1 dw within the increasing Pb range (2-15 mg kg-1 dw) of common water birds. The inputs of Pb and Cd into the local environment should be reduced for the preservation of aquatic system health.}, }
@article {pmid30613067, year = {2019}, author = {Fujii, Y and Kanno, Y and Koshita, S and Ogawa, T and Kusunose, H and Masu, K and Sakai, T and Yonamine, K and Kawakami, Y and Murabayashi, T and Kozakai, F and Noda, Y and Okada, H and Ito, K}, title = {Predictive Factors for Inaccurate Diagnosis of Swollen Lymph Nodes in Endoscopic Ultrasound-Guided Fine Needle Aspiration.}, journal = {Clinical endoscopy}, volume = {}, number = {}, pages = {}, doi = {10.5946/ce.2018.125}, pmid = {30613067}, issn = {2234-2400}, abstract = {Background/Aims: This study aimed to identify the predictive factors for inaccurate endoscopic ultrasound-guided fine needle aspiration (EUS-FNA) diagnosis of swollen lymph nodes without rapid on-site cytopathological evaluation.<br><br>Methods: Eighty-three consecutive patients who underwent EUS-FNA for abdominal or mediastinal lymph nodes from January 2008 to June 2017 were included from a prospectively maintained EUS-FNA database and retrospectively reviewed. The sensitivity, specificity, and accuracy of EUS-FNA for the detection of neoplastic diseases were calculated. Candidate factors for inaccurate diagnosis (lymph node size and location, needle type, puncture route, number of passes, and causative disease) were evaluated by comparison between accurately diagnosed cases and others.<br><br>Results: The final diagnosis of the punctured lymph node was classified as neoplastic (65 cases: a metastatic lymph node, malignant lymphoma, or Crow-Fukase syndrome) or non-neoplastic (18 cases: a reactive node or amyloidosis). The sensitivity, specificity, and accuracy were 83%, 94%, and 86%, respectively. On multivariate analyses, small size of the lymph node was the sole predictive factor for inaccurate EUS-FNA diagnosis with a significant difference (odds ratios, 19.8; 95% confidence intervals, 3.15-124; p=0.0015).<br><br>Conclusions: The lymph node size of <16 mm was the only independent factor associated with inaccurate EUS-FNA diagnosis of swollen lymph nodes.}, }
@article {pmid30598449, year = {2018}, author = {Chen, N and Juric, I and Cosgrove, EJ and Bowman, R and Fitzpatrick, JW and Schoech, SJ and Clark, AG and Coop, G}, title = {Allele frequency dynamics in a pedigreed natural population.}, journal = {Proceedings of the National Academy of Sciences of the United States of America}, volume = {}, number = {}, pages = {}, doi = {10.1073/pnas.1813852116}, pmid = {30598449}, issn = {1091-6490}, abstract = {A central goal of population genetics is to understand how genetic drift, natural selection, and gene flow shape allele frequencies through time. However, the actual processes underlying these changes-variation in individual survival, reproductive success, and movement-are often difficult to quantify. Fully understanding these processes requires the population pedigree, the set of relationships among all individuals in the population through time. Here, we use extensive pedigree and genomic information from a long-studied natural population of Florida Scrub-Jays (Aphelocoma coerulescens) to directly characterize the relative roles of different evolutionary processes in shaping patterns of genetic variation through time. We performed gene dropping simulations to estimate individual genetic contributions to the population and model drift on the known pedigree. We found that observed allele frequency changes are generally well predicted by accounting for the different genetic contributions of founders. Our results show that the genetic contribution of recent immigrants is substantial, with some large allele frequency shifts that otherwise may have been attributed to selection actually due to gene flow. We identified a few SNPs under directional short-term selection after appropriately accounting for gene flow. Using models that account for changes in population size, we partitioned the proportion of variance in allele frequency change through time. Observed allele frequency changes are primarily due to variation in survival and reproductive success, with gene flow making a smaller contribution. This study provides one of the most complete descriptions of short-term evolutionary change in allele frequencies in a natural population to date.}, }
@article {pmid30597322, year = {2018}, author = {Kim, EY and Inoue, N and Koh, DH and Iwata, H}, title = {The aryl hydrocarbon receptor 2 potentially mediates cytochrome P450 1A induction in the jungle crow (Corvus macrorhynchos).}, journal = {Ecotoxicology and environmental safety}, volume = {171}, number = {}, pages = {99-111}, doi = {10.1016/j.ecoenv.2018.12.037}, pmid = {30597322}, issn = {1090-2414}, abstract = {To understand the role of aryl hydrocarbon receptor (AHR) isoforms in avian species, we investigated the functional characteristics of two AHR isoforms (designated as jcAHR1 and jcAHR2) of the jungle crow (Corvus macrorhynchos). Two amino acid residues corresponding to Ile324 and Ser380 (high sensitive type) in chicken AHR1 that are known to determine dioxin sensitivity were Ile325 and Ala381 (moderate sensitive type) in jcAHR1 and Val306 and Ala362 (low sensitive type) in jcAHR2. The quantitative comparison of the two jcAHR mRNA expression levels in a Tokyo jungle crow population showed that jcAHR2 accounted for 92.4% in the liver, while jcAHR1 accounted for only 7.6%. Both in vitro-expressed jcAHR1 and jcAHR2 proteins exhibited a specific binding to [3H]-labeled 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Transactivation potencies for jcAHR1 and jcAHR2 in in vitro reporter gene assays were measured in jcAHR-expressed cells exposed to 16 dioxins and related compounds (DRCs). Both jcAHR1 and jcAHR2 were activated in a congener- and an isoform-specific manner. EC50 value of TCDD for jcAHR2 (0.61 nM) was six-fold higher than that for jcAHR1 (0.098 nM), but jcAHR2 had higher transactivation efficacy than jcAHR1 in terms of the magnitude of response. The high transactivation efficacy of jcAHR2 in DRCs is in contrast to that of AHR2s in other avian species with low transactivation efficacy. Molecular docking simulations of TCDD with in silico jcAHR1 and jcAHR2 homology models showed that the two sensitivity-decisive amino acids indirectly controlled TCDD-binding modes through their surrounding amino acids. Deletion assays of jcAHR2 revealed that 736-805 amino acid residues in the C-terminal region were critical for its transactivation. We suggest that jcAHR2 plays a critical role in regulating the AHR signaling pathway, at least in its highly expressed organs.}, }
@article {pmid30587749, year = {2018}, author = {Nishimoto, T and Bonkohara, Y and Murakami, H and Noma, D}, title = {[Video-assisted Thoracoscopic Pericardial Fenestration for Pericardial Effusion in a Patient with Crow-Fukase Syndrome].}, journal = {Kyobu geka. The Japanese journal of thoracic surgery}, volume = {71}, number = {13}, pages = {1092-1095}, pmid = {30587749}, issn = {0021-5252}, abstract = {A 65-year-old woman was referred to our department with recurrent pericardial effusion. Her serum vascular endothelial growth factor was high, serum M-protein was positive, and nerve conduction velocity of extremities was decreased. Therefore, she was diagnosed with Crow-Fukase (polyneuropathy, organomegaly, endocrinopathy, M protein, skin changes:POEMS) syndrome, which is characterized by the presence of plasma cell dyscrasia with them. We performed video-thoracoscopic pericardial fenestration with 4×4 cm window. The postoperative course was uneventful, and the pericardial effusion completely disappeared. Video-assisted thoracoscopic pericardial fenestration was a safe and effective treatment for recurrent pericardial effusion.}, }
@article {pmid30586006, year = {2018}, author = {Huerta-Franco, MR and Vargas-Luna, M and Somoza, X and Delgadillo-Holtfort, I and Balleza-Ordaz, M and Kashina, S}, title = {Gastric responses to acute psychological stress in climacteric women: a pilot study.}, journal = {Menopause (New York, N.Y.)}, volume = {}, number = {}, pages = {}, doi = {10.1097/GME.0000000000001274}, pmid = {30586006}, issn = {1530-0374}, abstract = {OBJECTIVE: Women exhibit reduced ovarian sex hormones during the menopausal period that result in well-known physical and psychological symptoms. However, symptoms related to gastric motility (GM) have not been thoroughly investigated. We hypothesized that stress response gastric motility (SRGM) is lower in postmenopausal (PM) and perimenopausal (PERIM) women than in premenopausal (PREM) women. Estrogenic decline leads to neuroendocrine changes in different areas of the brain. These changes can result in hypothalamic vasomotor symptoms, disorders in eating behaviours, and altered blood pressure, in addition to psychological disorders such as stress, anxiety, depression, and irritability related to alterations in the limbic system.<br><br>METHODS: In this pilot study, 55 PREM, PERIM, and PM women were clinically evaluated using the Nowack stress profile (SP) and State-Trait Anxiety Inventory (STAI). GM was assessed via electrical bioimpedance using two psychological stress tests (Stroop and Raven tests).<br><br>RESULTS: Basal SP and STAI-anxiety test scores were similar among the three groups of women (P > 0.05). PERIM women had lower GM in the basal state (P < 0.05) than did other women. PREM and PM women had significantly decreased GM during the stress tests (P < 0.05). However, PERIM did not exhibit GM changes during stress tests (P > 0.05).<br><br>CONCLUSION: Changes in sex hormones during PERIM may affect GM and SRGM.}, }
@article {pmid30580445, year = {2018}, author = {Bessis, D and Petit, A and Battistella, M and Bourrat, E and Girard, C and Pallure, V and Marque, M and Lacour, JP and Vitetta, A and Bieth, É and Selves, J and Solassol, J and Vendrell, J}, title = {Naevoid acanthosis nigricans or RAVEN (rounded and velvety epidermal naevus) and mosaic FGFR3 and FGFR2 mutations.}, journal = {The British journal of dermatology}, volume = {}, number = {}, pages = {}, doi = {10.1111/bjd.17581}, pmid = {30580445}, issn = {1365-2133}, abstract = {we read with interest the article by Larsabal et al.1 describing two cases of RAVEN (rounded and velvety epidermal naevus) or naevoid acanthosis nigricans (NAN) associated with mosaic p.Arg252Asn FGFR3 and p.Ser252Trp FGFR2 mutations, adding to a probable case of RAVEN/NAN with comedones linked to the previously reported p.Ser252Trp FGFR2 mutation.2 In the past two years, we had the opportunity to perform molecular analysis for FGFR2 and FGFR3 in seven unrelated patients with RAVEN/NAN and wish to add our experience.}, }
@article {pmid30578524, year = {2018}, author = {Tsui, I and Song, BJ and Lin, CS and Tsang, SH}, title = {A Practical Approach to Retinal Dystrophies.}, journal = {Advances in experimental medicine and biology}, volume = {1085}, number = {}, pages = {245-259}, doi = {10.1007/978-3-319-95046-4_51}, pmid = {30578524}, issn = {0065-2598}, abstract = {Genomic approaches to developing new diagnostic and therapeutic strategies in retinal dystrophies are among the most advanced applications of genetics (Tsang SH, Gouras P (1996) Molecular physiology and pathology of the retina. In: Duane TD, Tasman W, Jaeger AE (eds) Duane's clinical opthalmology. Lippincott-Raven, Philadelphia). The notion that &quot;nothing can be done&quot; for patients with retinal dystrophies is no longer true. Electrophysiological testing and autofluorescence imaging help to diagnose and predict the patient's course of disease. Better phenotyping can contribute to better-directed, cost-efficient genotyping. Combining fundoscopy, autofluorescent imaging, and electrophysiological testing is essential in approaching patients with retinal dystrophies. Emerging are new gene-based treatments for these devastating conditions.}, }
@article {pmid30564390, year = {2018}, author = {Lind, J}, title = {What can associative learning do for planning?.}, journal = {Royal Society open science}, volume = {5}, number = {11}, pages = {180778}, doi = {10.1098/rsos.180778}, pmid = {30564390}, issn = {2054-5703}, abstract = {There is a new associative learning paradox. The power of associative learning for producing flexible behaviour in non-human animals is downplayed or ignored by researchers in animal cognition, whereas artificial intelligence research shows that associative learning models can beat humans in chess. One phenomenon in which associative learning often is ruled out as an explanation for animal behaviour is flexible planning. However, planning studies have been criticized and questions have been raised regarding both methodological validity and interpretations of results. Due to the power of associative learning and the uncertainty of what causes planning behaviour in non-human animals, I explored what associative learning can do for planning. A previously published sequence learning model which combines Pavlovian and instrumental conditioning was used to simulate two planning studies, namely Mulcahy &amp; Call 2006 'Apes save tools for future use.' Science312, 1038-1040 and Kabadayi &amp; Osvath 2017 'Ravens parallel great apes in flexible planning for tool-use and bartering.' Science357, 202-204. Simulations show that behaviour matching current definitions of flexible planning can emerge through associative learning. Through conditioned reinforcement, the learning model gives rise to planning behaviour by learning that a behaviour towards a current stimulus will produce high value food at a later stage; it can make decisions about future states not within current sensory scope. The simulations tracked key patterns both between and within studies. It is concluded that one cannot rule out that these studies of flexible planning in apes and corvids can be completely accounted for by associative learning. Future empirical studies of flexible planning in non-human animals can benefit from theoretical developments within artificial intelligence and animal learning.}, }
@article {pmid30552190, year = {2018}, author = {Kovanen, S and Rossi, M and Pohja-Mykrä, M and Nieminen, T and Raunio-Saarnisto, M and Sauvala, M and Fredriksson-Ahomaa, M and Hänninen, ML and Kivistö, R}, title = {Population genetics and characterization of Campylobacter jejuni isolates in western jackdaws and game birds in Finland.}, journal = {Applied and environmental microbiology}, volume = {}, number = {}, pages = {}, doi = {10.1128/AEM.02365-18}, pmid = {30552190}, issn = {1098-5336}, abstract = {Poultry is considered a major reservoir and source of human campylobacteriosis but the roles of environmental reservoirs, including wild birds, have not been assessed in depth. In this study, we isolated and characterized Campylobacter jejuni from western jackdaws (n=91, 43%), mallard ducks (n=82, 76%) and pheasants (n=9, 9%). Most of the western jackdaw and mallard duck C. jejuni isolates represented MLST sequence types (STs) that diverged from those previously isolated from human patients and various animal species, whereas all pheasant isolates represented ST-19, a common ST among human patients and other hosts worldwide. Whole-genome MLST revealed that mallard duck ST-2314 and pheasant ST-19 isolates represented bacterial clones that were genetically highly similar to human isolates detected previously. Further analyses revealed that in addition to divergent ClonalFrame genealogy certain genomic characteristics, e.g. novel cdtABC gene cluster and T6SS of the western jackdaw C. jejuni isolates may affect their host-specificity and virulence. Game birds may thus pose a risk for acquiring campylobacteriosis, and therefore, hygienic measures during slaughter and meat handling warrant special attention.IMPORTANCEThe roles of environmental reservoirs, including wild birds, in the molecular epidemiology of Campylobacter jejuni have not been assessed in depth. Our results showed that game birds may pose a risk for acquiring campylobacteriosis, because they had C. jejuni genomotypes highly similar to human isolates detected previously. Therefore, hygienic measures during slaughter and meat handling warrant special attention. On the contrary a unique phylogeny was revealed for the western jackdaw isolates and certain genomic characteristics identified among these isolates are hypothesized to affect their host-specificity and virulence. Comparative genomics within STs, using wgMLST, and phylogenomics are efficient methods to analyze the genomic relationships of C. jejuni isolates.}, }
@article {pmid30538345, year = {2018}, author = {Yazdanjooie, M and Sadraei, J and Dalimi, A and Pirestani, M}, title = {Isolation of Encephalitozoon intestinalis from crows living in urban parks of Tehran, Iran: an investigation with zoonotic aspect.}, journal = {Journal of parasitic diseases : official organ of the Indian Society for Parasitology}, volume = {42}, number = {4}, pages = {494-499}, doi = {10.1007/s12639-018-1024-9}, pmid = {30538345}, issn = {0971-7196}, abstract = {Microsporidia are eukaryotic, intracellular obligate parasites that widely involve many organisms including insects, fish, birds, and mammals. One of the genera of Microsporidia is Encephalitozoon, which contains several opportunistic pathogens. Since Encephalitozoon spp. are zoonotic and opportunistic pathogens, it is important to find their reservoir hosts; hence, the current study aimed at isolating and identifying Encephalitozoon spp. in the crows by the light microscopy observations and molecular methods. For this purpose, 36 samples were collected by the dropping method; however, due to the low volume of samples, the total samples were collected in a sterile stool container and the polymerase chain reaction (PCR) was performed to detect Encephalitozoon spp. Accordingly, 300-bp bands, specific to Encephalitozoon spp., were observed and by sequencing E. intestinalis was identified. Crows can be considered as the hosts of E. intestinalis.}, }
@article {pmid30536039, year = {2018}, author = {Ashton, BJ and Ridley, AR and Thornton, A}, title = {Smarter through group living: A response to Smulders.}, journal = {Learning &amp; behavior}, volume = {}, number = {}, pages = {}, doi = {10.3758/s13420-018-0366-6}, pmid = {30536039}, issn = {1543-4508}, support = {DP140101921//Australian Research Council/ ; BB/H021817/2//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, abstract = {We recently identified a strong, positive relationship between group size and individual cognitive performance, and a strong, positive relationship between female cognitive performance and reproductive success (Ashton, Ridley, Edwards, &amp; Thornton in Nature, 554, 364-367, 2018). An opinion piece by Smulders (Learning &amp; Behavior, https://doi.org/10.3758/s13420-018-0335-0 , 2018) raised the interesting notion that these patterns may be underlined by motivational factors. In this commentary, we highlight why none of the available data are consistent with this explanation, but instead support the argument that the demands of group living influence cognitive development, with knock-on consequences for fitness.}, }
@article {pmid30534343, year = {2018}, author = {Klump, BC and Masuda, BM and St Clair, JJH and Rutz, C}, title = {Preliminary observations of tool-processing behaviour in Hawaiian crows Corvus hawaiiensis.}, journal = {Communicative &amp; integrative biology}, volume = {11}, number = {4}, pages = {e1509637}, doi = {10.1080/19420889.2018.1509637}, pmid = {30534343}, issn = {1942-0889}, abstract = {Very few animal species habitually make and use foraging tools. We recently discovered that the Hawaiian crow is a highly skilled, natural tool user. Most captive adults in our experiment spontaneously used sticks to access out-of-reach food from a range of extraction tasks, exhibiting a surprising degree of dexterity. Moreover, many birds modified tools before or during deployment, and some even manufactured tools from raw materials. In this invited addendum article, we describe and discuss these observations in more detail. Our preliminary data, and comparisons with the better-studied New Caledonian crow, suggest that the Hawaiian crow has extensive tool-modification and manufacture abilities. To chart the full extent of the species' natural tool-making repertoire, we have started conducting dedicated experiments where subjects are given access to suitable raw materials for tool manufacture, but not ready-to-use tools.}, }
@article {pmid30519433, year = {2018}, author = {Walker, LE and Marzluff, JM and Metz, MC and Wirsing, AJ and Moskal, LM and Stahler, DR and Smith, DW}, title = {Population responses of common ravens to reintroduced gray wolves.}, journal = {Ecology and evolution}, volume = {8}, number = {22}, pages = {11158-11168}, doi = {10.1002/ece3.4583}, pmid = {30519433}, issn = {2045-7758}, abstract = {Top predators have cascading effects throughout the food web, but their impacts on scavenger abundance are largely unknown. Gray wolves (Canis lupus) provide carrion to a suite of scavenger species, including the common raven (Corvus corax). Ravens are wide-ranging and intelligent omnivores that commonly take advantage of anthropogenic food resources. In areas where they overlap with wolves, however, ravens are numerous and ubiquitous scavengers of wolf-acquired carrion. We aimed to determine whether subsidies provided through wolves are a limiting factor for raven populations in general and how the wolf reintroduction to Yellowstone National Park in 1995-1997 affected raven population abundance and distribution on the Yellowstone's Northern Range specifically. We counted ravens throughout Yellowstone's Northern Range in March from 2009 to 2017 in both human-use areas and wolf habitat. We then used statistics related to the local wolf population and the winter weather conditions to model raven abundance during our study period and predict raven abundance on the Northern Range both before and after the wolf reintroduction. In relatively severe winters with greater snowpack, raven abundance increased in areas of human use and decreased in wolf habitat. When wolves were able to acquire more carrion, however, ravens increased in wolf habitat and decreased in areas with anthropogenic resources. Raven populations prior to the wolf reintroduction were likely more variable and heavily dependent on ungulate winter-kill and hunter-provided carcasses. The wolf recovery in Yellowstone helped stabilize raven populations by providing a regular food supply, regardless of winter severity. This stabilization has important implications for effective land management as wolves recolonize the west and global climate patterns change.}, }
@article {pmid30508564, year = {2018}, author = {Kelly, DM and Bisbing, TA and Magnotti, JF}, title = {Use of medial axis for reorientation by the Clark's nutcracker (Nucifraga columbiana).}, journal = {Behavioural processes}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.beproc.2018.11.011}, pmid = {30508564}, issn = {1872-8308}, abstract = {Many animals are challenged with the task of reorientation. Considerable research over the years has shown a diversity of species extract geometric information (e.g., distance and direction) from continuous surfaces or boundaries to reorient. How this information is extracted from the environment is less understood. Three encoding strategies that have received the most study are the use of principal axes, medial axis or local geometric cues. We used a modeling approach to investigate which of these three general strategies best fit the spatial search data of a highly-spatial corvid, the Clark's nutcracker (Nucifraga columbiana). Individual nutcrackers were trained in a rectangular-shaped arena, and once accurately locating a hidden goal, received non-reinforced tests in an L-shaped arena. The specific shape of this arena allowed us to dissociate among the three general encoding strategies. Furthermore, we reanalyzed existing data from chicks, pigeons and humans using our modeling approach. Overall, we found the most support for the use of the medial axis, although we additionally found that pigeons and humans may have engaged in random guessing. As with our previous studies, we find no support for the use of principal axes.}, }
@article {pmid30515968, year = {2018}, author = {Bonneris, E and Gao, Z and Prosser, A and Barfknecht, R}, title = {Selecting appropriate focal species for assessing the risk to birds from newly drilled pesticide-treated winter cereal fields in France.}, journal = {Integrated environmental assessment and management}, volume = {}, number = {}, pages = {}, doi = {10.1002/ieam.4112}, pmid = {30515968}, issn = {1551-3793}, abstract = {Identifying focal bird species appropriate to the situation in which a plant protection product is used is important for refined risk assessment (EFSA, 2009). We analysed the results of extensive field observations of newly-drilled cereal fields in France in autumn over two seasons to determine real bird focal species. In 2011, birds were observed, before and after drilling, on wheat and barley fields drilled with imidacloprid treated seeds (i.e. 'treatment' fields) or seeds treated with other compounds than imidacloprid (i.e. 'alternative treatment' fields). Bird abundance, species richness, and diversity were significantly higher in wheat fields than barley fields leading us to monitor only wheat fields in 2012. Statistical analyses did not show a significant effect of the drilling itself or between the 'treatment' fields and the 'alternative treatment' fields on the number and type of bird species. This led to the pooling of 2011 data on all fields for focal species determination. Similarly, all bird monitoring data generated in 2012 before and after drilling were pooled and analysed. Rules for determination of candidate focal species detailed in the EFSA (2009) guidance were followed. Carrion crow, wood pigeon, grey partridge, skylark, common starling and pied wagtail were the bird species the most frequently observed on wheat fields. This list of candidate species was processed to determine the most relevant focal species according to the method of Dietzen et al. (2014), resulting in the selection of skylark, grey partridge, wood pigeon and pied wagtail as focal species to assess risks to birds for pesticides applied during drilling of winter cereals in France (September- November). This article is protected by copyright. All rights reserved.}, }
@article {pmid30513676, year = {2018}, author = {Kaplan, G}, title = {Development of Meaningful Vocal Signals in a Juvenile Territorial Songbird (Gymnorhina tibicen) and the Dilemma of Vocal Taboos Concerning Neighbours and Strangers.}, journal = {Animals : an open access journal from MDPI}, volume = {8}, number = {12}, pages = {}, doi = {10.3390/ani8120228}, pmid = {30513676}, issn = {2076-2615}, support = {The Cardigan Fund//University of New England/ ; DP0452557//Australian Research Council/ ; }, abstract = {Young territorial songbirds have calls to learn, especially calls that may be vital for maintaining territory. Territoriality is largely reinforced and communicated by vocal signals. In their natal territory, juvenile magpies (Gymnorhina tibicen) enjoy protection from predators for 8⁻9 months. It is not at all clear, however, when and how a young territorial songbird learns to distinguish the meaning of calls and songs expressed by parents, conspecifics, neighbours, and heterospecifics, or how territorial calls are incorporated into the juvenile's own repertoire. This project investigated acquisition and expression of the vocal repertoire in juvenile magpies and assessed the responses of adults and juveniles to playbacks of neighbour and stranger calls inside their territory. The results reported here identify age of appearance of specific vocalisations and the limits of their expression in juveniles. One new and surprising result was that many types of adult vocalisation were not voiced by juveniles. Playbacks of calls of neighbours and strangers inside the natal territory further established that adults responded strongly but differentially to neighbours versus strangers. By contrast, juveniles needed months before paying any attention to and distinguishing between neighbour and stranger calls and eventually did so only in non-vocal ways (such as referral to adults). These results provide evidence that auditory perception not only includes recognition and memory of neighbour calls but also an assessment of the importance of such calls in the context of territoriality.}, }
@article {pmid30513278, year = {2018}, author = {Andreasen, AK and Iversen, P and Marstrand, L and Siersma, V and Siebner, HR and Sellebjerg, F}, title = {Structural and cognitive correlates of fatigue in progressive multiple sclerosis.}, journal = {Neurological research}, volume = {}, number = {}, pages = {1-9}, doi = {10.1080/01616412.2018.1547813}, pmid = {30513278}, issn = {1743-1328}, abstract = {BACKGROUND: Fatigue in multiple sclerosis (MS) is a debilitating symptom and experienced by most patients. In recent studies investigating this phenomenon, the majority of patients had a relapsing-remitting disease course.<br><br>METHODS: Patients with progressive MS participating in one of three treatment trials during a period from 2010 to 2014 were included. Fatigue was assessed with the Fatigue Scale for Motor and Cognitive Functions (FSMC) and patients were further examined with a cognitive test battery, including Symbol Digit Modalities Test (SDMT), and 3 T MRI with subsequent quantitative analyses of 13 cortical regions of interest, deep grey matter and lesion volume.<br><br>RESULTS: Twenty-two patients were enrolled. The thickness of the pre-central gyrus correlated significantly with motor fatigue. We found only a non-significant trend towards a correlation between cognitive fatigue and the thickness of the pre-central gyrus, the parietal inferior supra-marginal gyrus and the opercular part of the inferior frontal gyrus. 36% of participants had impaired processing speed and 9% had normal function on all tests. The scores on the FSMC-cognitive scale were related to performance on SDMT.<br><br>CONCLUSION: In this exploratory study of patients with progressive MS, fatigue was related to processing speed. Motor fatigue was also related to the cortical thickness of the primary motor cortex and there was a trend towards a relationship between cognitive fatigue and the thickness of cortical areas involved in attentional processes. Additional studies are needed to further elucidate the relationship between regional cortical atrophy, cognitive functioning and the perception of fatigue.<br><br>ABBREVIATIONS: FSMC: Motor and Cognitive Functions; MS: Multiple Sclerosis; SDMT: Symbol Digit Modalities Test; MRI: Magnetic Resonance Imaging; RRMS: Relapsing-Remitting Disease Course; EDSS: Kurtzke Expanded Disability Status Scale; FLAIR: Fluid Attenuated Inversion Recovery; NAWM: Normal-Appearing White Matter; CGM: Cortical Grey Matter; CTh: Cortical Thickness; ROIs: Regions of Interest; Raven: Raven Progressive Matrices; TM A: Trail Making A; TM B: Trail Making B; Rey: Rey Complex Figure; Similarities: WAIS III Similarities; Stroop: Stroop Colour Naming Test; BDI: Becks Depression Inventory II.}, }
@article {pmid30487308, year = {2018}, author = {Cunningham, CX and Johnson, CN and Barmuta, LA and Hollings, T and Woehler, EJ and Jones, ME}, title = {Top carnivore decline has cascading effects on scavengers and carrion persistence.}, journal = {Proceedings. Biological sciences}, volume = {285}, number = {1892}, pages = {}, doi = {10.1098/rspb.2018.1582}, pmid = {30487308}, issn = {1471-2954}, abstract = {Top carnivores have suffered widespread global declines, with well-documented effects on mesopredators and herbivores. We know less about how carnivores affect ecosystems through scavenging. Tasmania's top carnivore, the Tasmanian devil (Sarcophilus harrisii), has suffered severe disease-induced population declines, providing a natural experiment on the role of scavenging in structuring communities. Using remote cameras and experimentally placed carcasses, we show that mesopredators consume more carrion in areas where devils have declined. Carcass consumption by the two native mesopredators was best predicted by competition for carrion, whereas consumption by the invasive mesopredator, the feral cat (Felis catus), was better predicted by the landscape-level abundance of devils, suggesting a relaxed landscape of fear where devils are suppressed. Reduced discovery of carcasses by devils was balanced by the increased discovery by mesopredators. Nonetheless, carcasses persisted approximately 2.6-fold longer where devils have declined, highlighting their importance for rapid carrion removal. The major beneficiary of increased carrion availability was the forest raven (Corvus tasmanicus). Population trends of ravens increased 2.2-fold from 1998 to 2017, the period of devil decline, but this increase occurred Tasmania-wide, making the cause unclear. This case study provides a little-studied potential mechanism for mesopredator release, with broad relevance to the vast areas of the world that have suffered carnivore declines.}, }
@article {pmid30482600, year = {2018}, author = {Kent, SJW and Morrison, R}, title = {Rural and urban differences in orthognathic surgical patients in the north east of Scotland.}, journal = {The British journal of oral &amp; maxillofacial surgery}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.bjoms.2018.10.271}, pmid = {30482600}, issn = {1532-1940}, abstract = {We have previously identified differences in the presentation and treatment of cancer between patients who live in rural compared with urban areas, but have not yet seen differences in those treated by orthognathic surgery. We hypothesised that patients from areas further away from the hospital face higher costs to attend and may not present with minor problems as often as those who live nearby. We therefore retrospectively reviewed all those (n=216) who had presented for orthognathic surgery over a six-year period (May 2011 to May 2017). The severity of malocclusion and facial asymmetry was established by combining measurements of intraoperative movements. Rurality was measured as the distance from home to the hospital at the time of operation. Those with smaller intraoperative movements (less than 7mm combined movement) lived significantly closer to the hospital as the crow flies (mean difference 15.13 miles, 95% CI 0.20 to 30.48, p=0.05) and could travel there more quickly (mean difference 65minutes 95% CI 9.8 to 121.7, p=0.02) than those with larger movements. Our results suggest that patients with small malocclusions and slight facial asymmetry who live further away from the hospital, may be less likely to present for operation than those who live closer. We explain why socioeconomic class is unlikely to confound our results, and suggest potential ways to minimise the effect observed.}, }
@article {pmid30476136, year = {2018}, author = {Nuriddin, A}, title = {Psychiatric Jim Crow: Desegregation at the Crownsville State Hospital, 1948-1970.}, journal = {Journal of the history of medicine and allied sciences}, volume = {}, number = {}, pages = {}, doi = {10.1093/jhmas/jry025}, pmid = {30476136}, issn = {1468-4373}, abstract = {The Crownsville State Hospital, located in Maryland just outside of Annapolis, provides a thought-provoking example of the impact of desegregation in the space of the mental hospital. Using institutional reports, patient records, and oral histories, this article reconstructs the three phases of desegregation at Crownsville. First, as a result of its poor conditions, lack of qualified staff, and its egregious mistreatment of patients, African American community leaders and organizations such as the NAACP called for the desegregation of the care staff of Crownsville in the late 1940s. Second, the introduction of a skilled African American staff created unprecedented and morally complex issues about access to psychiatric therapeutics. Last, in 1963, Health Commissioner Dr. Isadore Tuerk officially desegregated patients in all Maryland state hospitals. Though desegregation brought much needed improvements to Crownsville, these gains were ultimately swamped by deinstitutionalization and the shift towards outpatient psychiatric care. By the 1970s, Crownsville had returned to the poor conditions that existed during segregation.}, }
@article {pmid30473852, year = {2018}, author = {Greggor, AL and McIvor, GE and Clayton, NS and Thornton, A}, title = {Wild jackdaws are wary of objects that violate expectations of animacy.}, journal = {Royal Society open science}, volume = {5}, number = {10}, pages = {181070}, doi = {10.1098/rsos.181070}, pmid = {30473852}, issn = {2054-5703}, abstract = {Nature is composed of self-propelled, animate agents and inanimate objects. Laboratory studies have shown that human infants and a few species discriminate between animate and inanimate objects. This ability is assumed to have evolved to support social cognition and filial imprinting, but its ecological role for wild animals has never been examined. An alternative, functional explanation is that discriminating stimuli based on their potential for animacy helps animals distinguish between harmless and threatening stimuli. Using remote-controlled experimental stimulus presentations, we tested if wild jackdaws (Corvus monedula) respond fearfully to stimuli that violate expectations for movement. Breeding pairs (N = 27) were presented at their nests with moving and non-moving models of ecologically relevant stimuli (birds, snakes and sticks) that differed in threat level and propensity for independent motion. Jackdaws were startled by movement regardless of stimulus type and produced more alarm calls when faced with animate objects. However, they delayed longest in entering their nest-box after encountering a stimulus that should not move independently, suggesting they recognized the movement as unexpected. How jackdaws develop expectations about object movement is not clear, but our results suggest that discriminating between animate and inanimate stimuli may trigger information gathering about potential threats.}, }
@article {pmid30469552, year = {2018}, author = {Zhu, XY and Gupta, SK and Sun, XC and He, C and Li, GX and Jiang, JH and Liu, XP and Lu, MH and Chen, YF}, title = {Z2 topological edge state in honeycomb lattice of coupled resonant optical waveguides with a flat band.}, journal = {Optics express}, volume = {26}, number = {19}, pages = {24307-24317}, pmid = {30469552}, issn = {1094-4087}, abstract = {Two-dimensional (2D) coupled resonant optical waveguide (CROW), exhibiting topological edge states, provides an efficient platform for designing integrated topological photonic devices. In this paper, we propose an experimentally feasible design of 2D honeycomb CROW photonic structure. The characteristic optical system possesses two-fold and three-fold Dirac points at different positions in the Brillouin zone. The effective gauge fields implemented by the intrinsic pseudo-spin-orbit interaction open up topologically nontrivial bandgaps through the Dirac points. Spatial lattice geometries allow destructive wave interference, leading to a dispersionless, near-flat energy band in the vicinity of the three-fold Dirac point in the telecommunication frequency regime. This nontrivial structure with a near-flat band yields topologically protected edge states. These characteristics underpin the fundamental importance as well as the potential applications in various optical devices. Based on the honeycomb CROW lattice, we design the shape-independent topological cavity and the beam splitter, which demonstrate the relevance for a wide range of photonic applications.}, }
@article {pmid30457220, year = {2018}, author = {Amici, F}, title = {An Evolutionary Approach to the Study of Collaborative Remembering?.}, journal = {Topics in cognitive science}, volume = {}, number = {}, pages = {}, doi = {10.1111/tops.12398}, pmid = {30457220}, issn = {1756-8765}, abstract = {Hope and Gabbert (2008) and Jay and colleagues (in press) show us that collaborative remembering, in certain contexts, may result in incomplete and less accurate memories. Here, I will discuss the evolutionary origins of this behavior, linking it to phenomena such as social contagion, conformity, and social learning, which are highly adaptive and widespread across non-human taxa.}, }
@article {pmid30442433, year = {2018}, author = {Falcionelli, N and Sernani, P and Brugués, A and Mekuria, DN and Calvaresi, D and Schumacher, M and Dragoni, AF and Bromuri, S}, title = {Indexing the Event Calculus: Towards practical human-readable Personal Health Systems.}, journal = {Artificial intelligence in medicine}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.artmed.2018.10.003}, pmid = {30442433}, issn = {1873-2860}, abstract = {Personal Health Systems (PHS) are mobile solutions tailored to monitoring patients affected by chronic non communicable diseases. In general, a patient affected by a chronic disease can generate large amounts of events: for example, in Type 1 Diabetic patients generate several glucose events per day, ranging from at least 6 events per day (under normal monitoring) to 288 per day when wearing a continuous glucose monitor (CGM) that samples the blood every 5 minutes for several days. Just by itself, without considering other physiological parameters, it would be impossible for medical doctors to individually and accurately follow every patient, highlighting the need of simple approaches towards querying physiological time series. Achieving this with current technology is not an easy task, as on one hand it cannot be expected that medical doctors have the technical knowledge to query databases and on the other hand these time series include thousands of events, which requires to re-think the way data is indexed. Anyhow, handling data streams efficiently is not enough. Domain experts' knowledge must be explicitly included into PHSs in a way that it can be easily readed and modified by medical staffs. Logic programming represents the perfect programming paradygm to accomplish this task. In this work, an Event Calculus-based reasoning framework to standardize and express domain-knowledge in the form of monitoring rules is suggested, and applied to three different use cases. However, if online monitoring has to be achieved, the reasoning performance must improve dramatically. For this reason, three promising mechanisms to index the Event Calculus Knowledge Base are proposed. All of them are based on different types of tree indexing structures: k-d trees, interval trees and red-black trees. The paper then compares and analyzes the performance of the three indexing techniques, by computing the time needed to check different type of rules (and eventually generating alerts), when the number of recorded events (e.g. values of physiological parameters) increases. The results show that customized jREC performs much better when the event average inter-arrival time is little compared to the checked rule time-window. Instead, where the events are more sparse, the use of k-d trees with standard EC is advisable. Finally, the Multi-Agent paradigm helps to wrap the various components of the system: the reasoning engines represent the agent minds, and the sensors are its body. The said agents have been developed in MAGPIE, a mobile event based Java agent platform.}, }
@article {pmid30440759, year = {2018}, author = {Li, X and Kesavadas, T}, title = {Surgical Robot with Environment Reconstruction and Force Feedback.}, journal = {Conference proceedings : ... Annual International Conference of the IEEE Engineering in Medicine and Biology Society. IEEE Engineering in Medicine and Biology Society. Annual Conference}, volume = {2018}, number = {}, pages = {1861-1866}, doi = {10.1109/EMBC.2018.8512695}, pmid = {30440759}, issn = {1557-170X}, abstract = {We present a new surgical robot hardware-in-the-loop simulator, with 3D surgical field reconstruction in RGB-D sensor range, which allows tool-tissue interactions to be presented as haptic feedback and thus provides the situation awareness of unwanted collision. First, the point cloud of the complete surgical environment is constructed from multiple frames of sensor data to avoid the occlusion issue. Then the user selects a region of interest where the robot's tool must avoid (also called forbidden region). The real-time haptic force rendering algorithm computes the interaction force which is then communicated to a haptic device at 1 kHz, to assist the surgeon to perform safe actions. The robot used is a RAVEN II system, RGB-D sensor is used to scan the environment, and two Omni haptic devices provide the 3-DoF haptic force. A registration pipeline is presented to complete the surgical environment point cloud mapping in preoperative surgery planning phase, which improves quality of haptic rendering in the presence of occlusion. Furthermore, we propose a feasible and fast algorithm which extends the existing work on the proxy-based method for haptic rendering between a Haptic Interaction Point (HIP) and a point cloud. The proposed methodology has the potential of improving the safety of surgical robots.}, }
@article {pmid30410111, year = {2018}, author = {Laumer, IB and Call, J and Bugnyar, T and Auersperg, AMI}, title = {Spontaneous innovation of hook-bending and unbending in orangutans (Pongo abelii).}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {16518}, doi = {10.1038/s41598-018-34607-0}, pmid = {30410111}, issn = {2045-2322}, support = {Y366-B17//Austrian Science Fund (FWF Der Wissenschaftsfonds)/ ; P-29084//Austrian Science Fund (FWF Der Wissenschaftsfonds)/ ; P-29075//Austrian Science Fund (FWF Der Wissenschaftsfonds)/ ; }, abstract = {Betty the crow astonished the scientific world as she spontaneously crafted hook-tools from straight wire in order to lift a basket out of vertical tubes. Recently it was suggested that this species' solution was strongly influenced by predispositions from behavioural routines from habitual hook-tool manufacture. Nevertheless, the task became a paradigm to investigate tool innovation. Considering that young humans had surprising difficulties with the task, it was yet unclear whether the innovation of a hooked tool would be feasible to primates that lacked habitual hook making. We thus tested five captive orangutans in a hook bending and unbending task. Orangutans are habitually tool-using primates that have been reported to use but not craft hooked tools for locomotion in the wild. Two orangutans spontaneously innovated hook tools and four unbent the wire from their first trial on. Pre-experience with ready-made hooks had some effect but did not lead to continuous success. Further subjects improved the hook-design feature when the task required the subjects to bent the hook at a steeper angle. Our results indicate that the ability to represent and manufacture tools according to a current need does not require stereotyped behavioural routines, but can indeed arise innovatively. Furthermore, the present study shows that the capacity for hook tool innovation is not limited to large brained birds within non-human animals.}, }
@article {pmid30405485, year = {2018}, author = {Bobrowicz, K and Osvath, M}, title = {Cats Parallel Great Apes and Corvids in Motor Self-Regulation - Not Brain but Material Size Matters.}, journal = {Frontiers in psychology}, volume = {9}, number = {}, pages = {1995}, doi = {10.3389/fpsyg.2018.01995}, pmid = {30405485}, issn = {1664-1078}, abstract = {The inhibition of unproductive motor movements is regarded as a fundamental cognitive mechanism. Recently it has been shown that species with large absolute brain size or high numbers of pallial neurons, like great apes and corvids, show the highest performance on a task purportedly measuring this mechanism: the cylinder task. In this task the subject must detour a perpendicularly oriented transparent cylinder to reach a reward through a side opening, instead of directly reaching for it and bumping into the front, which is regarded as an inhibitory failure. Here we test domestic cats, for the first time, and show that they can reach the same levels as great apes and corvids on this task, despite having much smaller brains. We tested subjects with apparatuses that varied in size (cylinder length and diameter) and material (glass or plastic), and found that subjects performed best on the large cylinders. As numbers of successes decreased significantly when the cylinders were smaller, we conducted additionally two experiments to discern which properties (length of the transparent surface, goal distance from the surface, size of the side opening) affects performance. We conclude that sensorimotor requirements, which differ between species, may have large impact on the results in such seemingly simple and apparently comparable tests. However, we also conclude that cats have comparably high levels of motor self-regulation, despite the differences between tests.}, }
@article {pmid30405209, year = {2018}, author = {Shirley, MK and Arthurs, OJ and Seunarine, KK and Cole, TJ and Eaton, S and Williams, JE and Clark, CA and Wells, JCK}, title = {Metabolic rate of major organs and tissues in young adult South Asian women.}, journal = {European journal of clinical nutrition}, volume = {}, number = {}, pages = {}, doi = {10.1038/s41430-018-0362-0}, pmid = {30405209}, issn = {1476-5640}, support = {8888//Wenner-Gren Foundation/ ; NIHR-CS-012-002//DH | National Institute for Health Research (NIHR)/ ; MR/M012069/1//Medical Research Council (MRC)/ ; }, abstract = {BACKGROUND/OBJECTIVES: Major organ-specific and tissue-specific metabolic rate (Ki) values were initially estimated using in vivo methods, and values reported by Elia (Energy metabolism: tissue determinants and cellular corollaries, Raven Press, New York, 1992) were subsequently supported by statistical analysis. However, the majority of work to date on this topic has addressed individuals of European descent, whereas population variability in resting energy metabolism has been reported. We aimed to estimate Ki values in South Asian females.<br><br>SUBJECTS/METHODS: This cross-sectional study recruited 70 healthy young women of South Asian ancestry. Brain and organs were measured using magnetic resonance imaging, skeletal muscle mass by dual-energy X-ray absorptiometry, fat mass by the 4-component model, and whole-body resting energy expenditure by indirect calorimetry. Organ and tissue Ki values were estimated indirectly using regression analysis through the origin. Preliminary analysis suggested overestimation of heart mass, hence the modeling was repeated with a literature-based 22.5% heart mass reduction.<br><br>RESULTS: The pattern of derived Ki values across organs and tissues matched that previously estimated in vivo, but the values were systematically lower. However, adjusting for the overestimation of heart mass markedly improved the agreement.<br><br>CONCLUSIONS: Our results support variability in Ki values among organs and tissues, where some are more metabolically &quot;expensive&quot; than others. Initial findings suggesting lower organ/tissue Ki values in South Asian women were likely influenced by heart mass estimation bias. The question of potential ethnic variability in organ-specific and tissue-specific energy metabolism requires further investigation.}, }
@article {pmid30402778, year = {2018}, author = {Sepkoski, D}, title = {The Unfinished Synthesis?: Paleontology and Evolutionary Biology in the 20th Century.}, journal = {Journal of the history of biology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10739-018-9537-8}, pmid = {30402778}, issn = {1573-0387}, abstract = {In the received view of the history of the Modern Evolutionary Synthesis, paleontology was given a prominent role in evolutionary biology thanks to the significant influence of paleontologist George Gaylord Simpson on both the institutional and conceptual development of the Synthesis. Simpson's 1944 Tempo and Mode in Evolution is considered a classic of Synthesis-era biology, and Simpson often remarked on the influence of other major Synthesis figures-such as Ernst Mayr and Theodosius Dobzhansky-on his developing thought. Why, then, did paleontologists of the 1970s and 1980s-Stephen Jay Gould, Niles Eldredge, David M. Raup, Steven Stanley, and others-so frequently complain that paleontology remained marginalized within evolutionary biology? This essay considers three linked questions: first, were paleontologists genuinely welcomed into the Synthetic project during its initial stages? Second, was the initial promise of the role for paleontology realized during the decades between 1950 and 1980, when the Synthesis supposedly &quot;hardened&quot; to an &quot;orthodoxy&quot;? And third, did the period of organized dissent and opposition to this orthodoxy by paleontologists during the 1970s and 1980s bring about a long-delayed completion to the Modern Synthesis, or rather does it highlight the wider failure of any such unified Darwinian evolutionary consensus?}, }
@article {pmid30402671, year = {2018}, author = {Kumar, SN and Fred, AL and Varghese, PS}, title = {Suspicious Lesion Segmentation on Brain, Mammograms and Breast MR Images Using New Optimized Spatial Feature Based Super-Pixel Fuzzy C-Means Clustering.}, journal = {Journal of digital imaging}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10278-018-0149-9}, pmid = {30402671}, issn = {1618-727X}, abstract = {Suspicious lesion or organ segmentation is a challenging task to be solved in most of the medical image analyses, medical diagnoses and computer diagnosis systems. Nevertheless, various image segmentation methods were proposed in the previous studies with varying success levels. But, the image segmentation problems such as lack of versatility, low robustness, high complexity and low accuracy in up-to-date image segmentation practices still remain unsolved. Fuzzy c-means clustering (FCM) methods are very well suited for segmenting the regions. The noise-free images are effectively segmented using the traditional FCM method. However, the segmentation result generated is highly sensitive to noise due to the negligence of spatial information. To solve this issue, super-pixel-based FCM (SPOFCM) is implemented in this paper, in which the influence of spatially neighbouring and similar super-pixels is incorporated. Also, a crow search algorithm is adopted for optimizing the influential degree; thereby, the segmentation performance is improved. In clinical applications, the SPOFCM feasibility is verified using the multi-spectral MRIs, mammograms and actual single spectrum on performing tumour segmentation tests for SPOFCM. Ultimately, the competitive, renowned segmentation techniques such as k-means, entropy thresholding (ET), FCM, FCM with spatial constraints (FCM_S) and kernel FCM (KFCM) are used to compare the results of proposed SPOFCM. Experimental results on multi-spectral MRIs and actual single-spectrum mammograms indicate that the proposed algorithm can provide a better performance for suspicious lesion or organ segmentation in computer-assisted clinical applications.}, }
@article {pmid30402057, year = {2018}, author = {Rodríguez, B and Rodríguez, A and Siverio, F and Siverio, M and , }, title = {Factors affecting the spatial distribution and breeding habitat of an insular cliff-nesting raptor community.}, journal = {Current zoology}, volume = {64}, number = {2}, pages = {173-181}, doi = {10.1093/cz/zox005}, pmid = {30402057}, issn = {1674-5507}, abstract = {The specific spatial distribution and habitat association-strongly influenced by environmental factors or competitive interactions-are major issues in ecology and conservation. We located and georeferenced nesting sites of five cliff-nesting raptors (Egyptian vulture Neophron percnopterus [a locally extinct species], common buzzard Buteo buteo, osprey Pandion haliaetus, common kestrel Falco tinnunculus, Barbary falcon Falco peregrinus pelegrinoides), and common raven Corvus corax on one of the most biodiverse hotspot within the Canary Islands (Teno, Tenerife). We used generalized linear models to evaluate the factors affecting abundance, richness, and intra- and interspecific interactions. Raptor abundance increased with slope, shrub-covered area, and habitat diversity, and decreased with altitude, and forested and grassed areas. Richness increased with slope and decreased with altitude. Threatened species (osprey, Barbary falcon, and raven) occupied cliffs farther away from houses and roads, and more rugged areas than the non-threatened species. The models suggested that the probability of cliff occupation by buzzards, falcons, and ravens depended only on inter-specific interactions. Buzzard occupation increased with the distance to the nearest raven and kestrel nests, whereas falcons and ravens seek proximity to each other. Teno holds between 75% and 100% of the insular breeding populations of the most endangered species (osprey and raven), indicating the high conservation value of this area. Our study suggests that the preservation of rugged terrains and areas of low human pressure are key factors for raptor conservation and provide basic knowledge on the community structure and habitat associations to develop appropriated management actions for these fragile island populations.}, }
@article {pmid30397596, year = {2018}, author = {Bache, WK and DeLisi, LE}, title = {The Sex Chromosome Hypothesis of Schizophrenia: Alive, Dead, or Forgotten? A Commentary and Review.}, journal = {Molecular neuropsychiatry}, volume = {4}, number = {2}, pages = {83-89}, doi = {10.1159/000491489}, pmid = {30397596}, issn = {2296-9209}, abstract = {The X chromosome has long been an intriguing site for harboring genes that have importance in brain development and function. It has received the most attention for having specific genes underlying the X-linked inherited intellectual disabilities, but has also been associated with schizophrenia in a number of early studies. An X chromosome hypothesis for a genetic predisposition for schizophrenia initially came from the X chromosome anomaly population data showing an excess of schizophrenia in Klinefelter's (XXY) males and triple X (XXX) females. Crow and colleagues later expanded the X chromosome hypothesis to include the possibility of a locus on the Y chromosome and, specifically, genes on X that escaped inactivation and are X-Y homologous loci. Some new information about possible risk loci on these chromosomes has come from the current large genetic consortia genome-wide association studies, suggesting that perhaps this hypothesis needs to be revisited for some schizophrenias. The following commentary reviews the early and more recent literature supporting or refuting this dormant hypothesis and emphasizes the possible candidate genes still of interest that could be explored in further studies.}, }
@article {pmid30397447, year = {2018}, author = {Yamasaki, T and Aoki, S and Tokita, M}, title = {Allometry and integration do not strongly constrain beak shape evolution in large-billed (Corvus macrorhynchos) and carrion crows (Corvus corone).}, journal = {Ecology and evolution}, volume = {8}, number = {20}, pages = {10057-10066}, doi = {10.1002/ece3.4440}, pmid = {30397447}, issn = {2045-7758}, abstract = {A recent geometric morphometric study on certain landbird lineages revealed that a major part of the variation in beak shape is accounted for by skull size and cranial shape. The study interpreted this result as evidence for the presence of strong evolutionary constraints that severely prevented beak shape from evolving substantially away from predictions of allometry and morphological integration. However, there is another overlooked but similarly plausible explanation for this result: The reason why beak shape does not depart much from predictions might simply be that selection pressures favoring such changes in shape are themselves rare. Here, to evaluate the intensity of evolutionary constraints on avian beak shape more appropriately, we selected large-billed (Corvus macrorhynchos) and carrion crows (Corvus corone) as study objects. These landbird species seem to experience selection pressures favoring a departure from an allometric trajectory. A landmark-based geometric morphometric approach using three-dimensional reconstructions of CT scan images revealed that only 45.4% of the total shape variation was explained by allometry and beak-braincase integration. This suggests that when a selection pressure acts in a different direction to allometry and integration, avian beak shape can react to it and evolve flexibly. As traditionally considered, evolutionary constraints on avian beak shape might not be all that strong.}, }
@article {pmid30391908, year = {2018}, author = {Nishisaka-Nonaka, R and Mawatari, K and Yamamoto, T and Kojima, M and Shimohata, T and Uebanso, T and Nakahashi, M and Emoto, T and Akutagawa, M and Kinouchi, Y and Wada, T and Okamoto, M and Ito, H and Yoshida, KI and Daidoji, T and Nakaya, T and Takahashi, A}, title = {Irradiation by ultraviolet light-emitting diodes inactivates influenza a viruses by inhibiting replication and transcription of viral RNA in host cells.}, journal = {Journal of photochemistry and photobiology. B, Biology}, volume = {189}, number = {}, pages = {193-200}, doi = {10.1016/j.jphotobiol.2018.10.017}, pmid = {30391908}, issn = {1873-2682}, abstract = {Influenza A viruses (IAVs) pose a serious global threat to humans and their livestock, especially poultry and pigs. This study aimed to investigate how to inactivate IAVs by using different ultraviolet-light-emitting diodes (UV-LEDs). We developed sterilization equipment with light-emitting diodes (LEDs) those peak wavelengths were 365 nm (UVA-LED), 310 nm (UVB-LED), and 280 nm (UVC-LED). These UV-LED irradiations decreased dose fluence-dependent plaque-forming units of IAV H1N1 subtype (A/Puerto Rico/8/1934) infected Madin-Darby canine kidney (MDCK) cells, but the inactivation efficiency of UVA-LED was significantly lower than UVB- and UVC-LED. UV-LED irradiations did not alter hemagglutination titer, but decreased accumulation of intracellular total viral RNA in infected MDCK cells was observed. Additionally, UV-LED irradiations suppressed the accumulation of intracellular mRNA (messenger RNA), vRNA (viral RNA), and cRNA (complementary RNA), as measured by strand-specific RT-PCR. These results suggest that UV-LEDs inhibit host cell replication and transcription of viral RNA. Both UVB- and UVC-LED irradiation decreased focus-forming unit (FFU) of H5N1 subtype (A/Crow/Kyoto/53/2004), a highly pathogenic avian IAV (HPAI), in infected MDCK cells, and the amount of FFU were lower than the H1N1 subtype. From these results, it appears that IAVs may have different sensitivity among the subtypes, and UVB- and UVC-LED may be suitable for HPAI virus inactivation.}, }
@article {pmid30390453, year = {2018}, author = {López-Perea, JJ and Camarero, PR and Sánchez-Barbudo, IS and Mateo, R}, title = {Urbanization and cattle density are determinants in the exposure to anticoagulant rodenticides of non-target wildlife.}, journal = {Environmental pollution (Barking, Essex : 1987)}, volume = {244}, number = {}, pages = {801-808}, doi = {10.1016/j.envpol.2018.10.101}, pmid = {30390453}, issn = {1873-6424}, abstract = {The persistence and toxicity of second generation anticoagulant rodenticides (SGARs) in animal tissues make these compounds dangerous by biomagnification in predatory species. Here we studied the levels of SGARs in non-target species of wildlife and the environmental factors that influence such exposure. Liver samples of terrestrial vertebrates (n = 244) found dead between 2007 and 2016 in the region of Aragón (NE Spain) were analysed. The presence of SGARs was statistically analysed with binary or ordinal logistic models to study the effect of habitat characteristics including human population density, percentage of urban surface, livestock densities and surface of different types of crops. SGARs residues were detected in 83 (34%) of the animals and levels >200 ng/g were found in common raven (67%), red fox (50%), red kite (38%), Eurasian eagle-owl (25%), stone marten (23%), Eurasian buzzard (17%), northern marsh harrier (17%), and Eurasian badger (14%). The spatial analysis revealed that the presence of SGARs residues in wildlife was more associated with the use of these products as biocides in urban areas and cattle farms rather than as plant protection products in agricultural fields. This information permits to identify potential habitats where SGARs may pose a risk for predatory birds and mammals.}, }
@article {pmid30384509, year = {2018}, author = {Ruiz-Rodríguez, M and Martín-Vivaldi, M and Martínez-Bueno, M and Soler, JJ}, title = {Correction: Ruiz-Rodríguez et al. Gut Microbiota of Great Spotted Cuckoo Nestlings Is a Mixture of Those of Their Foster Magpie Siblings and of Cuckoo Adults. Genes 2018, 9, 381.}, journal = {Genes}, volume = {9}, number = {11}, pages = {}, doi = {10.3390/genes9110530}, pmid = {30384509}, issn = {2073-4425}, abstract = {The authors wish to make the following changes in their paper [...].}, }
@article {pmid30357434, year = {2018}, author = {Prochazkova, L and Lippelt, DP and Colzato, LS and Kuchar, M and Sjoerds, Z and Hommel, B}, title = {Exploring the effect of microdosing psychedelics on creativity in an open-label natural setting.}, journal = {Psychopharmacology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s00213-018-5049-7}, pmid = {30357434}, issn = {1432-2072}, support = {694722//European Research Council (ERC-2015-AdG-694722)/ ; }, abstract = {INTRODUCTION: Taking microdoses (a mere fraction of normal doses) of psychedelic substances, such as truffles, recently gained popularity, as it allegedly has multiple beneficial effects including creativity and problem-solving performance, potentially through targeting serotonergic 5-HT2A receptors and promoting cognitive flexibility, crucial to creative thinking. Nevertheless, enhancing effects of microdosing remain anecdotal, and in the absence of quantitative research on microdosing psychedelics, it is impossible to draw definitive conclusions on that matter. Here, our main aim was to quantitatively explore the cognitive-enhancing potential of microdosing psychedelics in healthy adults.<br><br>METHODS: During a microdosing event organized by the Dutch Psychedelic Society, we examined the effects of psychedelic truffles (which were later analyzed to quantify active psychedelic alkaloids) on two creativity-related problem-solving tasks: the Picture Concept Task assessing convergent thinking and the Alternative Uses Task assessing divergent thinking. A short version of the Ravens Progressive Matrices task assessed potential changes in fluid intelligence. We tested once before taking a microdose and once while the effects were expected to be manifested.<br><br>RESULTS: We found that both convergent and divergent thinking performance was improved after a non-blinded microdose, whereas fluid intelligence was unaffected.<br><br>CONCLUSION: While this study provides quantitative support for the cognitive-enhancing properties of microdosing psychedelics, future research has to confirm these preliminary findings in more rigorous placebo-controlled study designs. Based on these preliminary results, we speculate that psychedelics might affect cognitive metacontrol policies by optimizing the balance between cognitive persistence and flexibility. We hope this study will motivate future microdosing studies with more controlled designs to test this hypothesis.}, }
@article {pmid30356096, year = {2018}, author = {Bayern, AMPV and Danel, S and Auersperg, AMI and Mioduszewska, B and Kacelnik, A}, title = {Compound tool construction by New Caledonian crows.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {15676}, doi = {10.1038/s41598-018-33458-z}, pmid = {30356096}, issn = {2045-2322}, support = {P 29084//Austrian Science Fund (FWF Der Wissenschaftsfonds)/ ; P 29075//Austrian Science Fund (FWF Der Wissenschaftsfonds)/ ; }, abstract = {The construction of novel compound tools through assemblage of otherwise non-functional elements involves anticipation of the affordances of the tools to be built. Except for few observations in captive great apes, compound tool construction is unknown outside humans, and tool innovation appears late in human ontogeny. We report that habitually tool-using New Caledonian crows (Corvus moneduloides) can combine objects to construct novel compound tools. We presented 8 naïve crows with combinable elements too short to retrieve food targets. Four crows spontaneously combined elements to make functional tools, and did so conditionally on the position of food. One of them made 3- and 4-piece tools when required. In humans, individual innovation in compound tool construction is often claimed to be evolutionarily and mechanistically related to planning, complex task coordination, executive control, and even language. Our results are not accountable by direct reinforcement learning but corroborate that these crows possess highly flexible abilities that allow them to solve novel problems rapidly. The underlying cognitive processes however remain opaque for now. They probably include the species' typical propensity to use tools, their ability to judge affordances that make some objects usable as tools, and an ability to innovate perhaps through virtual, cognitive simulations.}, }
@article {pmid30355809, year = {2018}, author = {Ling, H and Mclvor, GE and Nagy, G and MohaimenianPour, S and Vaughan, RT and Thornton, A and Ouellette, NT}, title = {Simultaneous measurements of three-dimensional trajectories and wingbeat frequencies of birds in the field.}, journal = {Journal of the Royal Society, Interface}, volume = {15}, number = {147}, pages = {}, doi = {10.1098/rsif.2018.0653}, pmid = {30355809}, issn = {1742-5662}, abstract = {Tracking the movements of birds in three dimensions is integral to a wide range of problems in animal ecology, behaviour and cognition. Multi-camera stereo-imaging has been used to track the three-dimensional (3D) motion of birds in dense flocks, but precise localization of birds remains a challenge due to imaging resolution in the depth direction and optical occlusion. This paper introduces a portable stereo-imaging system with improved accuracy and a simple stereo-matching algorithm that can resolve optical occlusion. This system allows us to decouple body and wing motion, and thus measure not only velocities and accelerations but also wingbeat frequencies along the 3D trajectories of birds. We demonstrate these new methods by analysing six flocking events consisting of 50 to 360 jackdaws (Corvus monedula) and rooks (Corvus frugilegus) as well as 32 jackdaws and 6 rooks flying in isolated pairs or alone. Our method allows us to (i) measure flight speed and wingbeat frequency in different flying modes; (ii) characterize the U-shaped flight performance curve of birds in the wild, showing that wingbeat frequency reaches its minimum at moderate flight speeds; (iii) examine group effects on individual flight performance, showing that birds have a higher wingbeat frequency when flying in a group than when flying alone and when flying in dense regions than when flying in sparse regions; and (iv) provide a potential avenue for automated discrimination of bird species. We argue that the experimental method developed in this paper opens new opportunities for understanding flight kinematics and collective behaviour in natural environments.}, }
@article {pmid30335785, year = {2018}, author = {Wang, H and Marcišauskas, S and Sánchez, BJ and Domenzain, I and Hermansson, D and Agren, R and Nielsen, J and Kerkhoven, EJ}, title = {RAVEN 2.0: A versatile toolbox for metabolic network reconstruction and a case study on Streptomyces coelicolor.}, journal = {PLoS computational biology}, volume = {14}, number = {10}, pages = {e1006541}, doi = {10.1371/journal.pcbi.1006541}, pmid = {30335785}, issn = {1553-7358}, abstract = {RAVEN is a commonly used MATLAB toolbox for genome-scale metabolic model (GEM) reconstruction, curation and constraint-based modelling and simulation. Here we present RAVEN Toolbox 2.0 with major enhancements, including: (i) de novo reconstruction of GEMs based on the MetaCyc pathway database; (ii) a redesigned KEGG-based reconstruction pipeline; (iii) convergence of reconstructions from various sources; (iv) improved performance, usability, and compatibility with the COBRA Toolbox. Capabilities of RAVEN 2.0 are here illustrated through de novo reconstruction of GEMs for the antibiotic-producing bacterium Streptomyces coelicolor. Comparison of the automated de novo reconstructions with the iMK1208 model, a previously published high-quality S. coelicolor GEM, exemplifies that RAVEN 2.0 can capture most of the manually curated model. The generated de novo reconstruction is subsequently used to curate iMK1208 resulting in Sco4, the most comprehensive GEM of S. coelicolor, with increased coverage of both primary and secondary metabolism. This increased coverage allows the use of Sco4 to predict novel genome editing targets for optimized secondary metabolites production. As such, we demonstrate that RAVEN 2.0 can be used not only for de novo GEM reconstruction, but also for curating existing models based on up-to-date databases. Both RAVEN 2.0 and Sco4 are distributed through GitHub to facilitate usage and further development by the community (https://github.com/SysBioChalmers/RAVEN and https://github.com/SysBioChalmers/Streptomyces_coelicolor-GEM).}, }
@article {pmid30331498, year = {1817}, author = {Comrie, P}, title = {Reports on the Ardent Fever of the West Indies, as Occurring on Board His Majesty's Ships Raven and Niobe, in the Year 1815.}, journal = {Edinburgh medical and surgical journal}, volume = {13}, number = {50}, pages = {165-181}, pmid = {30331498}, issn = {0963-4932}, }
@article {pmid30323931, year = {2018}, author = {Freeman, NE and Newman, AEM}, title = {Quantifying corticosterone in feathers: validations for an emerging technique.}, journal = {Conservation physiology}, volume = {6}, number = {1}, pages = {coy051}, doi = {10.1093/conphys/coy051}, pmid = {30323931}, issn = {2051-1434}, abstract = {Feather corticosterone measurement is becoming a widespread tool for assessing avian physiology. Corticosterone is deposited into feathers during growth and provides integrative and retrospective measures of an individual's hypothalamic-pituitary-adrenal (HPA) axis function. Although researchers across disciplines have been measuring feather corticosterone for the past decade, there are still many issues with the extraction and measurement of corticosterone from feathers. In this paper, we provide several directives for refining the methodology for feather hormone analysis. We compare parallelism between the standard curve and serially diluted feather tissue from wild turkeys, Canada jays, and black-capped chickadees to demonstrate the wide applicability across species. Through a series of validations, we compare methods for feather preparation, sample filtration and extract reconstitution prior to corticosterone quantification using a radioimmunoassay. Higher corticosterone yields were achieved following pulverization of the feather however, more variation between replicates was observed. Removal of the rachis also increased the amount of corticosterone detected per unit mass while glass versus paper filters had no effect, and using ethanol in the reconstution buffer decreased intra-assay variation. With these findings and continued methodological refinement, feather corticosterone has the potential to be a powerful tool for both ecologists and physiologists working with historical and contemporary specimens.}, }
@article {pmid30319161, year = {2018}, author = {Norwood, CR}, title = {Mapping the Intersections of Violence on Black Women's Sexual Health within the Jim Crow Geographies of Cincinnati Neighborhoods.}, journal = {Frontiers}, volume = {39}, number = {2}, pages = {97-135}, pmid = {30319161}, issn = {0160-9009}, abstract = {Who will revere the Black woman? Who will keep our neighborhoods safe for Black innocent womanhood? Black womanhood is outraged and humiliated. Black womanhood cries for dignity and restitution and salvation. Black womanhood wants and needs protection, and keeping, and holding. Who will assuage her indignation? Who will keep her precious and pure? Who will glorify and proclaim her beautiful image? To whom will she cry rape? Abbey Lincoln, 1970.}, }
@article {pmid30313452, year = {2018}, author = {Passanha, V and Brescovit, AD}, title = {On the Neotropical spider Subfamily Masteriinae (Araneae, Dipluridae).}, journal = {Zootaxa}, volume = {4463}, number = {1}, pages = {1-73}, pmid = {30313452}, issn = {1175-5334}, abstract = {The Neotropical species of the diplurid subfamily Masteriinae are revised and redefined. Masteriinae now comprises four genera, Masteria L. Koch, 1893, Striamea Raven, 1981, a new genus, Siremata n. gen. and Edwa Raven, 2015, a fossil genus. The type species, Masteria hirsuta L. Koch, 1893, was used as basis for comparison and the knowledge of the genus has increased. Twelve species of Masteria are redescribed and eight new species are described: M. amarumayu n. sp. and M. mutum n. sp., from Brazil; M. yacambu n. sp., from Venezuela; M. sabrinae n. sp., from Martinique; M. tayrona n. sp., from Colombia; M. aguaruna n. sp., from Peru, M. soucouyant n. sp., from Trinidad and Tobago; and M. galipote n. sp., from the Dominican Republic. Females of Masteria aimeae (Alayón, 1995) and M. golovatchi Alayón, 1995 are described for the first time. Females of M. spinosa (Petrunkevitch, 1925), M. petrunkevitchi (Chickering, 1964), M. lewisi (Chickering, 1964), M. barona (Chickering, 1966), M. downeyi (Chickering, 1966), M. simla (Chickering, 1966), M. colombiensis Raven, 1981 and M. pecki Gertsch, 1982 are illustrated for the first time and rediagnosed. Masteria tovarensis (Simon, 1889) and M. cyclops (Simon, 1889) are synonymized with M. lucifuga (Simon, 1889). Masteria modesta (Simon, 1892) is considered as species inquirendae and M. emboaba Pedroso, Baptista Bertani, 2015 is considered as incertae sedis, as the type is lost. Both species of Striamea are revised and redescribed. A new genus, Siremata n. gen., is described and includes three Amazonian species: S. valteri n. sp., S. juruti n. sp., S. lucasae n. sp. Knowledge of the distribution ranges of the Neotropical Masteriinae are increased.}, }
@article {pmid30313189, year = {2018}, author = {Almeida, MQ and Salvatierra, L and De Morais, JW}, title = {A new species of Masteria L. Koch, 1873 (Dipluridae: Masteriinae) from Guyana.}, journal = {Zootaxa}, volume = {4434}, number = {2}, pages = {366-368}, pmid = {30313189}, issn = {1175-5334}, abstract = {Mygalomorphs are a diverse spider group with primitive characteristics composed of the largest spider species in the world, however some species may be very small (Bond et al. 2012; Rogerio et al. 2013). The small spiders of the subfamily Masteriinae (Dipluridae, Mygalomorphae) can be found in Asia and South America (Raven 1981; Pedroso et al. 2015; WSC 2017). The subfamily is represented by two genera: Masteria L. Koch, 1873 and Striamea Raven, 1981. Masteria species can be identified by the following combination of characters: absence of cuspules in endites and labium; zero, two, six or eight eyes; and with or without paraembolic apophysis on the male palpal bulb (Raven 1981, 1985, 1991; Alayón 1995; Bertani et al. 2013; Pedroso et al. 2015). Currently, 24 species of Masteria are described, with 6 species found in South America: Masteria colombiensis, Raven, 1981 from Colombia; M. manauara Bertani, Cruz Oliveira 2013 and M. emboaba Pedroso, Baptista Bertani, 2015 from Brazil; M. cyclops (Simon 1889), M. tovarensis (Simon, 1889) and M. lucifuga (Simon, 1889) from Venezuela (WSC 2017). We document herein the first record and description of a new species of the genus Masteria from Guyana.}, }
@article {pmid30307964, year = {2018}, author = {Hausberger, M and Boigné, A and Lesimple, C and Belin, L and Henry, L}, title = {Wide-eyed glare scares raptors: From laboratory evidence to applied management.}, journal = {PloS one}, volume = {13}, number = {10}, pages = {e0204802}, doi = {10.1371/journal.pone.0204802}, pmid = {30307964}, issn = {1932-6203}, abstract = {Raptors are one of the most important causes of fatalities due to their collisions with aircrafts as well as being the main victims of collisions with constructions. They are difficult to deter because they are not influenced by other airspace users or ground predators. Because vision is the primary sensory mode of many diurnal raptors, we evaluated the reactions of captive raptors to a &quot;superstimulus&quot; (a &quot;paradoxical effect whereby animals show greater responsiveness to an exaggerated stimulus than to the natural stimulus&quot;) that combined an &quot;eye shape&quot; stimulus (as many species have an aversion for this type of stimulus) and a looming movement (LE). This looming stimulus mimics an impending collision and induces avoidance in a wide range of species. In captivity, raptors showed a clear aversion for this LE stimulus. We then tested it in a real life setting: at an airport where raptors are abundant. This study is the first to show the efficiency of a visual non-invasive repellent system developed on the basis of both captive and field studies. This system deterred birds of prey and corvids through aversion, and did not induce habituation. These findings suggest applications for human security as well as bird conservation, and further research on avian visual perception and sensitivity to signals.}, }
@article {pmid30288960, year = {2018}, author = {Taufique, ST and Prabhat, A and Kumar, V}, title = {Light at night affects hippocampal and nidopallial cytoarchitecture: Implication for impairment of brain function in diurnal corvids.}, journal = {Journal of experimental zoology. Part A, Ecological and integrative physiology}, volume = {}, number = {}, pages = {}, doi = {10.1002/jez.2238}, pmid = {30288960}, issn = {2471-5646}, support = {SR/CSI/03/2010 (2)//Department of Science and Technology-Cognitive Science Initiative/ ; //DST-DU PURSE Program/ ; //R&amp;D Program, University of Delhi/ ; }, abstract = {Our previous studies have shown that light at night (LAN) impaired cognitive performance and affected neurogenesis and neurochemistry in the cognition-associated brain regions, particularly the hippocampus (HP) and lateral caudal nidopallium (NCL) of Indian house crows (Corvus splendens). Here, we examined the cytoarchitecture and mapped out the morphology of neurons and glia-neuron density in HP and NCL regions of crows that were first entrained to 12-hr light (LL): 12-hr darkness (LD) and then exposed to the light regime in which 12-hr darkness was either replaced by daytime light (i.e., constant light, LL) or by dim light (i.e., dim light at night, dLAN), with controls continued on LD 12:12. Compared with LD, there was a significant decrease in the soma size, suggesting reduced neuronal plasticity without affecting the neuronal density of both HP and NCL of crows under LL and dLAN conditions. In parallel, we found a reduced number of glia cells and, hence, decreased glia-neuron ratio positively correlated with soma size in both, HP and NCL regions. These results for the first time demonstrate LAN-induced negative effects on the brain cytoarchitecture of a diurnal species and give insight for possible influence on the brain health and functions in animals including humans that might be inadvertently exposed to LAN in an emerging night-illuminated urban environment.}, }
@article {pmid30286069, year = {2018}, author = {Mitchell, PW}, title = {The fault in his seeds: Lost notes to the case of bias in Samuel George Morton's cranial race science.}, journal = {PLoS biology}, volume = {16}, number = {10}, pages = {e2007008}, doi = {10.1371/journal.pbio.2007008}, pmid = {30286069}, issn = {1545-7885}, abstract = {The discovery of nearly 180-year-old cranial measurements in the archives of 19th century American physician and naturalist Samuel George Morton can address a lingering debate, begun in the late 20th century by paleontologist and historian of science Stephen Jay Gould, about the unconscious bias alleged in Morton's comparative data of brain size in human racial groups. Analysis of Morton's lost data and the records of his studies does not support Gould's arguments about Morton's biased data collection. However, historical contextualization of Morton with his scientific peers, especially German anatomist Friedrich Tiedemann, suggests that, while Morton's data may have been unbiased, his cranial race science was not. Tiedemann and Morton independently produced similar data about human brain size in different racial groups but analyzed and interpreted their nearly equivalent results in dramatically different ways: Tiedemann using them to argue for equality and the abolition of slavery, and Morton using them to entrench racial divisions and hierarchy. These differences draw attention to the epistemic limitations of data and the pervasive role of bias within the broader historical, social, and cultural context of science.}, }
@article {pmid30284948, year = {2018}, author = {Rogers, KH and Ley, DH and Woods, LW}, title = {Mycoplasmosis of House Finches (Haemorhous mexicanus) and California Scrub-Jays (Aphelocoma californica) in a Wildlife Rehabilitation Facility with Probable Nosocomial Transmission.}, journal = {Journal of wildlife diseases}, volume = {}, number = {}, pages = {}, doi = {10.7589/2018-06-162}, pmid = {30284948}, issn = {1943-3700}, abstract = {We describe an investigation of an outbreak of conjunctivitis in juvenile House Finches (Haemorhous mexicanus) and California Scrub-jays (Aphelocoma californica) at a central California wildlife rehabilitation facility. In late May 2015, the facility began admitting juvenile finches, the majority with normal eyes at intake. In June, with juvenile finches already present, the facility admitted additional juvenile scrub-jays, again all with normal eyes at intake. In July, after conjunctivitis was observed in increasing numbers of juvenile finches and scrub-jays, carcasses were submitted for postmortem examination. Histopathology of five finches and three scrub-jays identified lymphocytic infiltrates in the ocular tissues. Conjunctival swabs from 87% (13/15) finches and 33% (4/12) scrub-jays were PCR-positive for Mycoplasma gallisepticum. One finch and two scrub-jays were PCR-positive for Mycoplasma synoviae. Additionally, gene sequencing (16S rRNA and 16S-23S intergenic spacer region) identified Mycoplasma sturni from 33% (3/9) scrub-jays. This outbreak of conjunctivitis suggested that M. gallisepticum-infected juvenile finches admitted to and maintained in a multispecies nursery likely resulted in transmission within the facility to healthy juvenile finches and scrub-jays. Evidence of other Mycoplasma spp. in finches and scrub-jays indicates that these species are susceptible to infection and may act as carriers. This outbreak highlighted the need for effective triage and biosecurity measures within wildlife rehabilitation facilities.}, }
@article {pmid30282404, year = {2018}, author = {Shin, DA and Kim, C and Yudoyono, F and Yun, Y and Ha, Y and Kang, S}, title = {Feasibility of Percutaneous Robot-Assisted Epiduroscopic System.}, journal = {Pain physician}, volume = {21}, number = {5}, pages = {E565-E571}, pmid = {30282404}, issn = {2150-1149}, abstract = {BACKGROUND: Endoscopy has replaced open surgery, especially in spinal surgery. Among them, image-guided epiduroscopy allows pain generators to be identified, including epidural adhesion, fibrotic tissues, root compression, and spinal stenosis. However, the heavy lead apron worn by pain physicians to avoid exposure to radiation can induce occupational hazards, such as orthopedic complications and radiation-induced cancer. Hence, we developed a robotic system to address these problems.<br><br>OBJECTIVE: The aim of the study was to evaluate the feasibility of a robot-controlled epiduroscopic system.<br><br>STUDY DESIGN: In vivo animal experiment.<br><br>SETTING: University in Republic of Korea.<br><br>METHODS: The robot-controlled epiduroscopic system was developed using the open architecture robot system (The Raven Surgical Robotic System, CITRIS, Berkley, CA, USA). The robotic system consists of a lab-made epiduroscope, steering section, robotic arm, and manipulator. For the in vivo study, 2 Yorkshire pigs were used to simulate an epiduroscopic procedure with the robotic system.<br><br>RESULTS: The insertion and steering of the catheter was performed safely, and epiduroscopic visualization was obtained without side effects. There were no device-related complications. Radiation exposure for the primary operator was 80% lower than the levels found during conventional epiduroscopic procedures. All live pigs showed normal behavior without any signs of pain. The mean time to reach the target region was less than 8 minutes.<br><br>LIMITATIONS: The epiduroscopic procedure was performed on pigs and not on humans. The dimensions of the spinal canal of pigs cannot compare to those of humans.<br><br>CONCLUSIONS: We demonstrated the feasibility of the robot-assisted epiduroscopic system.<br><br>KEY WORDS: Epiduroscopy, robotic system, spine, pig, animal model.}, }
@article {pmid30271545, year = {2018}, author = {Townsend, AK and Wheeler, SS and Freund, D and Sehgal, RNM and Boyce, WM}, title = {Links between blood parasites, blood chemistry, and the survival of nestling American crows.}, journal = {Ecology and evolution}, volume = {8}, number = {17}, pages = {8779-8790}, doi = {10.1002/ece3.4287}, pmid = {30271545}, issn = {2045-7758}, abstract = {Many studies have used the avian hemosporidians (Leucocytozoon, Plasmodium, and Hemoproteus) to test hypotheses of host-parasite co-evolution, yet documented health and survival consequences of these blood parasites vary among studies and generalizations about their pathogenicity are debatable. In general, the negative effects of the hemosporidians are likely to be greatest during acute infections of young birds, yet most previous studies in wild passerines have examined chronic effects in adults. Here, we evaluated responses of nestling American crows (Corvus brachyrhynchos) to acute infection (prevalence and burden), as well as its short- and long-term survival consequences. We used panel of nine hematological and biochemical parameters that are regularly used to evaluate the health of domestic animals, including leukocyte profiles, hematocrit, and plasma proteins. We assessed the effects of infection on survival in a mark-recapture framework. Overall, 56% of crows (n = 321 samples) were infected by at least one of the three genera. Infections by all genera were associated with elevated plasma proteins and globulins, which could indicate an adaptive immune response. However, only Plasmodium infections were associated with low hematocrit (anemia) and lower fledging success, possibly mediated by the negative effect of low hematocrit values on body condition. Moreover, early Plasmodium infection (<40 days of age) had long-term survival implications: it was associated with lower apparent survival probability within 3 years after fledging. These results suggest that young crows mounted an adaptive immune response to all three genera. Short- and long-term pathological effects, however, were only apparent with Plasmodium infections.}, }
@article {pmid30269648, year = {2018}, author = {Prussien, KV and Salihu, A and Abdullahi, SU and Galadanci, NA and Bulama, K and Belonwu, RO and Kirkham, FJ and Yarboi, J and Bemis, H and DeBaun, MR and Compas, BE}, title = {Associations of transcranial doppler velocity, age, and gender with cognitive function in children with sickle cell anemia in Nigeria.}, journal = {Child neuropsychology : a journal on normal and abnormal development in childhood and adolescence}, volume = {}, number = {}, pages = {1-16}, doi = {10.1080/09297049.2018.1526272}, pmid = {30269648}, issn = {1744-4136}, abstract = {Children with sickle cell anemia (SCA) have elevated cerebral blood velocity relative to healthy peers. The primary aim of this study was to evaluate the association between cerebral blood velocity, measured by transcranial Doppler (TCD) ultrasound, age, and gender with cognitive function in children with SCA in Nigeria. Eighty-three children (Mage = 9.10, SD = 1.90 years; 55% female) with SCA in Nigeria completed cognitive assessments and a TCD ultrasound. The association between TCD velocity and measures of perceptual reasoning (Raven's Progressive Matrices), working memory (WISC-IV Digit Span), and executive planning (Tower of London, TOL) were assessed. Results showed that elevated TCD velocity significantly predicted lower scores on TOL Time Violations and Total Problem-Solving Time when controlling for BMI, hemoglobin level, and parent education, suggesting that TCD velocity is related to the efficiency of executive function. Further, age was negatively related to children's performance on the Ravens Matrices and TOL Total Correct, and boys showed greater deficits on the TOL Total Correct relative to girls. Moderation analyses for gender showed that there was a conditional negative association between TCD velocity and Digit Span for boys, but not for girls. Findings suggest that children with SCA in Nigeria with elevated TCD velocity are at risk for deficits in efficiency of executive planning, and boys with elevated TCD velocity are particularly at increased risk for deficits in auditory working memory. Implications of this study are important for interventions to reduce cerebral blood velocity and the use of TCD in this population.}, }
@article {pmid30267304, year = {2018}, author = {Naumczyk, P and Sawicka, AK and Brzeska, B and Sabisz, A and Jodzio, K and Radkowski, M and Czachowska, K and Winklewski, PJ and Finc, K and Szurowska, E and Demkow, U and Szarmach, A}, title = {Cognitive Predictors of Cortical Thickness in Healthy Aging.}, journal = {Advances in experimental medicine and biology}, volume = {}, number = {}, pages = {}, doi = {10.1007/5584_2018_265}, pmid = {30267304}, issn = {0065-2598}, abstract = {This study seeks to define the role of predictive values of the motor speed, inhibition control, and fluid and crystallized intelligence in estimating the cortical thickness in healthy elderly. Forty-six older healthy subjects (37 women, 9 men) over 60 years of age were included in the study. The participants were examined on 3.0 T MRI scanners. The protocol included standard anatomical sequences, to exclude brain pathology, and a high-resolution T1-weighted sequence used to estimate the cortical thickness. The neuropsychological protocol included fluid intelligence assessment (Raven Progressive Matrices), crystalized intelligence assessment (information or vocabulary subtest of the Wechsler Adult Intelligence Scale-Revised (WAIS-R)), and executive functioning (Color Traits Test). The findings unraveled several interdependencies. The higher the intelligence, the thicker was the grey matter in nine regions of both hemispheres, but also some paradoxical reversed associations were found in four areas; all of them were localized along different sections of the cingulate gyrus in both hemispheres. An inverse association was found between crystallized intelligence and the thickness of the pars opecularis of the right hemisphere. The better the executive functioning, the thicker was the grey matter of a given region. The better the motor performance, the thicker was the grey matter of the rostral middle frontal area of the left hemisphere and the lingual gyrus of both hemispheres. In conclusion, the associations unraveled demonstrate that the neural mechanisms underlying healthy aging are complex and heterogenic across different cognitive domains and neuroanatomical regions. No brain aging theory seems to provide a suitable interpretative framework for all the results. A novel, more integrative approach to the brain aging should be considered.}, }
@article {pmid30256169, year = {2018}, author = {Elderbrock, EK and Small, TW and Schoech, SJ}, title = {Adult Provisioning Influences Nestling Corticosterone Levels in Florida Scrub Jays (Aphelocoma coerulescens).}, journal = {Physiological and biochemical zoology : PBZ}, volume = {91}, number = {6}, pages = {1083-1090}, doi = {10.1086/700258}, pmid = {30256169}, issn = {1537-5293}, abstract = {We studied Florida scrub jay (Aphelocoma coerulescens) nestlings to examine the relationship between parental feeding rates and levels of corticosterone (CORT), a metabolic and stress-related steroid hormone hypothesized to play a role in mediating begging behavior. It has been documented that nutritional deficiency results in increased glucocorticoid levels in nestling birds. Further, previous studies have found that CORT levels of Florida scrub jay nestlings are negatively correlated with parental nest attendance and provisioning rates; however, the behavioral observations were made several days before the collection of samples to assess CORT levels. Few studies have investigated whether experience immediately before sampling impacts nestling glucocorticoid levels, especially in a free-living species. By monitoring parental activity at the nest before sample collection, we found that nestling CORT levels varied as a function of parental provisioning rate and the time since their last feed. However, counter to our predictions, higher provisioning rates and more recent feedings were associated with higher CORT levels in nestlings rather than lower CORT levels. These results suggest that some aspect of parental provisioning results in increased CORT levels in nestling Florida scrub jays.}, }
@article {pmid30253153, year = {2018}, author = {Rutz, C and Hunt, GR and St Clair, JJH}, title = {Corvid Technologies: How Do New Caledonian Crows Get Their Tool Designs?.}, journal = {Current biology : CB}, volume = {28}, number = {18}, pages = {R1109-R1111}, doi = {10.1016/j.cub.2018.08.031}, pmid = {30253153}, issn = {1879-0445}, abstract = {Recent research shows that New Caledonian crows can incorporate information from researcher-made objects into objects they subsequently manufacture. This 'mental template matching' is one of several possible - mutually compatible - mechanisms for the cultural transmission of tool designs among wild crows.}, }
@article {pmid30238146, year = {2018}, author = {Ganz, K and Jenni, L and Madry, MM and Kraemer, T and Jenny, H and Jenny, D}, title = {Acute and Chronic Lead Exposure in Four Avian Scavenger Species in Switzerland.}, journal = {Archives of environmental contamination and toxicology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s00244-018-0561-7}, pmid = {30238146}, issn = {1432-0703}, abstract = {Despite irrefutable evidence of its negative impact on animal behaviour and physiology, lethal and sublethal lead poisoning of wildlife is still persistent and widespread. For scavenging birds, ingestion of ammunition, or fragments thereof, is the major exposure route. In this study, we examined the occurrence of lead in four avian scavengers of Switzerland and how it differs between species, regions, and age of the bird. We measured lead concentration in liver and bone of the two main alpine avian scavengers (golden eagle Aquila chrysaetos and bearded vulture Gypaetus barbatus) over the entire area of the Swiss Alps and two of the main avian scavengers occurring in the lowlands of Switzerland (red kite Milvus milvus and common raven Corvus corax). Of those four species, only the bearded vulture is an obligate scavenger. We found that lead burdens in the two alpine avian scavengers were higher than those found for the same species elsewhere in Europe or North America and reached levels compatible with acute poisoning, whereas lead burdens of the two lowland avian scavengers seemed to be lower. Several golden eagles, but only one red kite with abnormally high bone lead concentrations were found. In all four species, a substantial proportion of birds had elevated levels which presumably represent recent (liver lead levels) or past (bone lead levels) uptake of sublethal doses of lead.}, }
@article {pmid30228952, year = {2018}, author = {Baldauf, MC and Gerke, JS and Kirschner, A and Blaeschke, F and Effenberger, M and Schober, K and Rubio, RA and Kanaseki, T and Kiran, MM and Dallmayer, M and Musa, J and Akpolat, N and Akatli, AN and Rosman, FC and Özen, Ö and Sugita, S and Hasegawa, T and Sugimura, H and Baumhoer, D and Knott, MML and Sannino, G and Marchetto, A and Li, J and Busch, DH and Feuchtinger, T and Ohmura, S and Orth, MF and Thiel, U and Kirchner, T and Grünewald, TGP}, title = {Systematic identification of cancer-specific MHC-binding peptides with RAVEN.}, journal = {Oncoimmunology}, volume = {7}, number = {9}, pages = {e1481558}, doi = {10.1080/2162402X.2018.1481558}, pmid = {30228952}, issn = {2162-4011}, abstract = {Immunotherapy can revolutionize anti-cancer therapy if specific targets are available. Immunogenic peptides encoded by cancer-specific genes (CSGs) may enable targeted immunotherapy, even of oligo-mutated cancers, which lack neo-antigens generated by protein-coding missense mutations. Here, we describe an algorithm and user-friendly software named RAVEN (Rich Analysis of Variable gene Expressions in Numerous tissues) that automatizes the systematic and fast identification of CSG-encoded peptides highly affine to Major Histocompatibility Complexes (MHC) starting from transcriptome data. We applied RAVEN to a dataset assembled from 2,678 simultaneously normalized gene expression microarrays comprising 50 tumor entities, with a focus on oligo-mutated pediatric cancers, and 71 normal tissue types. RAVEN performed a transcriptome-wide scan in each cancer entity for gender-specific CSGs, and identified several established CSGs, but also many novel candidates potentially suitable for targeting multiple cancer types. The specific expression of the most promising CSGs was validated in cancer cell lines and in a comprehensive tissue-microarray. Subsequently, RAVEN identified likely immunogenic CSG-encoded peptides by predicting their affinity to MHCs and excluded sequence identity to abundantly expressed proteins by interrogating the UniProt protein-database. The predicted affinity of selected peptides was validated in T2-cell peptide-binding assays in which many showed binding-kinetics like a very immunogenic influenza control peptide. Collectively, we provide an exquisitely curated catalogue of cancer-specific and highly MHC-affine peptides across 50 cancer types, and a freely available software (https://github.com/JSGerke/RAVENsoftware) to easily apply our algorithm to any gene expression dataset. We anticipate that our peptide libraries and software constitute a rich resource to advance anti-cancer immunotherapy.}, }
@article {pmid30225178, year = {2018}, author = {Cucco, M and Bowman, R}, title = {Mass fluctuation in breeding females, males, and helpers of the Florida scrub-jay Aphelocoma coerulescens.}, journal = {PeerJ}, volume = {6}, number = {}, pages = {e5607}, doi = {10.7717/peerj.5607}, pmid = {30225178}, issn = {2167-8359}, abstract = {Much evidence suggests that birds actively regulate their body mass reserves relative to their energy needs. Energy requirements during reproduction may differ in relation to sex-specific behavioural roles or, in the case of cooperative breeders, breeders relative to helpers. We measured body mass of free-living Florida scrub-jays throughout the nesting season by training them to land on an electronic balance. Jays exhibited a pattern of diurnal linear mass gain, from morning to afternoon. Day-to-day mass fluctuations, defined as the difference between mass on two consecutive days, were small (>80% were within 2 g, less than 3% of the mass of an adult bird) for all classes of jays: female breeders, male breeders and prebreeding helpers. The jays, which live in subtropical south-central Florida, did not exhibit changes in day-to-day mass fluctuation relative to weather or climate variables or calendar date. Day-to-day mass fluctuations influenced mass fluctuation between the following third and fourth days. These changes were usually compensatory, indicating that jays are able to regulate their body mass on a short-term basis, despite strong differences in their roles in reproduction. During reproduction, jays have a relatively predictable and abundant food supply, thus the appropriate strategy may be to maintain a stable body mass that balances some energy reserves against maintaining a low body mass for efficient flight, as required during reproduction.}, }
@article {pmid30222228, year = {2018}, author = {Townsend, AK and Taff, CC and Jones, ML and Getman, KH and Wheeler, SS and Hinton, MG and Logsdon, RM}, title = {Apparent inbreeding preference despite inbreeding depression in the American crow.}, journal = {Molecular ecology}, volume = {}, number = {}, pages = {}, doi = {10.1111/mec.14866}, pmid = {30222228}, issn = {1365-294X}, abstract = {Although matings between relatives can have negative effects on offspring fitness, apparent inbreeding preference has been reported in a growing number of systems, including those with documented inbreeding depression. Here, we examined evidence for inbreeding depression and inbreeding preference in two populations (Clinton, New York and Davis, California, USA) of the cooperatively breeding American crow (Corvus brachyrhynchos). We then compared observed inbreeding strategies with theoretical expectations for optimal, adaptive levels of inbreeding, given the inclusive fitness benefits and population-specific magnitude of inbreeding depression. We found that low heterozygosity at a panel of 33 microsatellite markers was associated with low survival probability (fledging success) and low white blood cell counts among offspring in both populations. Despite these costs, our data were more consistent with inbreeding preference than avoidance: the observed heterozygosity among 396 sampled crow offspring was significantly lower than expected if local adults were mating by random chance. This pattern was consistent across a range of spatial scales in both populations. Theoretically adaptive levels of inbreeding, given the magnitude of inbreeding depression, were predicted to be very low in the California population, whereas complete disassociative mating was predicted in the New York population. Sexual conflict might have contributed to the apparent absence of inbreeding avoidance in crows. These data add to an increasing number of examples of an &quot;inbreeding paradox,&quot; where inbreeding appears to be preferred despite inbreeding depression. This article is protected by copyright. All rights reserved.}, }
@article {pmid30218871, year = {2018}, author = {Herring, G and Eagles-Smith, CA and Varland, DE}, title = {Mercury and lead exposure in avian scavengers from the Pacific Northwest suggest risks to California condors: Implications for reintroduction and recovery.}, journal = {Environmental pollution (Barking, Essex : 1987)}, volume = {243}, number = {Pt A}, pages = {610-619}, doi = {10.1016/j.envpol.2018.09.005}, pmid = {30218871}, issn = {1873-6424}, abstract = {Mercury (Hg) and lead (Pb) are widespread contaminants that pose risks to avian scavengers. In fact, Pb exposure is the primary factor limiting population recovery in the endangered California condor (Gymnogyps californianus) and Hg can impair avian reproduction at environmentally relevant exposures. The Pacific Northwest region of the US was historically part of the condor's native range, and efforts are underway to expand recovery into this area. To identify potential threats to reintroduced condors we assessed foraging habitats, Hg and Pb exposure, and physiological responses in two surrogate avian scavenger species (common ravens [Corvus corax] and turkey vultures [Cathartes aura] across the region between 2012 and 2016. Mercury exposure near the Pacific coast was 17-27-fold higher than in inland areas, and stable carbon and sulfur isotopes ratios indicated that coastal scavengers were highly reliant on marine prey. In contrast, Pb concentrations were uniformly elevated across the region, with 18% of the birds exposed to subclinical poisoning levels. Elevated Pb concentrations were associated with lower delta-aminolevulinic acid dehydratase (δ-ALAD) activity, and in ravens there was an interactive effect between Hg and Pb on fecal corticosterone concentrations. This interaction indicated that the effects of Hg and Pb exposure on the stress axis are bidirectional, and depend on the magnitude of simultaneous exposure to the other contaminant. Our results suggest that condors released to the Pacific Northwest may be exposed to both elevated Hg and Pb, posing challenges to management of future condor populations in the Pacific Northwest. Developing a robust monitoring program for reintroduced condors and surrogate scavengers will help both better understand the drivers of exposure and predict the likelihood of impaired health. These findings provide a strong foundation for such an effort, providing resource managers with valuable information to help mitigate potential risks.}, }
@article {pmid30218624, year = {2018}, author = {Taufique, SKT and Prabhat, A and Kumar, V}, title = {Illuminated night alters hippocampal gene expressions and induces depressive-like responses in diurnal corvids.}, journal = {The European journal of neuroscience}, volume = {}, number = {}, pages = {}, doi = {10.1111/ejn.14157}, pmid = {30218624}, issn = {1460-9568}, abstract = {Artificial light at night induces circadian disruptions and causes cognitive impairment and mood disorders; yet very little is known about the neural and molecular correlates of these effects in diurnal animals. We manipulated the night environment and examined cellular and molecular changes in hippocampus, the brain region involved in cognition and mood, of Indian house crows (Corvus splendens) exposed to 12 h light (150 lux): 12 h darkness (0 lux). Diurnal corvids are an ideal model species with cognitive abilities at par with mammals. Dim light (6 lux) at night (dLAN) altered daily activity:rest pattern, reduced sleep and induced depressive-like responses (decreased eating and self-grooming, self-mutilation and reduced novel object exploration); return to an absolute dark night reversed these negative effects. dLAN suppressed nocturnal melatonin levels, however, diurnal corticosterone levels were unaffected. Concomitant reduction of immunoreactivity for DCX and BDNF suggested dLAN-induced suppression of hippocampal neurogenesis and compromised neuronal health. dLAN also negatively influenced hippocampal expression of genes associated with depressive-like responses (bdnf, il-1β, tnfr1, nr4a2), but not of those associated with neuronal plasticity (egr1, creb, syngap, syn2, grin2a, grin2b), cellular oxidative stress (gst, sod3, cat1) and neuronal death (caspase2, caspase3, foxo3). Furthermore, we envisaged the role of BDNF and showed epigenetic modification of bdnf gene by decreased histone H3 acetylation and increased hdac4 expression under dLAN. These results demonstrate transcriptional and epigenetic bases of dLAN-induced negative effects in diurnal crows, and provide insights into the risks of exposure to illuminated nights to animals including humans in an urban setting. This article is protected by copyright. All rights reserved.}, }
@article {pmid30215276, year = {2018}, author = {Simonds, VW and Kim, FL and LaVeaux, D and Pickett, V and Milakovich, J and Cummins, J}, title = {Guardians of the Living Water: Using a Health Literacy Framework to Evaluate a Child as Change Agent Intervention.}, journal = {Health education &amp; behavior : the official publication of the Society for Public Health Education}, volume = {}, number = {}, pages = {1090198118798676}, doi = {10.1177/1090198118798676}, pmid = {30215276}, issn = {1552-6127}, abstract = {BACKGROUND: American Indian communities in the United States experience considerable health inequities, including increased exposure to environmental contaminants. Consequently, community members of the Apsáalooke (Crow) Nation identified the lack of water-related environmental knowledge among children as an area of concern.<br><br>AIM: The purpose of this study was to provide a feasibility evaluation of an increasingly sophisticated environmental health literacy program for children.<br><br>METHOD: A community-academic partnership developed and piloted the Guardians of the Living Water program to increase environmental health literacy among children and their families on the Crow reservation. Nutbeam's framework for health literacy, a schema based on functional, interactive, and critical literacy, shaped the program evaluation. We used a within-subjects, quasi-experimental design without a control group. Interviews with children and parents were used to assess the feasibility of the program, while pre-/posttests assessed changes in knowledge, skills, and behavior.<br><br>RESULTS: Compared with preintervention responses, those from postintervention indicated significant increases for selected knowledge and attitude components. Based on qualitative interviews with children and caregivers, the camp was a valuable experience and increased knowledge of water quality science and reinforced cultural knowledge.<br><br>DISCUSSION: This success of our program stems from the trust initially built between partners and then expanded throughout the community. The program and the evaluation benefited from both the health literacy framework and from our integration of Apsáalooke values.<br><br>CONCLUSION: Our findings suggest that a community-based intervention designed to increase environmental health literacy among youth and their social networks is feasible and acceptable to this American Indian community.}, }
@article {pmid30205027, year = {2018}, author = {Wheatcroft, D and Price, TD}, title = {Collective Action Promoted by Key Individuals.}, journal = {The American naturalist}, volume = {192}, number = {4}, pages = {401-414}, doi = {10.1086/698874}, pmid = {30205027}, issn = {1537-5323}, abstract = {Explaining why individuals participate in risky group behaviors has been a long-term challenge. We experimentally studied the formation of groups of birds (mobs) that aggressively confront predators and avian nest parasites and developed a theoretical model to evaluate the conditions under which mobs arise. We presented taxidermied mounts of predators on adult birds (hawks and owls) and of nest threats (crows and cuckoos) at different distances to nests of Phylloscopus warblers. Even when alone, birds are aggressive toward predators of adult birds, both at and away from their nests. By contrast, birds aggressively confront nest threats alone only when they have a nest nearby. However, strong initial responses by nest owners lead individuals without nearby nests to increase their responses, thereby generating a mob. Building on these findings, we derive the conditions in which individuals are incentivized to invest more when joining a high-gain individual compared to when acting alone. Strong responses of high-gain individuals acting alone tend to reduce the investments of other high-gain individuals that subsequently join. However, individuals that benefit sufficiently little from acting alone increase their investments when joining a high-gain individual and can even be sufficiently incentivized to join in when they would otherwise not act alone. Together, these results suggest an important role for key individuals in the generation of some group behaviors.}, }
@article {pmid30194522, year = {2018}, author = {Ţălu, Ş and Morozov, IA and Sobola, D and Škarvada, P}, title = {Multifractal Characterization of Butterfly Wings Scales.}, journal = {Bulletin of mathematical biology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s11538-018-0490-7}, pmid = {30194522}, issn = {1522-9602}, abstract = {A lot of insect families have physical structures created by evolution for coloration. These structures are a source of ideas for new bio-inspired materials. The aim of this study was to quantitatively characterize the micromorphology of butterfly wings scales using atomic force microscopy and multifractal analysis. Two types of butterflies, Euploea mulciber (&quot;striped blue crow&quot;) and Morpho didius (&quot;giant blue morpho&quot;), were studied. The three-dimensional (3D) surface texture of the butterfly wings scales was investigated focusing on two areas: where the perceived colors strongly depend on and where they do not depend on the viewing angle. The results highlight a correlation between the surface coloration and 3D surface microtexture of butterfly wings scales.}, }
@article {pmid30189245, year = {2018}, author = {Seppänen, MR}, title = {Novel cytoskeletal mutations with immunodeficiency: why is the raven like a writing desk?.}, journal = {The Journal of allergy and clinical immunology}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.jaci.2018.08.020}, pmid = {30189245}, issn = {1097-6825}, }
@article {pmid30151142, year = {2015}, author = {Tringali, A and Bowman, R and Husby, A}, title = {Selection and inheritance of sexually dimorphic juvenile plumage coloration.}, journal = {Ecology and evolution}, volume = {5}, number = {22}, pages = {5413-5422}, doi = {10.1002/ece3.1793}, pmid = {30151142}, issn = {2045-7758}, abstract = {Sexually dimorphic plumage coloration is widespread in birds and is generally thought to be a result of sexual selection for more ornamented males. Although many studies find an association between coloration and fitness related traits, few of these simultaneously examine selection and inheritance. Theory predicts that sex-linked genetic variation can facilitate the evolution of dimorphism, and some empirical work supports this, but we still know very little about the extent of sex linkage of sexually dimorphic traits. We used a longitudinal study on juvenile Florida scrub-jays (Aphelocoma coerulescens) to estimate strength of selection and autosomal and Z-linked heritability of mean brightness, UV chroma, and hue. Although plumage coloration signals dominance in juveniles, there was no indication that plumage coloration was related to whether or not an individual bred or its lifetime reproductive success. While mean brightness and UV chroma are moderately heritable, hue is not. There was no evidence for sex-linked inheritance of any trait with most of the variation explained by maternal effects. The genetic correlation between the sexes was high and not significantly different from unity. These results indicate that evolution of sexual dimorphism in this species is constrained by low sex-linked heritability and high intersexual genetic correlation.}, }
@article {pmid30141148, year = {2018}, author = {Aharoni, T and Goldbourt, A}, title = {Rapid automated determination of chemical shift anisotropy values in the carbonyl and carboxyl groups of fd-y21m bacteriophage using solid state NMR.}, journal = {Journal of biomolecular NMR}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10858-018-0206-1}, pmid = {30141148}, issn = {1573-5001}, support = {847/17//Israel Science Foundation/ ; }, abstract = {Determination of chemical shift anisotropy (CSA) in immobilized proteins and protein assemblies is one of several tools to determine protein dynamics on the timescales of microseconds and faster. The large CSA values of C=O groups in the rigid limit makes them in particular attractive for measurements of large amplitude motions, or their absence. In this study, we implement a 3D R-symmetry-based sequence that recouples the second spatial component of the 13C CSA with the corresponding isotropic 13C'-13C cross-peaks in order to probe backbone and sidechain dynamics in an intact fd-y21m filamentous phage viral capsid. The assignment of the isotropic cross-peaks and the analysis were conducted automatically using a new software named 'Raven'. The software can be utilized to auto-assign any 2D 13C-13C or 15N-13C spectrum given a previously-determined assignment table and generates simultaneously all intensity curves acquired in the third dimension. Here, all CSA spectra were automatically generated, and subsequently matched against a simulated set of CSA curves to yield their values. For the multi-copy, 50-residue-long protein capsid of fd-y21m, the backbone of the helical region is rigid, with reduced CSA values of ~ 12.5 kHz (~ 83 ppm). The N-terminus shows motionally-averaged CSA lineshapes and the carboxylic sidechain groups of four residues indicate large amplitude motions for D4, D5, D12 and E20. The current results further strengthen our previous studies of 15N CSA values and are in agreement with qualitative analysis of 13C-13C dipolar build-up curves, which were automatically obtained using our software. Our automated analysis technique is general and can be applied to study protein structure and dynamics, with data resulting from experiments that probe different variables such as relaxation rates and scaled anisotropic interactions.}, }
@article {pmid30137290, year = {2018}, author = {Jamborova, I and Janecko, N and Halova, D and Sedmik, J and Mezerova, K and Papousek, I and Kutilova, I and Dolejska, M and Cizek, A and Literak, I}, title = {Molecular characterization of plasmid-mediated AmpC beta-lactamase- and extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae among corvids (Corvus brachyrhynchos and Corvus corax) roosting in Canada.}, journal = {FEMS microbiology ecology}, volume = {}, number = {}, pages = {}, doi = {10.1093/femsec/fiy166}, pmid = {30137290}, issn = {1574-6941}, abstract = {This study evaluated the carriage of AmpC and extended-spectrum beta-lactamase (ESBL) genes and associated plasmids in faecal bacteria of Canadian corvids. Faecal samples from 449 birds in five roosting sites across Canada were analyzed using selective media, screening for AmpC and ESBL genes by PCR, and sequencing. Genomic relatedness was determined by PFGE and MLST. Plasmid mobility was studied by conjugation and transformation experiments, followed by plasmid typing. In total, 96 (21%, n = 449) cefotaxime-resistant Escherichia coli and three (0.7%) Klebsiella pneumoniae isolates were identified. ESBL genes blaCTX-M-1 (n = 3), blaCTX-M-14 (n = 2), blaCTX-M-32 (n = 2), and blaCTX-M-124 (n = 1) were detected in eight E. coli isolates, whereas blaSHV-2 (2) was found in two K. pneumoniae. E. coli isolates contained blaCMY-2 (n = 83) and blaCMY-42 (n = 1). The high genetic diversity of the isolates and presence of clinically important E. coli ST69 (n = 1), ST117 (n = 7), and ST131 (n = 1) was revealed. AmpC genes were predominantly carried by plasmids of incompatibility groups I1 (45 plasmids), A/C (10), and K (7). The plasmid IncI1/ST12 was most common and found in diverse E. coli STs in all sites. Highly diverse E. coli isolates containing AmpC and ESBL genes, including clinically important clones and emerging plasmids, are in circulation throughout Canadian wildlife.}, }
@article {pmid30132156, year = {2018}, author = {Hennefield, L and Hwang, HG and Weston, SJ and Povinelli, DJ}, title = {Meta-analytic techniques reveal that corvid causal reasoning in the Aesop's Fable paradigm is driven by trial-and-error learning.}, journal = {Animal cognition}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10071-018-1206-y}, pmid = {30132156}, issn = {1435-9456}, abstract = {The classic Aesop's fable, Crow and the Pitcher, has inspired a major line of research in comparative cognition. Over the past several years, five articles (over 32 experiments) have examined the ability of corvids (e.g., rooks, crows, and jays) to complete lab-based analogs of this fable, by requiring them to drop stones and other objects into tubes of water to retrieve a floating worm (Bird and Emery in Curr Biol 19:1-5, 2009b; Cheke et al. in Anim Cogn 14:441-455, 2011; Jelbert et al. in PLoS One 3:e92895, 2014; Logan et al. in PLoS One 7:e103049, 2014; Taylor et al. in Gray R D 12:e26887, 2011). These researchers have stressed the unique potential of this paradigm for understanding causal reasoning in corvids. Ghirlanda and Lind (Anim Behav 123:239-247, 2017) re-evaluated trial-level data from these studies and concluded that initial preferences for functional objects, combined with trial-and-error learning, may account for subjects' performance on key variants of the paradigm. In the present paper, we use meta-analytic techniques to provide more precise information about the rate and mode of learning that occurs within and across tasks. Within tasks, subjects learned from successful (but not unsuccessful) actions, indicating that higher-order reasoning about phenomena such as mass, volume, and displacement is unlikely to be involved. Furthermore, subjects did not transfer information learned in one task to subsequent tasks, suggesting that corvids do not engage with these tasks as variants of the same problem (i.e., how to generate water displacement to retrieve a floating worm). Our methodological analysis and empirical findings raise the question: Can Aesop's fable studies distinguish between trial-and-error learning and/or higher-order causal reasoning? We conclude they cannot.}, }
@article {pmid30131530, year = {2018}, author = {}, title = {Matchmaking clues for clever crows that are close to extinction.}, journal = {Nature}, volume = {560}, number = {7719}, pages = {413}, doi = {10.1038/d41586-018-05901-8}, pmid = {30131530}, issn = {1476-4687}, }
@article {pmid30129502, year = {2018}, author = {Hua, CL and Bardo, AR and Brown, JS}, title = {Mistrust in Physicians does not Explain Black-white Disparities in Primary Care and Emergency Department Utilization: The Importance of Socialization During the Jim Crow era.}, journal = {Journal of the National Medical Association}, volume = {}, number = {}, pages = {}, doi = {10.1016/j.jnma.2018.01.006}, pmid = {30129502}, issn = {0027-9684}, abstract = {PURPOSE: Compared to whites, blacks under-utilize primary care (PC) and over-utilize emergency department (ED) services. The aim of this study is to determine whether mistrust in physicians explains these black-white disparities, and the potentially modifying influence of socialization under racially segregated health care (i.e., raised in the U.S. South during the Jim Crow era).<br><br>METHODS: Data come from the nationally representative Americans' Changing Lives Study (n=1,578). Poisson regression techniques are utilized to respectively model PC and ED utilization among a sample of non-Hispanic black and white adults aged forty-years and older.<br><br>CONCLUSION: Mistrust in physicians does not explain black-white disparities in PC or ED utilization. Blacks under-utilize PC services compared to whites, net of predisposing, need, and enabling factors, but this is especially apparent among blacks who were raised in the U.S. south during the Jim Crow era and continue to reside in the South. Blacks greatly over-utilize ED services compared to whites, but this is greatest among those raised in the south during the Jim Crow era and/or those currently residing in the South.}, }
@article {pmid30127351, year = {2018}, author = {Mason, LD and Wardell-Johnson, G and Luxton, SJ and Bateman, PW}, title = {Predators Show Seasonal Predilections for Model Clay Spiders in an Urban Environment.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {12444}, doi = {10.1038/s41598-018-30778-y}, pmid = {30127351}, issn = {2045-2322}, abstract = {Predator-prey interactions may be altered under human-induced rapid environmental change, such as urbanisation. Extensive clearing in urban areas may leave short-range endemic species, such as mygalomorph spiders, more vulnerable to local extinction through predation in remaining remnants. Predation rates on Australian mygalomorph spiders were assessed using clay models of two size classes (5 cm, 3 cm), during two time periods in 2016 (January-February, July-August). Size and phenology of models resembled the mygalomorph genera Aname and Teyl occurring in these local urban remnants. Local predator guilds were significantly influenced by leaf-litter cover (%) and proportion of surrounding parkland. Preference for spider vs. control models was consistent across all predator types (bird, rodent, lizard and wasp), but specialist spider wasps (Pompilidae) only attacked spider models. Generalist predators (birds, lizards and rodents) were more opportunistic. Lizards and rodents exhibit similar predation behaviour, indicating there may be some inter-specific competition. Invasive generalists (e. g. rodents) or urban adapters (e. g. corvids) are more likely to represent an increased threat to spiders than are co-evolved specialists (e.g. spider wasps).}, }
@article {pmid30092679, year = {2018}, author = {Esquinas, AM and Karim, HMR and Soo Hoo, GW}, title = {Insight to the growing utilizations of high flow nasal oxygen therapy over non-invasive ventilation in community teaching hospital: alternative or complementary?In response to: Mihaela S. Stefan, Patrick Eckert, Bogdan Tiru, Jennifer Friderici, Peter K. Lindenauer &amp; Jay S. Steingrub (2018) High flow nasal oxygen therapy utilization: 7-year experience at a community teaching hospital, Hospital Practice, 46:2, 73-76, DOI: 10.1080/21548331.2018.1438739.}, journal = {Hospital practice (1995)}, volume = {}, number = {}, pages = {1-2}, doi = {10.1080/21548331.2018.1510283}, pmid = {30092679}, issn = {2154-8331}, }
@article {pmid30117157, year = {2018}, author = {Larsabal, M and Cogrel, O and Caumont, C and Jegou, MH and Taïeb, A and Morice-Picard, F}, title = {Mosaic mutations in FGFR3 and FGFR2 are associated with naevoid acanthosis nigricans or RAVEN (round and velvety epidermal naevus).}, journal = {The British journal of dermatology}, volume = {}, number = {}, pages = {}, doi = {10.1111/bjd.17095}, pmid = {30117157}, issn = {1365-2133}, abstract = {Naevoid acanthosis nigricans (AN) or RAVEN (Rounded and Velvety Epidermal Naevus) is a rare entity that manifests at any age at or before puberty and is characterised by hyperchromic, well-demarcated and linear lesion with velvety texture. We describe RAVEN in two unrelated patients and performed sequencing in affected skin tissue from both patients. We identified, a postzygotic FGFR2 p.Ser252Trp (c.755C>G) mutation in patient 1 and a postzygotic FGFR3 p.Arg252Asn (c.755G>A) mutation in patient 2. This is the first report of postzygotic FGFR3 and FGFR2 mutations in RAVEN thus it is a mosaic skin condition associated with receptor tyrosine kinase mutations. Laser CO2 seems to be a successful option for the treatment of naevoid AN. This article is protected by copyright. All rights reserved.}, }
@article {pmid30111659, year = {2018}, author = {Steyaert, SMJG and Frank, SC and Puliti, S and Badia, R and Arnberg, MP and Beardsley, J and Økelsrud, A and Blaalid, R}, title = {Special delivery: scavengers direct seed dispersal towards ungulate carcasses.}, journal = {Biology letters}, volume = {14}, number = {8}, pages = {}, doi = {10.1098/rsbl.2018.0388}, pmid = {30111659}, issn = {1744-957X}, abstract = {Cadaver decomposition islands around animal carcasses can facilitate establishment of various plant life. Facultative scavengers have great potential for endozoochory, and often aggregate around carcasses. Hence, they may disperse plant seeds that they ingest across the landscape towards cadaver decomposition islands. Here, we demonstrate this novel mechanism along a gradient of wild tundra reindeer carcasses. First, we show that the spatial distribution of scavenger faeces (birds and foxes) was concentrated around carcasses. Second, faeces of the predominant scavengers (corvids) commonly contained viable seeds of crowberry, a keystone species of the alpine tundra with predominantly vegetative reproduction. We suggest that cadaver decomposition islands function as endpoints for directed endozoochory by scavengers. Such a mechanism could be especially beneficial for species that rely on small-scale disturbances in soil and vegetation, such as several Nordic berry-producing species with cryptic generative reproduction.}, }
@article {pmid30110762, year = {2018}, author = {Saakian, DB and Cheong, KH and Koh, JM}, title = {Solution of the Crow-Kimura model with changing population size and Allee effect.}, journal = {Physical review. E}, volume = {98}, number = {1-1}, pages = {012405}, doi = {10.1103/PhysRevE.98.012405}, pmid = {30110762}, issn = {2470-0053}, abstract = {The Crow-Kimura model is commonly used in the modeling of genetic evolution in the presence of mutations and associated selection pressures. We consider a modified version of the Crow-Kimura model, in which population sizes are not fixed and Allee saturation effects are present. We demonstrate the evolutionary dynamics in this system through an analytical approach, examining both symmetric and single-peak fitness landscape cases. Especially interesting are the dynamics of the populations near extinction. A special version of the model with saturation and degradation on the single-peak fitness landscape is investigated as a candidate of the Allee effect in evolution, revealing reduction tendencies of excessively large populations, and extinction tendencies for small populations. The analytical solutions for these dynamics are presented with accuracy O(1/N), where N is the number of nucleotides in the genome.}, }
@article {pmid30105075, year = {2018}, author = {Morales, D and Ramirez, G and Herrera-Arellano, A and Tortoriello, J and Zavala, M and Zamilpa, A}, title = {Identification of Digestive Enzyme Inhibitors from Ludwigia octovalvis (Jacq.) P.H.Raven.}, journal = {Evidence-based complementary and alternative medicine : eCAM}, volume = {2018}, number = {}, pages = {8781352}, doi = {10.1155/2018/8781352}, pmid = {30105075}, issn = {1741-427X}, abstract = {Current antiobesity and antidiabetic tools have been insufficient to curb these diseases and frequently cause side effects; therefore, new pancreatic lipase and α-glucosidase inhibitors could be excellent aids for the prevention and treatment of these diseases. The aim of this study was to identify, quantify, and characterize the chemical compounds with the highest degree of inhibitory activity of these enzymes, contained in a Ludwigia octovalvis hydroalcoholic extract. Chemical purification was performed by liquid-liquid separation and column chromatography. Inhibitory activities were measured in vitro, employing acarbose, orlistat, and a Camellia sinensis hydroalcoholic extract as references. For structural elucidation, Nuclear Magnetic Resonance was carried out, and High Performance Liquid Chromatography was used to quantify the compounds. For α-glucosidases, L. octovalvis hydroalcoholic extract and its ethyl acetate fraction showed half-maximal Inhibitory Concentration (IC50) values of 700 and 250 μg/mL, for lipase, 480 and 718 μg/mL, while C. sinensis showed 260 and 587 μg/mL. The most active compounds were identified as ethyl gallate (1, IC50 832 μM) and gallic acid (2, IC50 969 μM); both displayed competitive inhibition of α-glucosidases and isoorientin (3, IC50 201 μM), which displayed uncompetitive inhibition of lipase. These data could be useful in the development of a novel phytopharmaceutical drug.}, }
@article {pmid30104433, year = {2018}, author = {Ashton, BJ and Thornton, A and Ridley, AR}, title = {An intraspecific appraisal of the social intelligence hypothesis.}, journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences}, volume = {373}, number = {1756}, pages = {}, doi = {10.1098/rstb.2017.0288}, pmid = {30104433}, issn = {1471-2970}, abstract = {The prevailing hypotheses for the evolution of cognition focus on either the demands associated with group living (the social intelligence hypothesis (SIH)) or ecological challenges such as finding food. Comparative studies testing these hypotheses have generated highly conflicting results; consequently, our understanding of the drivers of cognitive evolution remains limited. To understand how selection shapes cognition, research must incorporate an intraspecific approach, focusing on the causes and consequences of individual variation in cognition. Here, we review the findings of recent intraspecific cognitive research to investigate the predictions of the SIH. Extensive evidence from our own research on Australian magpies (Cracticus tibicen dorsalis), and a number of other taxa, suggests that individuals in larger social groups exhibit elevated cognitive performance and, in some cases, elevated reproductive fitness. Not only do these findings demonstrate how the social environment has the potential to shape cognitive evolution, but crucially, they demonstrate the importance of considering both genetic and developmental factors when attempting to explain the causes of cognitive variation.This article is part of the theme issue 'Causes and consequences of individual differences in cognitive abilities'.}, }
@article {pmid30094362, year = {2018}, author = {Hunter, MA and Lieberman, G and Coffman, BA and Trumbo, MC and Armenta, ML and Robinson, CSH and Bezdek, MA and O'Sickey, AJ and Jones, AP and Romero, V and Elkin-Frankston, S and Gaurino, S and Eusebi, L and Schumacher, EH and Witkiewitz, K and Clark, VP}, title = {Mindfulness-based training with transcranial direct current stimulation modulates neuronal resource allocation in working memory: A randomized pilot study with a nonequivalent control group.}, journal = {Heliyon}, volume = {4}, number = {7}, pages = {e00685}, doi = {10.1016/j.heliyon.2018.e00685}, pmid = {30094362}, issn = {2405-8440}, abstract = {Mindfulness-based training (MBT) and transcranial electrical stimulation (TES) methods such as direct current stimulation (tDCS) have demonstrated promise for the augmentation of cognitive abilities. The current study investigated the potential compatibility of concurrent &quot;electrical&quot; MBT and tDCS (or eMBT) by testing its combined effects on behavioral and neurophysiological indices of working memory (WM) and attentional resource allocation. Thirty-four healthy participants were randomly assigned to either a MBT task with tDCS group (eMBT) or an active control training task with sham tDCS (Control) group. Training lasted 4-weeks, with up to twenty MBT sessions and with up to eight of those sessions that were eMBT sessions. Electroencephalography was acquired during varying WM load conditions using the n-back task (1-, 2-, 3-back), along with performance on complex WM span tasks (operation and symmetry span) and fluid intelligence measures (Ravens and Shipley) before and after training. Improved performance was observed only on the 3-back and spatial span tasks for eMBT but not the Control group. During 3-back performance in the eMBT group, an increase in P3 amplitude and theta power at electrode site Pz was also observed, along with a simultaneous decrease in frontal midline P3 amplitude and theta power compared to the Control group. These results are consistent with the neural efficiency hypothesis, where higher cognitive capacity was associated with more distributed brain activity (i.e., increase in parietal and decrease in frontal amplitudes). Future longitudinal studies are called upon to further examine the direct contributions of tDCS on MBT by assessing the differential effects of electrode montage, polarity, current strength and a direct contrast between the eMBT and MBT conditions on performance and neuroimaging outcome data. While preliminary, the current results provided evidence for the potential compatibility of using eMBT to modulate WM capacity through the allocation of attention and its neurophysiological correlates.}, }
@article {pmid30088462, year = {2018}, author = {de Freitas Keppeke, L and Schoen, TH}, title = {Perceptual-Motor Maturity in Adolescence and the Tanner Stages: A Study with Bender-Gradual Scoring System.}, journal = {The Spanish journal of psychology}, volume = {21}, number = {}, pages = {E33}, doi = {10.1017/sjp.2018.33}, pmid = {30088462}, issn = {1988-2904}, abstract = {Visual-motor skill forms an important psycho diagnostic component and is associated with psycho-neurological aspects. The Bender Visual-Motor Gestalt Test, widely used for the evaluation of this area, is meant for children up to 11 years. In adolescence, the changes associated with puberty generate nonlinear anthropometric development resulting in mild and temporary incoordination. This study investigated the relation between visual-motor development measured by the Bender test and pubertal changes according to the Tanner scale. In all 134 adolescents of both sexes, aged from 10 to 15, who kept routine medical appointments, participated. We used the Bender Visual-Motor Gestalt Test, Raven's Progressive Matrices Test, and medical chart data. The techniques were applied individually. Pubertal changes were associated with the Bender test results showing higher scores at the G3 stage, the period corresponding to a growth spurt, compared to the G5 stage (p = .007, ES = .187), the post-growth spurt period in boys. Age and gender did not influence the Bender test scores. According to the Raven test, the g intelligence factor, interfered significantly in the visual-motor performance (r = -57%, p < .001). Schooling, repetition of a school year, and developmental problems (p = .002, ES = .156; p = .002, ES = .623; p < .001, ES = .880, respectively) obtained similar results. The Bender Test was sensitive to schooling and maturational problems during adolescence. There was an association between visual-motor development and sexual maturity in male adolescents. Our results indicate the usefulness of the Bender Test at older ages than those used in the test standardization.}, }
@article {pmid30083996, year = {2018}, author = {Malik, A and Dharaiya, N and Espín, S}, title = {Is current information on organochlorine exposure sufficient to conserve birds in India?.}, journal = {Ecotoxicology (London, England)}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10646-018-1969-6}, pmid = {30083996}, issn = {1573-3017}, support = {20828-1//Rufford Foundation/ ; }, abstract = {Organochlorine compounds (OCs) pose a serious threat towards the wildlife due to their well-known adverse effects. India is the second largest producer of pesticides in Asia, with DDT production still ongoing, and is ranked amongst the leading countries of pesticide consumption. However, a significant data gap in avian biomonitoring studies has been identified in Asia. The objective of this review is to compile and discuss the available literature on concentrations of organochlorine pesticides and PCBs in Indian birds. The review of 18 articles showed that DDTs were the OCs most frequently analysed, followed by HCHs and PCBs (highest hepatic mean values: 11.6, 1.8 and 1.03 µg/g ww, respectively). The most frequently analysed matrix was whole body homogenates, followed by internal tissues. Plasma, eggs, feathers and guano were poorly sampled. The range of sampling years was 1980-2007. In general, hepatic OC concentrations were below the level known to cause adverse effects, although p,p'-DDE in eggs was found in concentrations associated with eggshell thinning. Most of the studies were carried out in Southern India (Tamil Nadu). Out of 106 species studied, house crow (Corvus splendens) was the most frequently monitored. However, the number of individuals sampled per species is generally low and different sample types are used, thus, huge limitations to compare OC exposure exist. This review shows that there is a clear deficit of data on OC concentrations and sublethal effects that needs to be addressed to understand the status of OC exposure, spatio-temporal trends and potential impacts in Indian avifauna.}, }
@article {pmid30082401, year = {2018}, author = {Iknayan, KJ and Beissinger, SR}, title = {Collapse of a desert bird community over the past century driven by climate change.}, journal = {Proceedings of the National Academy of Sciences of the United States of America}, volume = {}, number = {}, pages = {}, doi = {10.1073/pnas.1805123115}, pmid = {30082401}, issn = {1091-6490}, abstract = {Climate change has caused deserts, already defined by climatic extremes, to warm and dry more rapidly than other ecoregions in the contiguous United States over the last 50 years. Desert birds persist near the edge of their physiological limits, and climate change could cause lethal dehydration and hyperthermia, leading to decline or extirpation of some species. We evaluated how desert birds have responded to climate and habitat change by resurveying historic sites throughout the Mojave Desert that were originally surveyed for avian diversity during the early 20th century by Joseph Grinnell and colleagues. We found strong evidence of an avian community in collapse. Sites lost on average 43% of their species, and occupancy probability declined significantly for 39 of 135 breeding birds. The common raven was the only native species to substantially increase across survey sites. Climate change, particularly decline in precipitation, was the most important driver of site-level persistence, while habitat change had a secondary influence. Habitat preference and diet were the two most important species traits associated with occupancy change. The presence of surface water reduced the loss of site-level richness, creating refugia. The collapse of the avian community over the past century may indicate a larger imbalance in the Mojave and provide an early warning of future ecosystem disintegration, given climate models unanimously predict an increasingly dry and hot future.}, }
@article {pmid30072877, year = {2018}, author = {Ditz, HM and Kupferman, JK and Nieder, A}, title = {Neurons in the Hippocampus of Crows Lack Responses to Non-spatial Abstract Categories.}, journal = {Frontiers in systems neuroscience}, volume = {12}, number = {}, pages = {33}, doi = {10.3389/fnsys.2018.00033}, pmid = {30072877}, issn = {1662-5137}, abstract = {Lesion studies suggest a role of the avian hippocampus in spatial and episodic memory. However, whether the avian hippocampus is also involved in processing categorical information and non-spatial working memory contents remains unknown. To address this question, we trained two crows in a delayed-match-to-sample test to assess and briefly memorize the number of items in dot displays, i.e., their numerosity. We recorded neuronal activity in hippocampus while crows solved this task. Hardly any hippocampal neurons responded to the category 'numerosity,' during neither sample presentation, nor during the memory delay. This was in striking contrast to previous recordings in the telencephalic association area 'nidopallium caudolaterale' (NCL) of the same crows, in which we previously reported an abundance of numerosity-selective and working memory-selective neurons. Our data suggest that categorical information is not processed in the avian hippocampus.}, }
@article {pmid30071975, year = {2018}, author = {Campo, JV and Bridge, JA}, title = {Exploring the Impact of 13 Reasons Why: Looking for Light Amidst the Heat . . .}, journal = {Journal of the American Academy of Child and Adolescent Psychiatry}, volume = {57}, number = {8}, pages = {547-549}, doi = {10.1016/j.jaac.2018.05.012}, pmid = {30071975}, issn = {1527-5418}, abstract = {A Letter to the Editor by Kieling and collegues1 in this month's Journal attempts to explore the impact of the Netflix series 13 Reasons Why (13RW) on the thinking and behavior of adolescent viewers. The series is an adaptation of a 2007 novel by Jay Asher, and tells the story of an adolescent girl who dies by suicide following a series of traumas and disappointments that she catalogues before her death on 13 audiotapes. The tapes are left behind with the expectation that each of the individuals presumably responsible for her suicide will listen and better understand their individual and collective failures. Since its release and airing in 2017, the show has generated considerable heated debate and controversy, largely due to concerns about its potential for suicide contagion.}, }
@article {pmid30071683, year = {2018}, author = {Sutton, JT and Helmkampf, M and Steiner, CC and Bellinger, MR and Korlach, J and Hall, R and Baybayan, P and Muehling, J and Gu, J and Kingan, S and Masuda, BM and Ryder, OA}, title = {A High-Quality, Long-Read De Novo Genome Assembly to Aid Conservation of Hawaii's Last Remaining Crow Species.}, journal = {Genes}, volume = {9}, number = {8}, pages = {}, doi = {10.3390/genes9080393}, pmid = {30071683}, issn = {2073-4425}, abstract = {Abstract: Genome-level data can provide researchers with unprecedented precision to examine the causes and genetic consequences of population declines, which can inform conservation management. Here, we present a high-quality, long-read, de novo genome assembly for one of the world's most endangered bird species, the 'Alalā (Corvus hawaiiensis; Hawaiian crow). As the only remaining native crow species in Hawai'i, the 'Alalā survived solely in a captive-breeding program from 2002 until 2016, at which point a long-term reintroduction program was initiated. The high-quality genome assembly was generated to lay the foundation for both comparative genomics studies and the development of population-level genomic tools that will aid conservation and recovery efforts. We illustrate how the quality of this assembly places it amongst the very best avian genomes assembled to date, comparable to intensively studied model systems. We describe the genome architecture in terms of repetitive elements and runs of homozygosity, and we show that compared with more outbred species, the 'Alalā genome is substantially more homozygous. We also provide annotations for a subset of immunity genes that are likely to be important in conservation management, and we discuss how this genome is currently being used as a roadmap for downstream conservation applications.}, }
@article {pmid30065105, year = {2018}, author = {Faria, JP and Rocha, M and Rocha, I and Henry, CS}, title = {Methods for automated genome-scale metabolic model reconstruction.}, journal = {Biochemical Society transactions}, volume = {}, number = {}, pages = {}, doi = {10.1042/BST20170246}, pmid = {30065105}, issn = {1470-8752}, abstract = {In the era of next-generation sequencing and ubiquitous assembly and binning of metagenomes, new putative genome sequences are being produced from isolate and microbiome samples at ever-increasing rates. Genome-scale metabolic models have enormous utility for supporting the analysis and predictive characterization of these genomes based on sequence data. As a result, tools for rapid automated reconstruction of metabolic models are becoming critically important for supporting the analysis of new genome sequences. Many tools and algorithms have now emerged to support rapid model reconstruction and analysis. Here, we are comparing and contrasting the capabilities and output of a variety of these tools, including ModelSEED, Raven Toolbox, PathwayTools, SuBliMinal Toolbox and merlin.}, }
@article {pmid30060541, year = {2018}, author = {Ruiz-Rodríguez, M and Martín-Vivaldi, M and Martínez-Bueno, M and Soler, JJ}, title = {Gut Microbiota of Great Spotted Cuckoo Nestlings is a Mixture of Those of Their Foster Magpie Siblings and of Cuckoo Adults.}, journal = {Genes}, volume = {9}, number = {8}, pages = {}, doi = {10.3390/genes9080381}, pmid = {30060541}, issn = {2073-4425}, abstract = {Diet and host genetic or evolutionary history are considered the two main factors determining gut microbiota of animals, although studies are scarce in natural populations. The system of great spotted cuckoos (Clamatorglandarius) parasitizing magpies (Pica pica) is ideal to study both effects since magpie adults feed cuckoo and magpie nestlings with the same diet and, consequently, differences in gut microbiota of nestlings of these two species will mainly reflect the importance of genetic components. Moreover, the diet of adults and of nestling cuckoos drastically differ from each other and, thus, differences and similarities in their microbiotas would respectively reflect the effect of environmental and genetic factors. We used next-generation sequencing technologies to analyze the gut microbiota of cuckoo adults and nestlings and of magpie nestlings. The highest α-diversity estimates appeared in nestling cuckoos and the lowest in nestling magpies. Moreover, despite the greatest differences in the microbiome composition of magpies and cuckoos of both ages, cuckoo nestlings harbored a mixture of the Operational Taxonomic Units (OTUs) present in adult cuckoos and nestling magpies. We identified the bacterial taxa responsible for such results. These results suggest important phylogenetic components determining gut microbiome of nestlings, and that diet might be responsible for similarities between gut microbiome of cuckoo and magpie nestlings that allow cuckoos to digest food provided by magpie adults.}, }
@article {pmid30042634, year = {2018}, author = {Yurtoğulları, Ş and Taşkapılıoğlu, Ö and Öztürk, B and Bilgiç, B and Hakyemez, B and Türkeş, N and Gelişken, Ö and Turan, ÖF and Bakar, M}, title = {Comparison of Brain Atrophy, Cognition and Optical Coherence Tomography Results Between Multiple Sclerosis Patients and Healthy Controls.}, journal = {Noro psikiyatri arsivi}, volume = {55}, number = {1}, pages = {3-8}, doi = {10.29399/npa.12534}, pmid = {30042634}, issn = {1300-0667}, abstract = {Introduction: Cognitive impairment is also an important cause of disability in MS in addition to motor, sensory, visual, and cerebellar affections. The aim of this study is to show the relation between the cognitive disability in MS with brain atrophy and retinal nerve fiber layer (RNFL).<br><br>Methods: Forty-three multiple sclerosis (MS) patients, and 15 healthy individuals as controls were included in the study. MS patients were divided into three groups as relapsing-remitting MS (RRMS), relapsing-remitting with optic neuritis (RRMS+ON), and secondary-progressive MS (SPMS). An experienced psychologist performed modified Wechsler Memory Scale Revised form (WMS-R), Lines Orientation test, Stroop Color Word Interference test (STROOP), Standard Raven Progressive Matrices (SRPM), Benton Facial Recognition Test, verbal fluency test, and Paced Auditory Serial Addition tests in all cases. Optic coherence tomographies (OCT) were done. Cranial subcortical volumes of all subjects were measured using 3-dimensonal T1A imagines obtained by the cranial subcortical 1.5 tesla MR device (fully automatic Freesurfer program). Brain parenchymal fractions were calculated by proportioning the obtained volume measurements to the total intracranial volume.<br><br>Results: Fifty-eight subjects (65.5% female, 34.5% male) were enrolled in the study. There were significant differences among the groups in terms of parenchymal thickness, volumes of third ventricle, and white matter. There was a significant correlation between the volumes of the deep gray matter, mesial temporal structures and lateral ventricular volumes, and the test results of the WMS-R. OCT scores of all MS patients, whether or not they experienced optic neuritis, had increased, being worse especially in the SPMS group. Correlation between RNFL and the brain parenchymal fractions of the patients were statistically significant.<br><br>Conclusion: Manual methods instead of automatic segmentation method are being more commonly used in the studies with brain atrophy and MS in our country. A significant correlation between OCT scores and brain atrophy is shown with our present study, and this is followed as a reflection of decrease in cognitive tests that provides valuable and reliable knowledge for the literature.}, }
@article {pmid30030729, year = {2018}, author = {Blume, CA and Machado, BM and da Rosa, RR and Rigoni, MDS and Casagrande, DS and Mottin, CC and Schaan, BD}, title = {Association of Maternal Roux-en-Y Gastric Bypass with Obstetric Outcomes and Fluid Intelligence in Offspring.}, journal = {Obesity surgery}, volume = {}, number = {}, pages = {}, doi = {10.1007/s11695-018-3407-5}, pmid = {30030729}, issn = {1708-0428}, abstract = {PURPOSE: The purpose of the study is to assess whether Roux-en-Y gastric bypass (RYGB) prior to pregnancy is associated with fluid intelligence in offspring. Additionally, perinatal and obstetric outcomes, and children nutritional status were evaluated.<br><br>MATERIAL AND METHODS: Singleton births of women who underwent RYGB between 2000 and 2010 (BS) were matched to two control births by maternal age, delivery year, and gender. Control group 1 (CG1) and control group 2 (CG2) included women with a pre-pregnancy body mass index (BMI) < 35 kg/m2 and ≥ 35 kg/m2, respectively, who had never undergone bariatric surgery.<br><br>RESULTS: Thirty-two children from each group (n = 96) were analyzed, mostly female (59%) and Caucasian (82%), with a mean age of 7 ± 2 years. Their general intelligence scores were similar after adjusting for sociodemographic confounders; family economic class was the strongest predictor (low: β = - 20.57; p < 0.001; middle: β = - 9.34; p = 0.019). Gestational diabetes mellitus (OR 0.06; 95% CI 0.03; 0.35) and hypertensive disorders (OR 0.09; 95% CI 0.01; 0.40) were less frequent in BS than CG2. Post-RYGB pregnancies were associated with lower birth weight (P = 0.021) than controls. Child overweight and obesity was higher (OR 4.59; 95% CI 1.55; 13.61; p = 0.006) in CG2 (78%) than CG1 (44%) and similar to BS (65%).<br><br>CONCLUSIONS: RYGB prior to pregnancy was not associated with fluid intelligence in offspring. Prior RYGB was associated with a lower frequency of gestational diabetes mellitus and hypertensive disorders than in women with a pre-pregnancy BMI ≥ 35 kg/m2, as well as with lower birth weight than both control groups.}, }
@article {pmid30017081, year = {2018}, author = {Abdoli, A and Arbabi, M and Pirestani, M and Mirzaghavami, M and Ghaffarifar, F and Dalimi, A and Sadraei, J}, title = {Molecular assessment of Neospora caninum and Toxoplasma gondii in hooded crows (Corvus cornix) in Tehran, Iran.}, journal = {Comparative immunology, microbiology and infectious diseases}, volume = {57}, number = {}, pages = {69-73}, doi = {10.1016/j.cimid.2018.06.008}, pmid = {30017081}, issn = {1878-1667}, abstract = {Neospora caninum and Toxoplasma gondii are two closely related protozoan parasites that have been detected from various species of bird hosts. However, little is known about the prevalence of N. caninum and T. gondii in crows. Hence, we examined the molecular frequency of N. caninum and T. gondii in the brain samples of hooded crows (Corvus cornix) that collected from different public parks of Tehran, Iran by nested-PCR method. We used the primers targeting the Nc5 and GRA6 genes for detection of N. caninum and T. gondii, respectively. From a total of 55 brain samples, 5 (9.9%) and 9 (16.36%) samples were positive for N. caninum and T. gondii, respectively. Sequencing of a N. caninum isolate revealed 95%-100% identity with the deposited N. caninum in GenBank. Genotyping of T. gondii isolates by PCR-RFLP analysis of the GRA6 gene revealed type III genotype in 8 isolates. The results of this study indicate that hooded crows may have a putative role in transmission of N. caninum and T. gondii to canines and felines definitive hosts, respectively.}, }
@article {pmid30013855, year = {2018}, author = {Silina, AV}, title = {Sex change in scallop Patinopecten yessoensis: response to population composition?.}, journal = {PeerJ}, volume = {6}, number = {}, pages = {e5240}, doi = {10.7717/peerj.5240}, pmid = {30013855}, issn = {2167-8359}, abstract = {Sex structure is very labile between populations and specific for each population because it is a result of genetic, ontogenetic and biocenotic influences on the mollusks. In this study, the age frequency distribution, age-sex structure, and sex ratio were assessed in the wild populations of the Yeso scallop Patinopecten yessoensis (Jay) observed at fifteen sites in the northwestern Sea of Japan (=East Sea). The sex ratio varied between the populations from 0.83:1 to 1.52:1 (males/females), with the mean sex ratio being 1.03 ± 0.05:1. Within a population, the proportions of males and females in term of number differed between age classes. Males were more numerous than females in the younger age classes, and females prevailed over males in the older age classes. It was found that in different scallop populations the sex change occurred at different ages. In the populations that predominantly consisted of young (two- to four-year-old) individuals, males prevailed over females in the age class 2 yr.; the equal male/female proportion was found in the age class 3 yr.; and in older age classes, females prevailed over males. Another pattern was observed in the populations that consisted mainly of middle-aged (five- to six-year-old) individuals. Here, the age-sex ratio became equal at an age of 4-6 years. In the old populations (mainly 6-12-year-olds) the equal male/female proportion was observed at an age of 8-10 years. Thus, the age of sex change was not uniform for the scallop populations. It depended on the age structure of the population and, thus, was socially controlled. The greater number of females in the older age classes suggests a protandric sex change.}, }
@article {pmid30012749, year = {2018}, author = {Gonçalves, A and Biro, D}, title = {Comparative thanatology, an integrative approach: exploring sensory/cognitive aspects of death recognition in vertebrates and invertebrates.}, journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences}, volume = {373}, number = {1754}, pages = {}, doi = {10.1098/rstb.2017.0263}, pmid = {30012749}, issn = {1471-2970}, abstract = {Evolutionary thanatology benefits from broad taxonomic comparisons of non-human animals' responses to death. Furthermore, exploring the sensory and cognitive bases of these responses promises to allow classification of the underlying mechanisms on a spectrum from phylogenetically ancient to more derived traits. We draw on studies of perception and cognition in invertebrate and vertebrate taxa (with a focus on arthropods, corvids, proboscids, cetaceans and primates) to explore the cues that these animals use to detect life and death in others, and discuss proximate and ultimate drivers behind their capacities to do so. Parallels in thanatological behaviour exhibited by the last four taxa suggest similar sensory-cognitive processing rules for dealing with corpses, the evolution of which may have been driven by complex social environments. Uniting these responses is a phenomenon we term 'animacy detection malfunction', whereupon the corpse, having both animate and inanimate attributes, creates states of fear/curiosity manifested as approach/avoidance behaviours in observers. We suggest that integrating diverse lines of evidence (including the 'uncanny valley' effect originating from the field of robotics) provides a promising way to advance the field, and conclude by proposing avenues for future research.This article is part of the theme issue 'Evolutionary thanatology: impacts of the dead on the living in humans and other animals'.}, }
@article {pmid30012745, year = {2018}, author = {Swift, K and Marzluff, JM}, title = {Occurrence and variability of tactile interactions between wild American crows and dead conspecifics.}, journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences}, volume = {373}, number = {1754}, pages = {}, doi = {10.1098/rstb.2017.0259}, pmid = {30012745}, issn = {1471-2970}, abstract = {Observations of some mammals and birds touching their dead provoke questions about the motivation and adaptive value of this potentially risky behaviour. Here, we use controlled experiments to determine if tactile interactions are characteristic of wild American crow responses to dead crows, and what the prevalence and nature of tactile interactions suggests about their motivations. In Experiment 1, we test if food or information acquisition motivates contact by presenting crows with taxidermy-prepared dead crows, and two species crows are known to scavenge: dead pigeons and dead squirrels. In Experiment 2, we test if territoriality motivates tactile interactions by presenting crows with taxidermy crows prepared to look either dead or upright and life-like. In Experiment 1, we find that crows are significantly less likely to make contact but more likely to alarm call and recruit other birds in response to dead crows than to dead pigeons and squirrels. In addition, we find that aggressive and sexual encounters with dead crows are seasonally biased. These findings are inconsistent with feeding or information acquisition-based motivation. In Experiment 2, we find that crows rarely dive-bomb and more often alarm call and recruit other crows to dead than to life-like crows, behaviours inconsistent with responses given to live intruders. Consistent with a danger response hypothesis, our results show that alarm calling and neighbour recruitment occur more frequently in response to dead crows than other stimuli, and that touching dead crows is atypical. Occasional contacts, which take a variety of aggressive and sexual forms, may result from an inability to mediate conflicting stimuli.This article is part of the theme issue 'Evolutionary thanatology: impacts of the dead on the living in humans and other animals'.}, }
@article {pmid30008787, year = {2018}, author = {Reid, SNS and Ryu, JK and Kim, Y and Jeon, BH}, title = {The Effects of Fermented Laminaria japonica on Short-Term Working Memory and Physical Fitness in the Elderly.}, journal = {Evidence-based complementary and alternative medicine : eCAM}, volume = {2018}, number = {}, pages = {8109621}, doi = {10.1155/2018/8109621}, pmid = {30008787}, issn = {1741-427X}, abstract = {Considering the neuroprotective and antioxidant potential of fermented Laminaria japonica A. (FST), the purpose of the present study is to establish whether FST may be considered a viable, efficacious supplement that can be administered in later life to offset neurodegenerative conditions associated with aging. Forty senior subjects participated in a randomized, double-blind, and placebo-controlled study. Two groups were formed, one FST group (n = 32, 72.35 ± 5.54 yrs) and one placebo (CON) (n = 28, 74.57 ± 5.69 yrs), which received 1.5 g/day of FST for 6 weeks. Subjects were asked to abstain from any regular exercise. In order to analyze short-term memory, a variety of neuropsychological tests were implemented. Body composition, physical fitness evaluations, antioxidant function, and inflammatory markers were also included in the analyses pre- and posttest. We demonstrated that FST significantly improved neuropsychological test scores, including higher scores in the K-MMSE, numerical memory test, Raven test, and iconic memory, compared to the CON group. Shorter test trial times in the 6-minute walk test were observed in the FST group (p<0.001 and p<0.05, trials 1 and 2, respectively). FST also significantly increased antioxidant activity of GPx, GSR, and SOD, reduced the production of TBARS, and lowered 8-oxoDG levels. The present study highlights the potential widespread application of FST in protecting against the degenerative effects of aging on short-term memory and physical function. Neuropsychological evaluation indicates that FST may provide a protective mechanism against cognitive impairment associated with dementia. Neuromuscular integrity and physical function are typically compromised in aging and dementia patients; thus, whether by stimulation of muscle-related growth factors or an increase in serum BDNF, FST supplementation may act to preserve physical function in the elderly. The bioactive constituents of FST such as GABA and fucoidan acting to provide improvements in antioxidant activity following FST supplementation may protect against progressive degeneration purportedly caused by reactive oxygen species.}, }
@article {pmid30008510, year = {2018}, author = {Isaksson, E and Utku Urhan, A and Brodin, A}, title = {High level of self-control ability in a small passerine bird.}, journal = {Behavioral ecology and sociobiology}, volume = {72}, number = {7}, pages = {118}, doi = {10.1007/s00265-018-2529-z}, pmid = {30008510}, issn = {0340-5443}, abstract = {Abstract: Cognitively advanced animals are usually assumed to possess better self-control, or ability to decline immediate rewards in favour of delayed ones, than less cognitively advanced animals. It has been claimed that the best predictor of high such ability is absolute brain volume meaning that large-brained animals should perform better than small-brained ones. We tested self-control ability in the great tit, a small passerine. In the common test of this ability, the animal is presented with a transparent cylinder that contains a piece of food. If the animal tries to take the reward through the transparent wall of the cylinder, this is considered an impulsive act and it fails the test. If it moves to an opening and takes the reward this way, it passes the test. The average performance of our great tits was 80%, higher than most animals that have been tested and almost in level with the performance in corvids and apes. This is remarkable considering that the brain volume of a great tit is 3% of that of a raven and 0.1% of that of a chimpanzee.<br><br>Significance statement: The transparent cylinder test is the most common way to test the ability of self-control in animals. If an animal understands that it only can take food in the cylinder from the cylinder's opening and controls its impulsivity, it passes the test. A high level of self-control has been demonstrated only in cognitively advanced animals such as apes and corvids. Here, we demonstrate that the great tit, a small song bird that is very good at learning, performs almost in level with chimpanzees and ravens in this test.}, }
@article {pmid30002396, year = {2018}, author = {Gómez-Olivencia, A and Sala, N and Núñez-Lahuerta, C and Sanchis, A and Arlegi, M and Rios-Garaizar, J}, title = {First data of Neandertal bird and carnivore exploitation in the Cantabrian Region (Axlor; Barandiaran excavations; Dima, Biscay, Northern Iberian Peninsula).}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {10551}, doi = {10.1038/s41598-018-28377-y}, pmid = {30002396}, issn = {2045-2322}, abstract = {Neandertals were top predators who basically relied on middle- to large-sized ungulates for dietary purposes, but there is growing evidence that supports their consumption of plants, leporids, tortoises, marine resources, carnivores and birds. The Iberian Peninsula has provided the most abundant record of bird exploitation for meat in Europe, starting in the Middle Pleistocene. However, the bird and carnivore exploitation record was hitherto limited to the Mediterranean area of the Iberian Peninsula. Here we present the first evidence of bird and carnivore exploitation by Neandertals in the Cantabrian region. We have found cut-marks in two golden eagles, one raven, one wolf and one lynx remain from the Mousterian levels of Axlor. The obtaining of meat was likely the primary purpose of the cut-marks on the golden eagle and lynx remains. Corvids, raptors, felids and canids in Axlor could have likely acted as commensals of the Neandertals, scavenging upon the carcasses left behind by these hunter-gatherers. This could have brought them closer to Neandertal groups who could have preyed upon them. These new results provide additional information on their dietary scope and indicate a more complex interaction between Neandertals and their environment.}, }
@article {pmid29992421, year = {2018}, author = {Smulders, TV}, title = {Smarter through group living?.}, journal = {Learning &amp; behavior}, volume = {}, number = {}, pages = {}, doi = {10.3758/s13420-018-0335-0}, pmid = {29992421}, issn = {1543-4508}, abstract = {Wild Australian magpies living (or growing up) in larger social groups take fewer trials to solve a battery of four cognitive tests than those living (or growing up) in smaller groups. The tests all draw on a common underlying factor, but is this factor cognitive or motivational?}, }
@article {pmid29991639, year = {2018}, author = {Valiente, R and Sureda, X and Bilal, U and Navas-Acien, A and Pearce, J and Franco, M and Escobar, F}, title = {Regulating the local availability of tobacco retailing in Madrid, Spain: a GIS study to evaluate compliance.}, journal = {Tobacco control}, volume = {}, number = {}, pages = {}, doi = {10.1136/tobaccocontrol-2018-054269}, pmid = {29991639}, issn = {1468-3318}, abstract = {BACKGROUND: In Spain, tobacco sales are limited to tobacco-exclusive stores and associated vending machines. A minimum of 150 m between stores is required, unless they exceed a legal sales threshold. Minimum distances to schools are recommended but not defined. We evaluated compliance with these regulations in Madrid, Spain.<br><br>METHODS: Information about tobacco-exclusive stores and their sales volume was obtained in 2014. We used geographic information system to identify stores closer than 150 m between them and examine whether they exceeded the sales threshold. We estimated distances between stores and schools, considering different distance intervals (<150 m, 150-300 m and >300 m) and calculations (crow flies and street network). We assessed the association of area-level demographic and socioeconomic characteristics with the distribution of tobacco stores.<br><br>RESULTS: 5.3% (34/638) of tobacco stores were within 150 m of each other. Among those, 76% (26/34) did not meet the regulation sales threshold. These stores were in areas with lower proportion of young population (<15 years) and higher proportion of people with university-level education. 75% (476/638) of stores were situated closer than 300 m to schools. No differences were identified in sociodemographic and economic characteristics by the store distance to schools.<br><br>CONCLUSION: Most tobacco stores are compliant with the regulations in Spain. However, these regulations are insufficient to reduce tobacco availability. More restrictive regulations are needed to limit the geographic distribution of tobacco retailers, and health criteria should also be considered in the current legislation. The evaluation of the Spanish regulatory model may provide useful insights for other jurisdictions looking to decrease the tobacco retail availability.}, }
@article {pmid29983311, year = {2018}, author = {Dickerson, KL and Ainge, JA and Seed, AM}, title = {The Role of Association in Pre-schoolers' Solutions to &quot;Spoon Tests&quot; of Future Planning.}, journal = {Current biology : CB}, volume = {28}, number = {14}, pages = {2309-2313.e2}, doi = {10.1016/j.cub.2018.05.052}, pmid = {29983311}, issn = {1879-0445}, abstract = {Imagining the future is a powerful tool for making plans and solving problems. It is thought to rely on the episodic system which also underpins remembering a specific past event [1-3]. However, the emergence of episodic future thinking over development and evolution is debated [4-9]. One key source of positive evidence in pre-schoolers and animals is the &quot;spoon test&quot; or item choice test [4, 10], in which participants encounter a problem in one context and then a choice of items in another context, one of which is the solution to the problem. A majority of studies report that most children choose the right item by age 4 [10-15, cf.16]. Apes and corvids have also been shown to pass versions of the test [17-19]. However, it has been suggested that a simpler mechanism could be driving choice: the participant simply chooses the item that has been assigned salience or value, without necessarily imagining the future event [16, 20-23]. We developed a new test in which two of the items offered to children were associated with positive outcomes, but only one was still useful. We found that older children (5-, 6-, and 7-year-olds) chose the correct item at above chance levels, but younger children (3- and 4-year-olds) did not. In further tests, 4-year-olds showed an intact memory for the encoding event. We conclude that positive association substantially impacts performance on item choice tests in 4-year-olds and that future planning may have a more protracted developmental trajectory than episodic memory.}, }
@article {pmid29975360, year = {2018}, author = {Wójciak, P and Rybakowski, J}, title = {Clinical picture, pathogenesis and psychometric assessment of negative symptoms of schizophrenia.}, journal = {Psychiatria polska}, volume = {52}, number = {2}, pages = {185-197}, doi = {10.12740/PP/70610}, pmid = {29975360}, issn = {2391-5854}, abstract = {Negative symptoms of schizophrenia constitute a serious diagnostic and therapeutic problem. They substantially account for the impairment of health, social functioning and quality of life whereas treatment is difficult. In this paper the development of the concept of schizophrenia and negative symptoms is presented. The models of positive and negative symptoms, introduced in the 1980's by Timothy Crow and Nancy Andreasen, and William Carpenter's concept of so-called deficit syndrome with the criteria of the division of negative symptoms into the primary and secondary, are discussed. Current views on the pathogenesis of negative symptoms are shown with reference to neuroimaging studies, neurotransmitter alterations, neuropsychological deficits, genetic, immunological and epidemiological studies. A subsection is devoted to the diagnostics tools for negative symptoms. Chronologically, they are divided into scales of the 1st and 2nd generation. The first generation includes: the Brief Psychiatric Rating Scale (BPRS), the Scale for the Assessment of Negative Symptoms (SANS), the Positive and Negative Syndrome Scale (PANSS), the Schedule for the Deficit Syndrome (SDS), and the Proxy for Deficit Syndrome. The second generation scales, developed as a result of the recommendation by American experts in 2006, include: the Brief Negative Syndrome Scale (BNSS) and the Clinical Assessment Interview for Negative Symptoms (CAINS), also the self-assessment scales: the Motivation and Pleasure Scale - Self Report (MAP-SR) and the Self-assessment of Negative Symptoms (SNS). The BNSS and the SNS scales, whose Polish versions were elaborated in the Department of Adult Psychiatry of Poznan University of Medical Sciences, are discussed in-depth.}, }
@article {pmid29962382, year = {2018}, author = {Chen, YM and Huang, CC and Hsiao, CY and Hu, S and Wang, IL and Sung, HC}, title = {Ludwigia octovalvis (Jacq.) raven extract supplementation enhances muscle glycogen content and endurance exercise performance in mice.}, journal = {The Journal of veterinary medical science}, volume = {}, number = {}, pages = {}, doi = {10.1292/jvms.18-0165}, pmid = {29962382}, issn = {1347-7439}, abstract = {Ludwigia octovalvis extract (LOE) is a widely used traditional Chinese herbal medicine. To date, few studies have demonstrated the effect of LOE supplementation on exercise performance, physical fatigue and biochemical profile. The purpose of this study is to evaluate the potential beneficial effects of LOE extract on fatigue and ergogenic functions following physiological challenge. Male ICR mice from 3 groups (n=8 per group) were orally administered LOE for 4 weeks at 0 (vehicle), 61.5 (LOE-1X) or 307.5 (LOE-5X) mg/kg/day. LOE supplementation was able to dose-dependently increase endurance swimming time (P<0.0001) and decrease levels of serum lactate (P=0.0022), ammonia (P<0.0001), creatine kinase (P<0.0001), blood urea nitrogen (P<0.0001) and glucose utilization (P<0.0001) after acute exercise challenge. The glycogen in gastrocnemius muscle also increased with LOE treatment in a dose-dependent manner (P<0.0001). Biochemically, AST, ALT, LDH, CK, BUN, creatinine and UA levels were decreased with LOE treatment. Our study shows that 4-week supplementation with LOE increases muscle glycogen content storage to enhance exercise performance and anti-fatigue effects.}, }
@article {pmid29958290, year = {2018}, author = {Williams, BK and Johnson, FA}, title = {Value of sample information in dynamic, structurally uncertain resource systems.}, journal = {PloS one}, volume = {13}, number = {6}, pages = {e0199326}, doi = {10.1371/journal.pone.0199326}, pmid = {29958290}, issn = {1932-6203}, abstract = {Few if any natural resource systems are completely understood and fully observed. Instead, there almost always is uncertainty about the way a system works and its status at any given time, which can limit effective management. A natural approach to uncertainty is to allocate time and effort to the collection of additional data, on the reasonable assumption that more information will facilitate better understanding and lead to better management. But the collection of more data, either through observation or investigation, requires time and effort that often can be put to other conservation activities. An important question is whether the use of limited resources to improve understanding is justified by the resulting potential for improved management. In this paper we address directly a change in value from new information collected through investigation. We frame the value of information in terms of learning through the management process itself, as well as learning through investigations that are external to the management process but add to our base of understanding. We provide a conceptual framework and metrics for this issue, and illustrate them with examples involving Florida scrub-jays (Aphelocoma coerulescens).}, }
@article {pmid29958041, year = {2018}, author = {Hirst, RB and Conaboy, C and Vaughn, D and H Enriquez, R and Wickham, R}, title = {The &quot;Jay-Dar&quot; Phenomenon: Individuals Discriminate Cannabis Users from Nonusers Based Upon a Photograph.}, journal = {Substance use &amp; misuse}, volume = {53}, number = {14}, pages = {2359-2367}, doi = {10.1080/10826084.2018.1474228}, pmid = {29958041}, issn = {1532-2491}, abstract = {OBJECTIVE: With increasing legalization of medicinal and recreational cannabis, use is on the rise. Research suggests individuals may be able to guess cannabis user status based upon appearance; however, these findings utilized a small sample of photographs that was not balanced on user status or gender. Further, no studies examined whether raters with cannabis experience are better at judging others' cannabis use, or what physical features they use to make these judgments. This study explored these factors using a larger, balanced photograph database.<br><br>METHOD: An American sample (n = 249, 48.6% female, mean age = 35.19 years) rated 36 photographs (18 cannabis users, 18 nonusers) balanced on gender and age on the likelihood that the photographed individuals use cannabis, producing 8964 ratings. Respondents also reported physical features considered in their ratings, as well as their own cannabis use history.<br><br>RESULTS: As hypothesized, photographs of users received higher ratings on the Marijuana Use Likelihood Index relative to nonusers. Further, results revealed a gender by rater user status interaction, indicating that raters with no previous cannabis experience rated males higher than females, while raters with cannabis experience did not demonstrate this rating discrepancy. Cannabis use explained over 9% of the variance in ratings across all photographs.<br><br>CONCLUSIONS: Results suggest individuals do rate cannabis users as more likely to be users, relative to nonusers, based upon appearance alone. These findings have important implications, not only for research on chronic cannabis use effects, but also for social and achievement factors such as potential stigma.}, }
@article {pmid29955154, year = {2018}, author = {Jelbert, SA and Hosking, RJ and Taylor, AH and Gray, RD}, title = {Mental template matching is a potential cultural transmission mechanism for New Caledonian crow tool manufacturing traditions.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {8956}, doi = {10.1038/s41598-018-27405-1}, pmid = {29955154}, issn = {2045-2322}, abstract = {Cumulative cultural evolution occurs when social traditions accumulate improvements over time. In humans cumulative cultural evolution is thought to depend on a unique suite of cognitive abilities, including teaching, language and imitation. Tool-making New Caledonian crows show some hallmarks of cumulative culture; but this claim is contentious, in part because these birds do not appear to imitate. One alternative hypothesis is that crows' tool designs could be culturally transmitted through a process of mental template matching. That is, individuals could use or observe conspecifics' tools, form a mental template of a particular tool design, and then reproduce this in their own manufacture - a process analogous to birdsong learning. Here, we provide the first evidence supporting this hypothesis, by demonstrating that New Caledonian crows have the cognitive capacity for mental template matching. Using a novel manufacture paradigm, crows were first trained to drop paper into a vending machine to retrieve rewards. They later learnt that only items of a particular size (large or small templates) were rewarded. At test, despite being rewarded at random, and with no physical templates present, crows manufactured items that were more similar in size to previously rewarded, than unrewarded, templates. Our results provide the first evidence that this cognitive ability may underpin the transmission of New Caledonian crows' natural tool designs.}, }
@article {pmid29926397, year = {2018}, author = {Hampton, R}, title = {Parallel overinterpretation of behavior of apes and corvids.}, journal = {Learning &amp; behavior}, volume = {}, number = {}, pages = {}, doi = {10.3758/s13420-018-0330-5}, pmid = {29926397}, issn = {1543-4508}, support = {P51OD011132//National Science Foundation/ ; P51OD011132//National Institutes of Health ORIP/OD/ ; }, abstract = {The report by Kabadayi and Osvath (Science, 357(6347), 202-204, 2017) does not demonstrate planning in ravens. The behavior of corvids and apes is fascinating and will be best appreciated through well-designed experiments that explicitly test alternative explanations and that are interpreted without unjustified anthropomorphic embellishment.}, }
@article {pmid29920164, year = {2018}, author = {Komar, N and Panella, NA and Golnar, AJ and Hamer, GL}, title = {Forage Ratio Analysis of the Southern House Mosquito in College Station, Texas.}, journal = {Vector borne and zoonotic diseases (Larchmont, N.Y.)}, volume = {}, number = {}, pages = {}, doi = {10.1089/vbz.2018.2285}, pmid = {29920164}, issn = {1557-7759}, abstract = {Culex quinquefasciatus is the principal vector of West Nile virus (WNV) in the South Central United States, yet limited data on host utilization are available. We evaluated host utilization over a 3-month period in 2013 in a residential landscape in College Station, Texas. PCR sequencing of the mitochondrial cytochrome oxidase 1 gene permitted molecular identification of vertebrate bloodmeals to the species level. Forage ratio analysis identified bird species that were overutilized and underutilized by comparing community feeding index values to expected relative abundance values of bird species, derived from eBird data. Community feeding index values were also used in conjunction with reservoir competence data from the literature to generate reservoir capacity index values, a means of identifying relative importance of vertebrate reservoir hosts. Of 498 blood-engorged Cx. quinquefasciatus, 313 (62.9%) were identified to vertebrate species. The majority (95.5%) of bloodmeals originated from avian species with the remainder from mammals, but not humans. Northern mockingbird (Mimus polyglottos) was the principal host for mosquito feeding in June and July, but northern cardinal (Cardinalis cardinalis) became primary host in August. Forage ratio analysis revealed the overutilization of house finch (Haemorhous mexicanus), American robin (Turdus migratorius), northern mockingbird, northern cardinal, white-winged dove (Zenaida asiatica), and mourning dove (Zenaida macroura). Great-tailed grackle (Quiscalus mexicanus), blue jay (Cyanocitta cristata), and Carolina wren (Thryothorus ludovicianus) were under-utilized relative to availability. Reservoir capacity calculations suggested that northern mockingbird and northern cardinal were the principal amplifiers in the study area. These data identify the primary avian species contributing to the enzootic amplification of WNV in East-Central Texas and reveal that the heavy feeding on moderately competent hosts and no feeding on humans likely limit epidemics in this region.}, }
@article {pmid29905106, year = {2018}, author = {Kruse, T and Zachariah, T and McManamon, R}, title = {T-cell Thymic Lymphoma With Proventricular Metastasis in a Florida Scrub Jay (Aphelocoma coerulescens).}, journal = {Journal of avian medicine and surgery}, volume = {32}, number = {2}, pages = {128-132}, doi = {10.1647/2017-293}, pmid = {29905106}, issn = {1082-6742}, abstract = {An adult, wild-caught, female Florida scrub jay (Aphelocoma coerulescens) was evaluated because of an observable mass on the ventral neck. Initial physical examination and diagnostic tests were performed, which revealed a subcutaneous mass. Surgical removal of the mass was attempted, but the bird died during surgery. Results of necropsy and histopathologic evaluation identified the mass as thymic lymphoma with proventricular metastasis. Immunohistochemical staining revealed strong cytoplasmic immunoreactivity for CD3 in the thymic mass and within the predominant lymphoid population in the serosal proventricular masses, which confirmed metastasis of T-cell lymphoma. To our knowledge, this is the first report of T-cell thymic lymphoma in a wild Florida scrub jay.}, }
@article {pmid29891142, year = {2018}, author = {Hassan, MM and Hoque, MA and Ujvari, B and Klaassen, M}, title = {Live bird markets in Bangladesh as a potentially important source for Avian Influenza Virus transmission.}, journal = {Preventive veterinary medicine}, volume = {156}, number = {}, pages = {22-27}, doi = {10.1016/j.prevetmed.2018.05.003}, pmid = {29891142}, issn = {1873-1716}, abstract = {Live bird markets (LBM) are important for trading poultry in many developing countries where they are being considered hotspots of Avian Influenza Virus (AIV) prevalence and contamination. An active surveillance for Avian Influenza Virus (AIV) was conducted on four species of LBM birds (chickens, ducks, quails and pigeons) from 10 of the largest LBM in Chittagong, Bangladesh, and two species of peri-domestic wild birds (house crow and Asian pied starling) in their direct vicinity from November 2012 until September 2016. Our aim was to identify the scale and annual pattern of AIV circulation in both the LBM birds and the two per-domestic wild bird species living in close proximity of the LBM. In the latter two species, the annual pattern in AIV antibody prevalence was additionally investigated. A total of 4770 LBM birds and 1119 peri-domestic wild birds were sampled. We used rt-PCR for detection of the AIV M-gene and AIV subtypes H5, H7 and H9 from swab samples. We used c-ELISA for AIV antibody detection from serum samples of peri-domestic wild birds. Average AIV prevalence among the four LBM species varied between 16 and 28%, whereas no AIV was detected in peri-domestic wild birds by rt-PCR. In all LBM species we found significantly higher AIV prevalence in winter compared to summer. A similar pattern was found in AIV antibody prevalence in peri-domestic wild birds feeding in the direct vicinity of LBM. For the subtypes of AIV investigated, we found a significantly higher proportion of AIV H5 in LBM chickens and H9 in LBM ducks. No H7 was detected in any of the investigated samples. We conclude that AIV and notably AIV H5 and H9 were circulating in the investigated LBM of Bangladesh with clear seasonality that matched the prevalence of AIV antibodies of peri-domestic wild birds. These patterns show great resemblance to the annual outbreak patterns in Bangladeshi poultry industry. Our data suggest considerable exchange of AIV within and among the four LBM bird species and peri-domestic wild birds, which likely contributes to the maintenance of the AIV problems in Bangladesh. Increasing biosecurity and notably reducing the direct and indirect mixing of various domestic bird species and peri-domestic wild birds and developing all-in-all-out selling systems with regular use of disinfectant are likely to reduce the risk of transmission and spread of AIV, including HPAI.}, }
@article {pmid29881330, year = {2018}, author = {Singh, UA and Kumari, M and Iyengar, S}, title = {Method for improving the quality of genomic DNA obtained from minute quantities of tissue and blood samples using Chelex 100 resin.}, journal = {Biological procedures online}, volume = {20}, number = {}, pages = {12}, doi = {10.1186/s12575-018-0077-6}, pmid = {29881330}, issn = {1480-9222}, abstract = {Background: Although genomic DNA isolation using the Chelex 100 resin is rapid and inexpensive, the DNA obtained by this method has a low concentration in solution and contains suspended impurities. The presence of debris in the DNA solution may result in degradation of DNA on long term storage and inhibition of the polymerase chain reaction. In order to remove impurities and concentrate the DNA in solution, we have introduced modifications in the existing DNA isolation protocol using Chelex-100. We used ammonium acetate to precipitate proteins and a sodium acetate- isopropanol mixture to pellet out DNA which was washed with ethanol.<br><br>Results: A pure DNA pellet that can be dissolved in water or Tris-EDTA buffer and stored for a long time at - 80 °C was obtained. We also observed a 20-fold change in the DNA concentration following precipitation and re-dissolution.<br><br>Conclusion: Our method is different from other extraction methods since it uses non-toxic, easily available and inexpensive reagents as well as minimal amounts of blood or tissue samples for the DNA extraction process. Besides its use in sex determination and genotyping in lab animals as described in this paper, it may also have applications in forensic science and diagnostics such as the easy detection of pathogenic DNA in blood.}, }
@article {pmid29875298, year = {2018}, author = {Szipl, G and Ringler, E and Bugnyar, T}, title = {Attacked ravens flexibly adjust signalling behaviour according to audience composition.}, journal = {Proceedings. Biological sciences}, volume = {285}, number = {1880}, pages = {}, doi = {10.1098/rspb.2018.0375}, pmid = {29875298}, issn = {1471-2954}, abstract = {A fundamental attribute of social intelligence is the ability to monitor third-party relationships, which has been repeatedly demonstrated in primates, and recently also in captive ravens. It is yet unknown how ravens make use of this ability when dealing with different types of social relationships simultaneously during complex real-life situations. Free-ranging non-breeder ravens live in societies characterized by high fission-fusion dynamics and structured by age, pair-bond status and kinship. Here, we show that free-ranging ravens modify communication during conflicts according to audience composition. When being attacked by dominant conspecifics, victims of aggression signal their distress via defensive calls. Victims increased call rates when their kin were in the bystander audience, but reduced call rates when the bystanders were bonding partners of their aggressors. Hence, ravens use social knowledge flexibly and probably based on their own need (i.e. alert nearby allies and avoid alerting nearby rivals).}, }
@article {pmid29871743, year = {2018}, author = {Zeeh, F and Klausmann, S and Masserey, Y and Nathues, H and Perreten, V and Rohde, J}, title = {Isolation of Brachyspira hyodysenteriae from a crow (Corvus corone) in close proximity to commercial pigs.}, journal = {Veterinary journal (London, England : 1997)}, volume = {236}, number = {}, pages = {111-112}, doi = {10.1016/j.tvjl.2018.05.002}, pmid = {29871743}, issn = {1532-2971}, abstract = {The aim of this study was to determine whether crows (Corvus corone) can harbour Brachyspira hyodysenteriae, the cause of swine dysentery, and whether the organism carried by crows is related to strains infecting pigs. B. hyodysenteriae was isolated from one crow in close proximity to two pig farms in Switzerland. This isolate, along with five isolates of B. hyodysenteriae from one of the farms, belonged to sequence type (ST) 66 using multilocus sequence typing. This finding suggests that crows are potential vectors of B. hyodysenteriae, but further studies will be necessary to clarify the role of crows in the epidemiology of this organism.}, }
@article {pmid29870913, year = {2018}, author = {Oravcová, V and Peixe, L and Coque, TM and Novais, C and Francia, MV and Literák, I and Freitas, AR}, title = {Wild corvid birds colonized with vancomycin-resistant Enterococcus faecium of human origin harbor epidemic vanA plasmids.}, journal = {Environment international}, volume = {118}, number = {}, pages = {125-133}, doi = {10.1016/j.envint.2018.05.039}, pmid = {29870913}, issn = {1873-6750}, abstract = {The most prevalent type of acquired vancomycin resistance in Enterococcus faecium (VREfm) is encoded by the vanA transposon Tn1546, mainly located on transferable plasmids. vanA plasmids have been characterized in VREfm from a variety of sources but not wild birds. The aim of this study was to analyse the genetic context of VREfm strains recovered from wild corvid birds and to compare their plasmid and strain characteristics with human strains. To achieve that, 75 VREfm isolates, including strains from wild birds recovered during wide surveillance studies performed in Europe, Canada and the United States (2010-2013), and clinical and wastewater strains from Czech Republic, a region lacking data about vanA plasmids, were analysed. Their population structure, presence of major putative virulence markers and characterization of vanA transposons and plasmids were established. VREfm from wild birds were mainly associated with major human lineages (ST18 and ST78) circulating in hospitals worldwide and were enriched in putative virulence markers that are highly associated with clinical E. faecium from human infections. They also carried plasmids of the same families usually found in the clinical setting [RCR, small theta plasmids, RepA_N (pRUM/pLG1) and Inc18]. The clinically widespread IS1251-carrying Tn1546 type &quot;F&quot; was predominant and Tn1546-vanA was mainly located on pRUM/Axe-Txe (USA) and Inc18- or pLG1-like (Europe) plasmids. VREfm from hospitals and wastewaters carried Tn1546-vanA in different plasmid types including mosaic pRUM-Inc18 plasmids, not identified in wild birds. This is the first characterization of vanA plasmids obtained from wild birds. A similar plasmid pool seems to exist in different clonal E. faecium backgrounds of humans and wild birds. The isolation of VREfm strains from wild birds that belong to human E. faecium adapted lineages and carry virulence genes, Tn1546 and plasmid variants widespread in the clinical setting is of concern and highlight their role as potential drivers of the global dissemination of vancomycin resistance.}, }
@article {pmid29868262, year = {2018}, author = {Forti, LR and Foratto, RM and Márquez, R and Pereira, VR and Toledo, LF}, title = {Current knowledge on bioacoustics of the subfamily Lophyohylinae (Hylidae, Anura) and description of Ocellated treefrog Itapotihyla langsdorffii vocalizations.}, journal = {PeerJ}, volume = {6}, number = {}, pages = {e4813}, doi = {10.7717/peerj.4813}, pmid = {29868262}, issn = {2167-8359}, abstract = {Background: Anuran vocalizations, such as advertisement and release calls, are informative for taxonomy because species recognition can be based on those signals. Thus, a proper acoustic description of the calls may support taxonomic decisions and may contribute to knowledge about amphibian phylogeny.<br><br>Methods: Here we present a perspective on advertisement call descriptions of the frog subfamily Lophyohylinae, through a literature review and a spatial analysis presenting bioacoustic coldspots (sites with high diversity of species lacking advertisement call descriptions) for this taxonomic group. Additionally, we describe the advertisement and release calls of the still poorly known treefrog, Itapotihyla langsdorffii. We analyzed recordings of six males using the software Raven Pro 1.4 and calculated the coefficient of variation for classifying static and dynamic acoustic properties.<br><br>Results and Discussion: We found that more than half of the species within the subfamily do not have their vocalizations described yet. Most of these species are distributed in the western and northern Amazon, where recording sampling effort should be strengthened in order to fill these gaps. The advertisement call of I. langsdorffii is composed of 3-18 short unpulsed notes (mean of 13 ms long), presents harmonic structure, and has a peak dominant frequency of about 1.4 kHz. This call usually presents amplitude modulation, with decreasing intensity along the sequence of notes. The release call is a simple unpulsed note with an average duration of 9 ms, and peak dominant frequency around 1.8 kHz. Temporal properties presented higher variations than spectral properties at both intra- and inter-individual levels. However, only peak dominant frequency was static at intra-individual level. High variability in temporal properties and lower variations related to spectral ones is usual for anurans; The first set of variables is determined by social environment or temperature, while the second is usually related to species-recognition process. Here we review and expand the acoustic knowledge of the subfamily Lophyohylinae, highlighting areas and species for future research.}, }
@article {pmid29860384, year = {2018}, author = {Kutilova, I and Janecko, N and Cejkova, D and Literak, I and Papagiannitsis, CC and Dolejska, M}, title = {Characterization of blaKPC-3-positive plasmids from an Enterobacter aerogenes isolated from a corvid in Canada.}, journal = {The Journal of antimicrobial chemotherapy}, volume = {}, number = {}, pages = {}, doi = {10.1093/jac/dky199}, pmid = {29860384}, issn = {1460-2091}, }
@article {pmid29860368, year = {2018}, author = {Klein, HU and Zareba, W and Kutyifa, V}, title = {Arthur Jay Moss MD PhD: The cardiology world has again lost one of its most respected and worldwide-honoured scholars and experienced clinician. Born 21 June 1931, Professor of Medicine and Cardiology at Rochester University Medical Center, Rochester, NY, Arthur passed away on 14 February 2018 at the age of 86.}, journal = {European heart journal}, volume = {39}, number = {21}, pages = {1872-1874}, doi = {10.1093/eurheartj/ehy211}, pmid = {29860368}, issn = {1522-9645}, }
@article {pmid29857494, year = {2018}, author = {Zrzavá, M and Hladová, I and Dalíková, M and Šíchová, J and Õunap, E and Kubíčková, S and Marec, F}, title = {Sex Chromosomes of the Iconic Moth Abraxas grossulariata (Lepidoptera, Geometridae) and Its Congener A. sylvata.}, journal = {Genes}, volume = {9}, number = {6}, pages = {}, doi = {10.3390/genes9060279}, pmid = {29857494}, issn = {2073-4425}, abstract = {The magpie moth, Abraxas grossulariata, is an iconic species in which female heterogamety was discovered at the beginning of the 20th century. However, the sex chromosomes of this species have not yet been cytologically identified. We describe the sex chromosomes of A. grossulariata and its congener, A. sylvata. Although these species split only around 9.5 million years ago, and both species have the expected WZ/ZZ chromosomal system of sex determination and their sex chromosomes share the major ribosomal DNA (rDNA) representing the nucleolar organizer region (NOR), we found major differences between their karyotypes, including between their sex chromosomes. The species differ in chromosome number, which is 2n = 56 in A. grossularita and 2n = 58 in A. sylvata. In addition, A. grossularita autosomes exhibit massive autosomal blocks of heterochromatin, which is a very rare phenomenon in Lepidoptera, whereas the autosomes of A. sylvata are completely devoid of distinct heterochromatin. Their W chromosomes differ greatly. Although they are largely composed of female-specific DNA sequences, as shown by comparative genomic hybridization, cross-species W-chromosome painting revealed considerable sequence differences between them. The results suggest a relatively rapid molecular divergence of Abraxas W chromosomes by the independent spreading of female-specific repetitive sequences.}, }
@article {pmid29797581, year = {2018}, author = {Paulson, S and Lombard, J and Pigliucci, M and Ruse, M and Smith, EE}, title = {The power of meaning: the quest for an existential roadmap.}, journal = {Annals of the New York Academy of Sciences}, volume = {}, number = {}, pages = {}, doi = {10.1111/nyas.13699}, pmid = {29797581}, issn = {1749-6632}, abstract = {Where can we turn to find the story of our lives-an existential roadmap that explains where we have come from, why we are here, and where we are headed? Must each of us discover meaning within the context of our individual lives, or are there universal sources of meaning that we can all access? Is there any relationship between living a meaningful life and the quality of our health and well-being? And how can we find meaning in the face of adversity and suffering? Neurologist Jay Lombard, philosophers Massimo Pigliucci and Michael Ruse, and author Emily Esfahani Smith shed light on these perennial questions in conversation with Steve Paulson, executive producer and host of To the Best of Our Knowledge.}, }
@article {pmid29794731, year = {2018}, author = {Tang, S and Sun, Z and Wu, X and Wang, YY and Zhang, J}, title = {An innovative thread-lift technique for facial rejuvenation and complication management: A case report.}, journal = {Medicine}, volume = {97}, number = {21}, pages = {e10547}, doi = {10.1097/MD.0000000000010547}, pmid = {29794731}, issn = {1536-5964}, mesh = {Blepharoptosis/*surgery ; Face/*surgery ; Female ; Humans ; Middle Aged ; Postoperative Complications ; Rejuvenation ; Rhytidoplasty/adverse effects/*methods ; Skin Aging ; }, abstract = {RATIONALE: Aging of face is an unavoidable process. Traditional procedures for facial rejuvenation have multiple disadvantages. In this case report, we used an innovative technique combining thread lift with small incision rhytidectomy for facial rejuvenation. Management for complication was also reported.<br><br>PATIENT CONCERNS: We presented a 52-year-old male with facial ptosis and wrinkles.<br><br>DIAGNOSES: The patient was diagnosed as facial aging including skin laxity, mid-face and mandibular jowl ptosis, static crows-feet wrinkles, and deepening nasolabial fold.<br><br>INTERVENTIONS: We used an innovative technique combining thread lift with small incision rhytidectomy to treat facial aging.<br><br>OUTCOMES: Improvements of the crow's feet, nasolabial fold, mid-face and lower face ptosis were observed. Complication of subcutaneous nodule was corrected with cosmetic effect of thread lift remained.<br><br>LESSONS: The innovative technique combining thread lift with small incision rhytidectomy is a good alternative for the treatment of facial aging.}, }
@article {pmid29793682, year = {2018}, author = {Tolnay, SE and Beck, EM and Sass, V}, title = {Migration and protest in the Jim Crow South.}, journal = {Social science research}, volume = {73}, number = {}, pages = {13-30}, doi = {10.1016/j.ssresearch.2018.03.011}, pmid = {29793682}, issn = {1096-0317}, abstract = {The Great Migration and the Civil Rights Movement were two pivotal events experienced by the southern African American population during the 20th Century. Each has received considerable attention by social scientists and historians, and a possible connection between the two phenomena has been speculated. However, no systematic investigation of the effect of migration on protest during the Jim Crow era has been conducted. In this study we use data for 333 southern communities to examine the relationship between youthful black migration between 1950 and 1960 and the occurrence of sit-ins early in 1960. We find a strong positive, non-linear, relationship between net-migration and the likelihood of a sit-in which can be explained by two sets of mediating influences: local demographic conditions and local organizational presence. Our findings offer strong empirical support for an association between southern black migration and protest during Jim Crow and suggest the value of considering the influence of demographic forces on collective action.}, }
@article {pmid29790246, year = {2018}, author = {Roos, S and Smart, J and Gibbons, DW and Wilson, JD}, title = {A review of predation as a limiting factor for bird populations in mesopredator-rich landscapes: a case study of the UK.}, journal = {Biological reviews of the Cambridge Philosophical Society}, volume = {}, number = {}, pages = {}, doi = {10.1111/brv.12426}, pmid = {29790246}, issn = {1469-185X}, abstract = {The impact of increasing vertebrate predator numbers on bird populations is widely debated among the general public, game managers and conservationists across Europe. However, there are few systematic reviews of whether predation limits the population sizes of European bird species. Views on the impacts of predation are particularly polarised in the UK, probably because the UK has a globally exceptional culture of intensive, high-yield gamebird management where predator removal is the norm. In addition, most apex predators have been exterminated or much depleted in numbers, contributing to a widely held perception that the UK has high numbers of mesopredators. This has resulted in many high-quality studies of mesopredator impacts over several decades. Here we present results from a systematic review of predator trends and abundance, and assess whether predation limits the population sizes of 90 bird species in the UK. Our results confirm that the generalist predators Red Fox (Vulpes vulpes) and Crows (Corvus corone and C. cornix) occur at high densities in the UK compared with other European countries. In addition, some avian and mammalian predators have increased numerically in the UK during recent decades. Despite these high and increasing densities of predators, we found little evidence that predation limits populations of pigeons, woodpeckers and passerines, whereas evidence suggests that ground-nesting seabirds, waders and gamebirds can be limited by predation. Using life-history characteristics of prey species, we found that mainly long-lived species with high adult survival and late onset of breeding were limited by predation. Single-brooded species were also more likely to be limited by predation than multi-brooded species. Predators that depredate prey species during all life stages (i.e. from nest to adult stages) limited prey numbers more than predators that depredated only specific life stages (e.g. solely during the nest phase). The Red Fox and non-native mammals (e.g. the American Mink Neovison vison) were frequently identified as numerically limiting their prey species. Our review has identified predator-prey interactions that are particularly likely to result in population declines of prey species. In the short term, traditional predator-management techniques (e.g. lethal control or fencing to reduce predation by a small number of predator species) could be used to protect these vulnerable species. However, as these techniques are costly and time-consuming, we advocate that future research should identify land-use practices and landscape configurations that would reduce predator numbers and predation rates.}, }
@article {pmid29774435, year = {2018}, author = {Stow, MK and Vernouillet, A and Kelly, DM}, title = {Neophobia does not account for motoric self-regulation performance as measured during the detour-reaching cylinder task.}, journal = {Animal cognition}, volume = {21}, number = {4}, pages = {565-574}, doi = {10.1007/s10071-018-1189-8}, pmid = {29774435}, issn = {1435-9456}, support = {312379-2009//Natural Sciences and Engineering Research Council of Canada/ ; }, abstract = {The ability to restrain a prepotent response in favor of a more adaptive behavior, or to exert inhibitory control, has been used as a measure of a species' cognitive abilities. Inhibitory control defines a spectrum of behaviors varying in complexity, ranging from self-control to motoric self-regulation. Several factors underlying inhibitory control have been identified, however, the influence of neophobia (i.e., aversion to novelty) on inhibitory control has not received much attention. Neophobia is known to affect complex cognitive abilities, but whether neophobia also influences more basic cognitive abilities, such as motoric self-regulation, has received less attention. Further, it remains unclear whether an individual's response to novelty is consistent across different paradigms purported to assess neophobia. We tested two North American corvid species, black-billed magpies (Pica hudsonia) and California scrub jays (Aphelocoma californica) using two well-established neophobia paradigms to assess response stability between contexts. We then evaluated neophobia scores against the number of trials needed to learn a motoric self-regulation task, as well as subsequent task performance. Neophobia scores did not correlate across paradigms, nor did the responses during either paradigm account for motoric self-regulation performance.}, }
@article {pmid29769348, year = {2018}, author = {Lau, SKP and Wong, EYM and Tsang, CC and Ahmed, SS and Au-Yeung, RKH and Yuen, KY and Wernery, U and Woo, PCY}, title = {Discovery and Sequence Analysis of Four Deltacoronaviruses from Birds in the Middle East Reveal Interspecies Jumping with Recombination as a Potential Mechanism for Avian-to-Avian and Avian-to-Mammalian Transmission.}, journal = {Journal of virology}, volume = {92}, number = {15}, pages = {}, doi = {10.1128/JVI.00265-18}, pmid = {29769348}, issn = {1098-5514}, mesh = {Animals ; *Bird Diseases/genetics/transmission ; Birds/*virology ; *Coronaviridae Infections/genetics/transmission/veterinary ; *Coronavirus/classification/genetics/isolation &amp; purification/pathogenicity ; *High-Throughput Nucleotide Sequencing ; Saudi Arabia ; Swine/*virology ; }, abstract = {The emergence of Middle East respiratory syndrome showed once again that coronaviruses (CoVs) in animals are potential source for epidemics in humans. To explore the diversity of deltacoronaviruses in animals in the Middle East, we tested fecal samples from 1,356 mammals and birds in Dubai, The United Arab Emirates. Four novel deltacoronaviruses were detected from eight birds of four species by reverse transcription-PCR (RT-PCR): FalCoV UAE-HKU27 from a falcon, HouCoV UAE-HKU28 from a houbara bustard, PiCoV UAE-HKU29 from a pigeon, and QuaCoV UAE-HKU30 from five quails. Complete genome sequencing showed that FalCoV UAE-HKU27, HouCoV UAE-HKU28, and PiCoV UAE-HKU29 belong to the same CoV species, suggesting recent interspecies transmission between falcons and their prey, houbara bustards and pigeons, possibly along the food chain. Western blotting detected specific anti-FalCoV UAE-HKU27 antibodies in 33 (75%) of 44 falcon serum samples, supporting genuine infection in falcons after virus acquisition. QuaCoV UAE-HKU30 belongs to the same CoV species as porcine coronavirus HKU15 (PorCoV HKU15) and sparrow coronavirus HKU17 (SpCoV HKU17), discovered previously from swine and tree sparrows, respectively, supporting avian-to-swine transmission. Recombination involving the spike protein is common among deltacoronaviruses, which may facilitate cross-species transmission. FalCoV UAE-HKU27, HouCoV UAE-HKU28, and PiCoV UAE-HKU29 originated from recombination between white-eye coronavirus HKU16 (WECoV HKU16) and magpie robin coronavirus HKU18 (MRCoV HKU18), QuaCoV UAE-HKU30 from recombination between PorCoV HKU15/SpCoV HKU17 and munia coronavirus HKU13 (MunCoV HKU13), and PorCoV HKU15 from recombination between SpCoV HKU17 and bulbul coronavirus HKU11 (BuCoV HKU11). Birds in the Middle East are hosts for diverse deltacoronaviruses with potential for interspecies transmission.IMPORTANCE During an attempt to explore the diversity of deltacoronaviruses among mammals and birds in Dubai, four novel deltacoronaviruses were detected in fecal samples from eight birds of four different species: FalCoV UAE-HKU27 from a falcon, HouCoV UAE-HKU28 from a houbara bustard, PiCoV UAE-HKU29 from a pigeon, and QuaCoV UAE-HKU30 from five quails. Genome analysis revealed evidence of recent interspecies transmission between falcons and their prey, houbara bustards and pigeons, possibly along the food chain, as well as avian-to-swine transmission. Recombination, which is known to occur frequently in some coronaviruses, was also common among these deltacoronaviruses and occurred predominantly at the spike region. Such recombination, involving the receptor binding protein, may contribute to the emergence of new viruses capable of infecting new hosts. Birds in the Middle East are hosts for diverse deltacoronaviruses with potential for interspecies transmission.}, }
@article {pmid29768124, year = {2018}, author = {Fronzetti Colladon, A and Grippa, F}, title = {The Importance of Being Honest: Correlating Self-Report Accuracy and Network Centrality with Academic Performance.}, journal = {The Journal of psychology}, volume = {152}, number = {5}, pages = {304-324}, doi = {10.1080/00223980.2018.1459443}, pmid = {29768124}, issn = {1940-1019}, abstract = {This study investigates the correlation of self-report accuracy with academic performance. The sample was composed of 289 undergraduate students (96 senior and 193 junior) enrolled in two engineering classes. Age ranged between 22 and 24 years, with a slight over representation of male students (53%). Academic performance was calculated based on students' final grades in each class. The tendency to report inaccurate information was measured at the end of the Raven Progressive Matrices Test, by asking students to report their exact finishing times. We controlled for gender, age, personality traits, intelligence, and past academic performance. We also included measures of centrality in their friendship, advice and trust networks. Correlation and multiple regression analyses results indicate that lower achieving students were significantly less accurate in self-reporting data. We also found that being more central in the advice network was correlated with higher performance (r = .20, p < .001). The results are aligned with existing literature emphasizing the individual and relational factors associated with academic performance and, pending future studies, may be utilized to include a new metric of self-report accuracy that is not dependent on academic records.}, }
@article {pmid29764777, year = {2018}, author = {Monshizadeh, L and Vameghi, R and Sajedi, F and Yadegari, F and Hashemi, SB and Kirchem, P and Kasbi, F}, title = {Comparison of Social Interaction between Cochlear-Implanted Children with Normal Intelligence Undergoing Auditory Verbal Therapy and Normal-Hearing Children: A Pilot Study.}, journal = {The journal of international advanced otology}, volume = {14}, number = {1}, pages = {34-38}, doi = {10.5152/iao.2018.3663}, pmid = {29764777}, issn = {1308-7649}, abstract = {OBJECTIVE: A cochlear implant is a device that helps hearing-impaired children by transmitting sound signals to the brain and helping them improve their speech, language, and social interaction. Although various studies have investigated the different aspects of speech perception and language acquisition in cochlear-implanted children, little is known about their social skills, particularly Persian-speaking cochlear-implanted children. Considering the growing number of cochlear implants being performed in Iran and the increasing importance of developing near-normal social skills as one of the ultimate goals of cochlear implantation, this study was performed to compare the social interaction between Iranian cochlear-implanted children who have undergone rehabilitation (auditory verbal therapy) after surgery and normal-hearing children.<br><br>MATERIALS AND METHODS: This descriptive-analytical study compared the social interaction level of 30 children with normal hearing and 30 with cochlear implants who were conveniently selected. The Raven test was administered to the both groups to ensure normal intelligence quotient. The social interaction status of both groups was evaluated using the Vineland Adaptive Behavior Scale, and statistical analysis was performed using Statistical Package for Social Sciences (SPSS) version 21.<br><br>RESULTS: After controlling age as a covariate variable, no significant difference was observed between the social interaction scores of both the groups (p > 0.05). In addition, social interaction had no correlation with sex in either group.<br><br>CONCLUSION: Cochlear implantation followed by auditory verbal rehabilitation helps children with sensorineural hearing loss to have normal social interactions, regardless of their sex.}, }
@article {pmid29743545, year = {2018}, author = {Woods, RD and Kings, M and McIvor, GE and Thornton, A}, title = {Caller characteristics influence recruitment to collective anti-predator events in jackdaws.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {7343}, doi = {10.1038/s41598-018-25793-y}, pmid = {29743545}, issn = {2045-2322}, abstract = {Across the animal kingdom, examples abound of individuals coming together to repel external threats. When such collective actions are initiated by recruitment signals, individuals may benefit from being selective in whom they join, so the identity of the initiator may determine the magnitude of the group response. However, the role of signaller discrimination in coordinating group-level responses has yet to be tested. Here we show that in wild jackdaws, a colonial corvid species, collective responses to anti-predator recruitment calls are mediated by caller characteristics. In playbacks next to nestboxes, the calls of nestbox residents attracted most recruits, followed in turn by other colony members, non-colony members and rooks (a sympatric corvid). Playbacks in fields outside nestbox colonies, where the immediate threat to broods was lower, showed similar results, with highest recruitment to nearby colony members' calls. Responses were further influenced by caller sex: calls from non-colony member females were less likely to elicit responsive scolding by recruits than other calls, potentially reflecting social rank associated with sex and colony membership. These results show that vocal discrimination mediates jackdaws' collective responses and highlight the need for further research into the cognitive basis of collective actions in animal groups.}, }
@article {pmid29719531, year = {2018}, author = {Rohde, F and Schusser, B and Hron, T and Farkašová, H and Plachý, J and Härtle, S and Hejnar, J and Elleder, D and Kaspers, B}, title = {Characterization of Chicken Tumor Necrosis Factor-α, a Long Missed Cytokine in Birds.}, journal = {Frontiers in immunology}, volume = {9}, number = {}, pages = {605}, doi = {10.3389/fimmu.2018.00605}, pmid = {29719531}, issn = {1664-3224}, abstract = {Tumor necrosis factor-α (TNF-α) is a pleiotropic cytokine playing critical roles in host defense and acute and chronic inflammation. It has been described in fish, amphibians, and mammals but was considered to be absent in the avian genomes. Here, we report on the identification and functional characterization of the avian ortholog. The chicken TNF-α (chTNF-α) is encoded by a highly GC-rich gene, whose product shares with its mammalian counterpart 45% homology in the extracellular part displaying the characteristic TNF homology domain. Orthologs of chTNF-α were identified in the genomes of 12 additional avian species including Palaeognathae and Neognathae, and the synteny of the closely adjacent loci with mammalian TNF-α orthologs was demonstrated in the crow (Corvus cornix) genome. In addition to chTNF-α, we obtained full sequences for homologs of TNF-α receptors 1 and 2 (TNFR1, TNFR2). chTNF-α mRNA is strongly induced by lipopolysaccharide (LPS) stimulation of monocyte derived, splenic and bone marrow macrophages, and significantly upregulated in splenic tissue in response to i.v. LPS treatment. Activation of T-lymphocytes by TCR crosslinking induces chTNF-α expression in CD4+ but not in CD8+ cells. To gain insights into its biological activity, we generated recombinant chTNF-α in eukaryotic and prokaryotic expression systems. Both, the full-length cytokine and the extracellular domain rapidly induced an NFκB-luciferase reporter in stably transfected CEC-32 reporter cells. Collectively, these data provide strong evidence for the existence of a fully functional TNF-α/TNF-α receptor system in birds thus filling a gap in our understanding of the evolution of cytokine systems.}, }
@article {pmid29690109, year = {2018}, author = {Hammer, MP and Allen, GR and Martin, KC and Adams, M and Ebner, BC and Raadik, TA and Unmack, PJ}, title = {Revision of the Australian Wet Tropics endemic rainbowfish genus Cairnsichthys (Atheriniformes: Melanotaeniidae), with description of a new species.}, journal = {Zootaxa}, volume = {4413}, number = {2}, pages = {271-294}, pmid = {29690109}, issn = {1175-5334}, mesh = {Animal Distribution ; Animals ; Australia ; Ecosystem ; *Fishes ; Male ; Queensland ; }, abstract = {The freshwater melanotaeniid genus Cairnsichthys is endemic to a relatively small area of specialised habitat within the Wet Tropics bioregion of north-eastern Queensland, Australia. It was previously considered as monotypic, including only a single species, C. rhombosomoides (Nichols Raven, 1928). The recent discovery of an apparently-isolated population in the Daintree rainforest, approximately 120 km north of the known range extent, prompted a detailed investigation of its taxonomic status using a combined lines of evidence approach. We provide compelling evidence from multiple nuclear genetic markers (52 allozyme loci), mitochondrial DNA sequence data (1141 bp cytochrome b) and morphology (examination of a suite of 38 morphometric and meristic characters) that supports north-south splitting of C. rhombosomoides. Accordingly, we describe the northern population as a distinct species, C. bitaeniatus sp. nov., on the basis of 25 specimens, 34.7-65.6 mm SL. The new species differs morphologically primarily by having a more slender and narrow shape, featuring a flatter, straighter predorsal profile and shorter second dorsal fin base; possession of slightly smaller scales, reflected in higher counts of lateral scales and predorsal scales; typically more vertebrae; and colour differences including a more robust, short black stripe across the upper operculum, a pronounced yellow patch on the anteroventral body and usually a more conspicuous second dark stripe on the lower body, with adult males generally having yellowish compared to reddish fins. We also provide a generic diagnosis for Cairnsichthys and a redescription of C. rhombosomoides. Information on the known distribution, habitats and conservation status of species in the genus is summarised, the new species being of particular concern as a narrow range endemic with specific environmental requirements.}, }
@article {pmid29680766, year = {2018}, author = {Osvath, M and Kabadayi, C}, title = {Contrary to the Gospel, Ravens Do Plan Flexibly.}, journal = {Trends in cognitive sciences}, volume = {22}, number = {6}, pages = {474-475}, doi = {10.1016/j.tics.2018.03.011}, pmid = {29680766}, issn = {1879-307X}, }
@article {pmid29675942, year = {2018}, author = {Janecko, N and Halova, D and Jamborova, I and Papousek, I and Masarikova, M and Dolejska, M and Literak, I}, title = {Occurrence of plasmid-mediated quinolone resistance genes in Escherichia coli and Klebsiella spp. recovered from Corvus brachyrhynchos and Corvus corax roosting in Canada.}, journal = {Letters in applied microbiology}, volume = {67}, number = {2}, pages = {130-135}, doi = {10.1111/lam.12993}, pmid = {29675942}, issn = {1472-765X}, abstract = {The spread of antimicrobial resistance from human activity derived sources to natural habitats implicates wildlife as potential vectors of antimicrobial resistance transfer. Wild birds, including corvid species can disseminate mobile genetic resistance determinants through faeces. This study aimed to determine the occurrence of plasmid-mediated quinolone resistance (PMQR) genes in Escherichia coli and Klebsiella spp. isolates obtained from winter roosting sites of American crows (Corvus brachyrhynchos) and common ravens (Corvus corax) in Canada. Faecal swabs were collected at five roosting sites across Canada. Selective media isolation and multiplex PCR screening was utilized to identify PMQR genes followed by gene sequencing, pulse-field gel electrophoresis and multilocus sequence typing to characterize isolates. Despite the low prevalence of E. coli containing PMQR (1·3%, 6/449), qnrS1, qnrB19, qnrC, oqxAB and aac(6')-Ib-cr genes were found in five sequence types (ST), including E. coli ST 131. Conversely, one isolate of Klebsiella pneumoniae contained the plasmid-mediated resistance gene qnrB19. Five different K. pneumoniae STs were identified, including two novel types. The occurrence of PMQR genes and STs of public health significance in E. coli and Klebsiella pneumoniae recovered from corvids gives further evidence of the anthropogenic derived dissemination of antimicrobial resistance determinants at the human activity-wildlife-environment interface.<br><br>This study examined large corvids as possible vector species for the dissemination of antimicrobial resistance in indicator and pathogenic bacteria as a means to assess the anthropogenic dissemination of plasmid-mediated quinolone resistance (PMQR) genes. Although rare, PMQR genes were found among corvid populations across Canada. The clinically important Escherichia coli strain ST131 containing aac(6')-Ib-cr gene along with a four-class phenotypic antimicrobial resistance (AMR) pattern as well as one Klebsiella pneumoniae strain containing a qnrB19 gene were identified in one geographical location. Corvids are a viable vector for the circulation of PMQR genes and clinically important clones in wide-ranging environments.}, }
@article {pmid29675138, year = {2018}, author = {Hu, L and Jiang, L and Bi, K and Liao, H and Yang, Z and Huang, X and Bao, Z}, title = {Genomic in situ hybridization in interspecific hybrids of scallops (Bivalvia, Pectinidae) and localization of the satellite DNA Cf303, and the vertebrate telomeric sequences (TTAGGG)n on chromosomes of scallop Chlamys farreri (Jones &amp; Preston, 1904).}, journal = {Comparative cytogenetics}, volume = {12}, number = {1}, pages = {83-95}, doi = {10.3897/CompCytogen.v12i1.14995}, pmid = {29675138}, issn = {1993-0771}, abstract = {Mitotic chromosome preparations of the interspecific hybrids Chlamys farreri (Jones &amp; Preston, 1904) × Patinopecten yessoensis (Jay, 1857), C. farreri × Argopecten irradians (Lamarck, 1819) and C. farreri × Mimachlamys nobilis (Reeve, 1852) were used to compare two different scallop genomes in a single slide. Although genomic in situ hybridization (GISH) using genomic DNA from each scallop species as probe painted mitotic chromosomes of the interspecific hybrids, the painting results were not uniform; instead it showed species-specific distribution patterns of fluorescent signals among the chromosomes. The most prominent GISH-bands were mainly located at centromeric or telomeric regions of scallop chromosomes. In order to illustrate the sequence constitution of the GISH-bands, the satellite Cf303 sequences of C. farreri and the vertebrate telomeric (TTAGGG)n sequences were used to map mitotic chromosomes of C. farreri by fluorescence in situ hybridization (FISH). The results indicated that the GISH-banding pattern presented by the chromosomes of C. farreri is mainly due to the distribution of the satellite Cf303 DNA, therefore suggesting that the GISH-banding patterns found in the other three scallops could also be the result of the chromosomal distribution of other species-specific satellite DNAs.}, }
@article {pmid29674990, year = {2018}, author = {Ibernon, L and Touchet, C and Pochon, R}, title = {Emotion Recognition as a Real Strength in Williams Syndrome: Evidence From a Dynamic Non-verbal Task.}, journal = {Frontiers in psychology}, volume = {9}, number = {}, pages = {463}, doi = {10.3389/fpsyg.2018.00463}, pmid = {29674990}, issn = {1664-1078}, abstract = {The hypersocial profile characterizing individuals with Williams syndrome (WS), and particularly their attraction to human faces and their desire to form relationships with other people, could favor the development of their emotion recognition capacities. This study seeks to better understand the development of emotion recognition capacities in WS. The ability to recognize six emotions was assessed in 15 participants with WS. Their performance was compared to that of 15 participants with Down syndrome (DS) and 15 typically developing (TD) children of the same non-verbal developmental age, as assessed with Raven's Colored Progressive Matrices (RCPM; Raven et al., 1998). The analysis of the three groups' results revealed that the participants with WS performed better than the participants with DS and also than the TD children. Individuals with WS performed at a similar level to TD participants in terms of recognizing different types of emotions. The study of development trajectories confirmed that the participants with WS presented the same development profile as the TD participants. These results seem to indicate that the recognition of emotional facial expressions constitutes a real strength in people with WS.}, }
@article {pmid29673693, year = {2018}, author = {Mcleish, K and Ferguson, S and Gannicliffe, C and Campbell, S and Thomson, PIT and Webster, LMI}, title = {Profiling in wildlife crime: Recovery of human DNA deposited outside.}, journal = {Forensic science international. Genetics}, volume = {35}, number = {}, pages = {65-69}, doi = {10.1016/j.fsigen.2018.04.002}, pmid = {29673693}, issn = {1878-0326}, abstract = {Incidents of bird of prey persecution receive a lot of media coverage in the UK, with investigations rarely recovering sufficient evidence to proceed to prosecution. One of the main challenges is to identify a suspect, as these offences are carried out in remote locations without witnesses, and crime scenes may not be found for days. However, traps, poisoned baits and bird of prey carcasses can be recovered from these crime scenes. This study aimed to determine whether reportable human DNA profiles could be recovered from any of these substrates after periods of time outside. Experiments depositing human touch DNA on duplicate substrates (traps, rabbit baits and corvid carcasses) set for 0, 1, 2, 4, 7 and 10 days outside were carried out, with DNA recovery and profiling following standard operating procedures for Scottish Police Authority Forensic Services. Weather conditions varied among experiments, including some heavy rainfall. Results demonstrated that it was possible to obtain reportable DNA profiles from all substrates after at least 1 day outside. Most promisingly, the traps showed no drop-off in DNA persistence over the experiments as complete DNA profiles were obtained after the full 10 days outside. A further experiment using 4 bird of prey carcasses confirmed that it is possible to obtain reportable human DNA profiles from them after 1 day outside (n = 2 reportable profiles). These results show that touch DNA can persist in an outdoor environment, and provide a tantalising avenue for inquiry in bird of prey persecution investigations.}, }
@article {pmid29667522, year = {2018}, author = {Mendes, PVB and Gradim, LCC and Silva, NS and Allegretti, ALC and Carrijo, DCM and Cruz, DMCD}, title = {Pressure distribution analysis in three wheelchairs cushions of subjects with spinal cord injury.}, journal = {Disability and rehabilitation. Assistive technology}, volume = {}, number = {}, pages = {1-6}, doi = {10.1080/17483107.2018.1463399}, pmid = {29667522}, issn = {1748-3115}, abstract = {PURPOSE: Pressure injuries are a complication due to spinal cord injury. The objective of the study is to compare the pressure distribution in the wheelchair seat of subjects with spinal cord injury using 3 pads (Roho®, Varilite® and Varilite®).<br><br>METHODS: Pressure analysis was performed on 10 participants in two situations: (a) the participant sitting in static posture and (b) with the wheelchair being used for locomotion.<br><br>RESULTS: In the static position: Jay® showed the best rates for average pressure and also the contact area, the Roho® had the lowest average for the peak pressure. During the wheelchair moving, Jay® showed the best average pressure, Roho® had a lower average for peak pressure and Varilite® provided a highest means for the contact area of the buttocks and thighs.<br><br>CONCLUSIONS: The use of appropriate cushion is an effective measure in people with spinal cord injury. Implications for Rehabilitation Pressure injuries are a complication due to spinal cord injury. Study to compare the pressure distribution in the wheelchair seat of subjects with spinal cord injury is important to minimize the injuries resulting from pressure injuries. The comfort resulting from the use of the cushion suited to the demands of the subjects with spinal cord injury is fundamental for the process of rehabilitation and social participation of the people affected. Understanding and minimizing pressure points can contribute to the appropriate rehabilitation process.}, }
@article {pmid29666837, year = {2018}, author = {Meeker, AK}, title = {Cancer telomeres and white crows.}, journal = {American journal of clinical and experimental urology}, volume = {6}, number = {2}, pages = {93-100}, pmid = {29666837}, issn = {2330-1910}, abstract = {This mini-review article discusses past and present prostate-focused research on telomere and telomerase biology conducted at Johns Hopkins, through the eyes of a Donald S Coffey trainee. Included are past discoveries of abnormalities in telomere biology in the context of prostate cancer and its pre-malignant precursor prostatic intraepithelial neoplasia (PIN); the finding that telomerase activity is androgen-regulated in the prostate, and the potential role of telomerase in prostate epithelial stem cells. Also reviewed are more recent results showing that in situ telomere length measurements in patient tissue specimens may have utility in risk assessment and as a prognostic biomarker. Highlighted throughout the article are some of the training and mentorship approaches employed by the late Dr. Coffey, former Director of Urologic Research at the Brady Urological Research Institute, which inspired new research ideas, team science, and discovery.}, }
@article {pmid29666401, year = {2018}, author = {Montecino-Latorre, D and Barker, CM}, title = {Overwintering of West Nile virus in a bird community with a communal crow roost.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {6088}, doi = {10.1038/s41598-018-24133-4}, pmid = {29666401}, issn = {2045-2322}, abstract = {In temperate climates, transmission of West Nile virus (WNV) is detectable rarely during the coldest months (late fall through early spring), yet the virus has reappeared consistently during the next warm season. Several mechanisms may contribute to WNV persistence through winter, including bird-to-bird transmission among highly viremic species. Here we consider whether, under realistic scenarios supported by field and laboratory evidence, a winter bird community could sustain WNV through the winter in the absence of mosquitoes. With this purpose we constructed a deterministic model for a community of susceptible birds consisting of communally roosting crows, raptors and other birds. We simulated WNV introduction and subsequent transmission dynamics during the winter under realistic initial conditions and model parameterizations, including plausible contact rates for roosting crows. Model results were used to determine whether the bird community could yield realistic outbreaks that would result in WNV infectious individuals at the end of the winter, which would set up the potential for onward horizontal transmission into summer. Our findings strongly suggest that winter crow roosts could allow for WNV persistence through the winter, and our model results provide synthesis to explain inconclusive results from field studies on WNV overwintering in crow roosts.}, }
@article {pmid29657318, year = {2018}, author = {}, title = {Jays play nicely with the right hormone.}, journal = {Nature}, volume = {556}, number = {7701}, pages = {277}, doi = {10.1038/d41586-018-04436-2}, pmid = {29657318}, issn = {1476-4687}, }
@article {pmid29644612, year = {2018}, author = {Zarrintab, M and Mirzaei, R}, title = {Tissue distribution and oral exposure risk assessment of heavy metals in an urban bird: magpie from Central Iran.}, journal = {Environmental science and pollution research international}, volume = {25}, number = {17}, pages = {17118-17127}, doi = {10.1007/s11356-018-1642-x}, pmid = {29644612}, issn = {1614-7499}, abstract = {Direct ingestion of soil and/or soil attached to the food items is a potential rout for wildlife exposure to contaminants. In this study, bioaccumulation of five heavy metals (HMs) in internal tissues of an urban bird (Pica pica) collected from Aran-O-Bidgol City, Central Iran and their related soil were investigated. A total of 15 magpie specimens were collected in autumn 2013 and then their internal tissues were digested using a mixture of HNO3 and H2O2, and finally, concentrations of HMs were detected by ICP-OES. In addition, in order to show level of HM exposure risk to magpie, an exposure risk assessment was modeled. Results indicated that HMs were accumulated as follows: liver > kidney > muscle. Zn and Cu were significantly higher in magpie's tissues collected from agricultural site; on the other hand, Pb and Cd were significantly higher in industrial site (p < 0.05). Level of Cd in male's livers (2.11 μg/g dw) was significantly higher than in females (1.85 μg/g dw) (p < 0.05). Levels of Cd, Pb, and Ni in liver, muscle, and kidney, respectively, were significantly higher in adults than in subadults (p < 0.05). Soil exposure doses of all HMs were lower than tolerable daily intake (Zn 4.35, Cu 1.34, Ni 5.65, Pb 0.35, and Cd 0.53). The calculated hazard quotations (HQs) for HMs were as follows: Pb > Zn > Cu > Ni > Cd and for all HMs were at no risk level (HQ < 1). The amounts of hazard index for three sites were as follows: urban (1.032) > agriculture (0.943) ≥ industry (0.941) and only for urban area was at low risk (1 < HQ < 2). It seemed that birds living in a safe environment and/or HM contaminations in soil separately had no negative effects on magpies. We can also suggest that low levels of HMs in magpie's tissues can be due to low levels of HMs in soil.}, }
@article {pmid29643823, year = {2018}, author = {Gómez-Veiga, I and Vila Chaves, JO and Duque, G and García Madruga, JA}, title = {A New Look to a Classic Issue: Reasoning and Academic Achievement at Secondary School.}, journal = {Frontiers in psychology}, volume = {9}, number = {}, pages = {400}, doi = {10.3389/fpsyg.2018.00400}, pmid = {29643823}, issn = {1664-1078}, abstract = {Higher-order thinking abilities such as abstract reasoning and meaningful school learning occur sequentially. The fulfillment of these tasks demands that people activate and use all of their working memory resources in a controlled and supervised way. The aims of this work were: (a) to study the interplay between two new reasoning measures, one mathematical (Cognitive Reflection Test) and the other verbal (Deductive Reasoning Test), and a third classical visuo-spatial reasoning measure (Raven Progressive Matrices Test); and (b) to investigate the relationship between these measures and academic achievement. Fifty-one 4th grade secondary school students participated in the experiment and completed the three reasoning tests. Academic achievement measures were the final numerical scores in seven basic subjects. The results demonstrated that cognitive reflection, visual, and verbal reasoning are intimately related and predicts academic achievement. This work confirms that abstract reasoning constitutes the most important higher-order cognitive ability that underlies academic achievement. It also reveals the importance of dual processes, verbal deduction and metacognition in ordinary teaching and learning at school.}, }
@article {pmid29643220, year = {2018}, author = {Duque, JF and Leichner, W and Ahmann, H and Stevens, JR}, title = {Mesotocin influences pinyon jay prosociality.}, journal = {Biology letters}, volume = {14}, number = {4}, pages = {}, doi = {10.1098/rsbl.2018.0105}, pmid = {29643220}, issn = {1744-957X}, abstract = {Many species exhibit prosocial behaviour, in which one individual's actions benefit another individual, often without an immediate benefit to itself. The neuropeptide oxytocin is an important hormonal mechanism influencing prosociality in mammals, but it is unclear whether the avian homologue mesotocin plays a similar functional role in birds. Here, we experimentally tested prosociality in pinyon jays (Gymnorhinus cyanocephalus), a highly social corvid species that spontaneously shares food with others. First, we measured prosocial preferences in a prosocial choice task with two different pay-off distributions: Prosocial trials delivered food to both the subject and either an empty cage or a partner bird, whereas Altruism trials delivered food only to an empty cage or a partner bird (none to subject). In a second experiment, we examined whether administering mesotocin influenced prosocial preferences. Compared to choices in a control condition, we show that subjects voluntarily delivered food rewards to partners, but only when also receiving food for themselves (Prosocial trials), and administration of high levels of mesotocin increased these behaviours. Thus, in birds, mesotocin seems to play a similar functional role in facilitating prosocial behaviours as oxytocin does in mammals, suggesting an evolutionarily conserved hormonal mechanism for prosociality.}, }
@article {pmid29634743, year = {2018}, author = {Jiménez de Oya, N and Camacho, MC and Blázquez, AB and Lima-Barbero, JF and Saiz, JC and Höfle, U and Escribano-Romero, E}, title = {High susceptibility of magpie (Pica pica) to experimental infection with lineage 1 and 2 West Nile virus.}, journal = {PLoS neglected tropical diseases}, volume = {12}, number = {4}, pages = {e0006394}, doi = {10.1371/journal.pntd.0006394}, pmid = {29634743}, issn = {1935-2735}, mesh = {Animals ; Antibodies, Neutralizing/blood ; Antibodies, Viral/blood ; Bird Diseases/blood/transmission/*virology ; Culicidae/physiology/virology ; Disease Susceptibility ; Europe ; Female ; Male ; Mosquito Vectors/physiology/virology ; Pica/immunology/virology ; West Nile Fever/blood/transmission/*veterinary/virology ; West Nile virus/genetics/immunology/*physiology ; }, abstract = {West Nile virus (WNV), a zoonotic pathogen naturally transmitted by mosquitoes whose natural hosts are birds, has spread worldwide during the last few decades. Resident birds play an important role in flavivirus epidemiology, since they can serve as reservoirs and facilitate overwintering of the virus. Herein, we report the first experimental infection of magpie (Pica pica) with two strains of West Nile virus, lineages 1 (NY-99) and 2 (SRB Novi-Sad/12), which are currently circulating in Europe. Magpies were highly susceptible to WNV infection, with similar low survival rates (30% and 42.8%) for both lineages. All infected magpies developed viremia detectable at 3 days post-infection with titers above those necessary for successful transmission of WNV to a mosquito. Neutralizing antibodies were detected at all time points analyzed (from 7 to 17 days post-infection). WNV genome was detected in the brains and hearts of all magpies that succumbed to the infection, and, in some of the surviving birds. WNV-RNA was amplified from swabs (oral and cloacal) at 3, 6 and 7 days post-infection and feather pulps, from 3 to 17 days post-infection, of infected animals. Even more, infectious virus was recovered from swabs up to 7 days post-infection and from feather pulps up to 10 days post infection. Sham-infected control animals were negative for viremia, viral RNA, and antibodies. These results suggest that the magpie, which is one of the most abundant corvid species in Europe, could represent a source of WNV transmission for birds and humans. Our observations shed light on the pathogenesis, transmission, and ecology of WNV and can benefit the implementation of surveillance and control programs.}, }
@article {pmid29620454, year = {2018}, author = {Scott, AB and Phalen, D and Hernandez-Jover, M and Singh, M and Groves, P and Toribio, JLML}, title = {Wildlife Presence and Interactions with Chickens on Australian Commercial Chicken Farms Assessed by Camera Traps.}, journal = {Avian diseases}, volume = {62}, number = {1}, pages = {65-72}, doi = {10.1637/11761-101917-Reg.1}, pmid = {29620454}, issn = {1938-4351}, abstract = {The types of wildlife and the frequency of their visits to commercial chicken farms in Australia were assessed using infrared and motion-sensing camera traps. Cameras were set up on 14 free-range layer farms, three cage layer farms, two barn layer farms, five non-free-range meat chicken farms, and six free-range meat chicken farms in the Sydney basin region and South East Queensland. Wildlife visits were found on every farm type and were most frequent on cage layer farms (73%), followed by free-range layer farms (15%). The common mynah (Acridotheres tristis) was the most frequent wildlife visitor in the study (23.9%), followed by corvids (22.9%) and Columbiformes (7.5%). Most wildlife visits occurred during the day from 6 am to 6 pm (85%). There were infrequent observations of direct contact between chickens and wildlife, suggesting the indirect route of pathogen transfer may be more significant. The level of biosecurity on the farm is suggested to impact the frequency of wildlife visits more so than the farm type.}, }
@article {pmid29601669, year = {2018}, author = {Boonekamp, JJ and Mulder, E and Verhulst, S}, title = {Canalisation in the wild: effects of developmental conditions on physiological traits are inversely linked to their association with fitness.}, journal = {Ecology letters}, volume = {21}, number = {6}, pages = {857-864}, doi = {10.1111/ele.12953}, pmid = {29601669}, issn = {1461-0248}, abstract = {Ecological conditions affect fitness, but mechanisms causing such effects are not well known, while evolved responses to environmental variation may depend on the underlying mechanisms. Consequences of environmental conditions vary strongly between traits, but a framework to interpret such variation is lacking. We propose that variation in trait response may be explained by differential canalisation, with traits with larger fitness effects showing weaker responses to environmental perturbations due to preferential resource allocation to such traits. We tested the canalisation hypothesis using brood size manipulation in wild jackdaw nestlings in which we measured eight physiological traits (mainly oxidative stress markers), and two feather traits. For each trait, we estimated manipulation response and association with fitness (over-winter survival). As predicted, a strong negative correlation emerged between manipulation response and association with fitness (r =-0.76). We discuss the consequences of differential trait canalisation for the study of mechanisms mediating environmental effects on fitness.}, }
@article {pmid29579052, year = {2018}, author = {, }, title = {Correction: MAGPIE: Simplifying access and execution of computational models in the life sciences.}, journal = {PLoS computational biology}, volume = {14}, number = {3}, pages = {e1006083}, doi = {10.1371/journal.pcbi.1006083}, pmid = {29579052}, issn = {1553-7358}, abstract = {[This corrects the article DOI: 10.1371/journal.pcbi.1005898.].}, }
@article {pmid29576946, year = {2018}, author = {Brecht, KF and Ostojić, L and Legg, EW and Clayton, NS}, title = {Difficulties when using video playback to investigate social cognition in California scrub-jays (Aphelocoma californica).}, journal = {PeerJ}, volume = {6}, number = {}, pages = {e4451}, doi = {10.7717/peerj.4451}, pmid = {29576946}, issn = {2167-8359}, abstract = {Previous research has suggested that videos can be used to experimentally manipulate social stimuli. In the present study, we used the California scrub-jays' cache protection strategies to assess whether video playback can be used to simulate conspecifics in a social context. In both the lab and the field, scrub-jays are known to exhibit a range of behaviours to protect their caches from potential pilferage by a conspecific, for example by hiding food in locations out of the observer's view or by re-caching previously made caches once the observer has left. Here, we presented scrub-jays with videos of a conspecific observer as well as two non-social conditions during a caching period and assessed whether they would cache out of the observer's &quot;view&quot; (Experiment 1) or would re-cache their caches once the observer was no longer present (Experiment 2). In contrast to previous studies using live observers, the scrub-jays' caching and re-caching behaviour was not influenced by whether the observer was present or absent. These findings suggest that there might be limitations in using video playback of social agents to mimic real-life situations when investigating corvid decision making.}, }
@article {pmid29569788, year = {2018}, author = {Krause, A and Pugh, TAM and Bayer, AD and Li, W and Leung, F and Bondeau, A and Doelman, JC and Humpenöder, F and Anthoni, P and Bodirsky, BL and Ciais, P and Müller, C and Murray-Tortarolo, G and Olin, S and Popp, A and Sitch, S and Stehfest, E and Arneth, A}, title = {Large uncertainty in carbon uptake potential of land-based climate-change mitigation efforts.}, journal = {Global change biology}, volume = {24}, number = {7}, pages = {3025-3038}, doi = {10.1111/gcb.14144}, pmid = {29569788}, issn = {1365-2486}, abstract = {Most climate mitigation scenarios involve negative emissions, especially those that aim to limit global temperature increase to 2°C or less. However, the carbon uptake potential in land-based climate change mitigation efforts is highly uncertain. Here, we address this uncertainty by using two land-based mitigation scenarios from two land-use models (IMAGE and MAgPIE) as input to four dynamic global vegetation models (DGVMs; LPJ-GUESS, ORCHIDEE, JULES, LPJmL). Each of the four combinations of land-use models and mitigation scenarios aimed for a cumulative carbon uptake of ~130 GtC by the end of the century, achieved either via the cultivation of bioenergy crops combined with carbon capture and storage (BECCS) or avoided deforestation and afforestation (ADAFF). Results suggest large uncertainty in simulated future land demand and carbon uptake rates, depending on the assumptions related to land use and land management in the models. Total cumulative carbon uptake in the DGVMs is highly variable across mitigation scenarios, ranging between 19 and 130 GtC by year 2099. Only one out of the 16 combinations of mitigation scenarios and DGVMs achieves an equivalent or higher carbon uptake than achieved in the land-use models. The large differences in carbon uptake between the DGVMs and their discrepancy against the carbon uptake in IMAGE and MAgPIE are mainly due to different model assumptions regarding bioenergy crop yields and due to the simulation of soil carbon response to land-use change. Differences between land-use models and DGVMs regarding forest biomass and the rate of forest regrowth also have an impact, albeit smaller, on the results. Given the low confidence in simulated carbon uptake for a given land-based mitigation scenario, and that negative emissions simulated by the DGVMs are typically lower than assumed in scenarios consistent with the 2°C target, relying on negative emissions to mitigate climate change is a highly uncertain strategy.}, }
@article {pmid29567144, year = {2018}, author = {Wang, B and Sun, LD and Liu, HH and Wang, ZD and Zhao, YK and Wang, W and Liu, Q}, title = {Molecular detection of novel circoviruses in ticks in northeastern China.}, journal = {Ticks and tick-borne diseases}, volume = {9}, number = {4}, pages = {836-839}, doi = {10.1016/j.ttbdis.2018.03.017}, pmid = {29567144}, issn = {1877-9603}, abstract = {Novel circular single-stranded DNA (ssDNA) genomes have been found in various animals using high-throughput sequencing techniques. In this study, two circular ssDNA genomes were detected in adult ticks from northeastern China by Solexa sequencing and PCR. The two sequences shared a similar genomic organization to circoviruses, with genomes of 1936 bp (TiCV-1) and 1812 bp (TiCV-2), each including two major open read frames (ORFs), ORF1 and ORF2, encoding putative replicase and capsid proteins, respectively. The potential stem-loop structure of a circovirus was predicted in the intergenic region between the two ORFs. Sequence comparison showed that the genome of TiCV-2 was almost the same as that of TiCV-1, except for two deletions and several mutations, and they had a high identity of 71.3-72.9% with Raven circovirus. The infection rates of circoviruses were calculated by the maximum likelihood estimation as 3.2% (95% CI, 1.9-5.2%) for TiCV-1 in the investigated Haemaphysalis longicornis, and 1.2% (95% CI, 0.2-4.0%) for TiCV-2 in Ixodes crenulatus from Yichun of Heilongjiang Province. These results indicate that the two sequences are distantly related to known circovirus genomes and may represent novel species in the family Circoviridae.}, }
@article {pmid29563949, year = {2018}, author = {Boeckle, M and Szipl, G and Bugnyar, T}, title = {Raven food calls indicate sender's age and sex.}, journal = {Frontiers in zoology}, volume = {15}, number = {}, pages = {5}, doi = {10.1186/s12983-018-0255-z}, pmid = {29563949}, issn = {1742-9994}, abstract = {Background: Acoustic parameters of animal signals have been shown to correlate with various phenotypic characteristics of the sender. These acoustic characteristics can be learned and categorized and thus are a basis for perceivers' recognition abilities. One of the most demanding capacities is individual recognition, achievable only after repeated interactions with the same individual. Still, class-level recognition might be potentially important to perceivers who have not previously encountered callers but can classify unknown individuals according to the already learned categories. Especially for species with high fission-fusion dynamics that repeatedly encounter unknown individuals it may be advantageous to develop class-level recognition. We tested whether frequency-, temporal-, and amplitude-related acoustic parameters of vocalizations emitted by ravens, a species showing high fission-fusion dynamics in non-breeder aggregations, are connected to phenotypic characteristics and thus have the potential for class-level recognition.<br><br>Results: The analysis of 418 food calls revealed that some components summarizing acoustic parameters were differentiated by age-classes and sex.<br><br>Conclusions: Together, the results provide evidence for the co-variation of vocal characteristics and respective sex and age categories, a prerequisite for class-level recognition in perceivers. Perceivers that are ignorant of the caller's identity can thus potentially recognize these class-level differences for decision-making processes in feeding contexts.}, }
@article {pmid29561815, year = {2018}, author = {Doyle, JT and Kindness, L and Realbird, J and Eggers, MJ and Camper, AK}, title = {Challenges and Opportunities for Tribal Waters: Addressing Disparities in Safe Public Drinking Water on the Crow Reservation in Montana, USA.}, journal = {International journal of environmental research and public health}, volume = {15}, number = {4}, pages = {}, doi = {10.3390/ijerph15040567}, pmid = {29561815}, issn = {1660-4601}, abstract = {Disparities in access to safe public drinking water are increasingly being recognized as contributing to health disparities and environmental injustice for vulnerable communities in the United States. As the Co-Directors of the Apsaálooke Water and Wastewater Authority (AWWWA) for the Crow Tribe, with our academic partners, we present here the multiple and complex challenges we have addressed in improving and maintaining tribal water and wastewater infrastructure, including the identification of diverse funding sources for infrastructure construction, the need for many kinds of specialized expertise and long-term stability of project personnel, ratepayer difficulty in paying for services, an ongoing legacy of inadequate infrastructure planning, and lack of water quality research capacity. As a tribal entity, the AWWWA faces additional challenges, including the complex jurisdictional issues affecting all phases of our work, lack of authority to create water districts, and additional legal and regulatory gaps-especially with regards to environmental protection. Despite these obstacles, the AWWWA and Crow Tribe have successfully upgraded much of the local water and wastewater infrastructure. We find that ensuring safe public drinking water for tribal and other disadvantaged U.S. communities will require comprehensive, community-engaged approaches across a broad range of stakeholders to successfully address these complex legal, regulatory, policy, community capacity, and financial challenges.}, }
@article {pmid29552564, year = {2018}, author = {Carrasco-Garcia, R and Barroso, P and Perez-Olivares, J and Montoro, V and Vicente, J}, title = {Consumption of Big Game Remains by Scavengers: A Potential Risk as Regards Disease Transmission in Central Spain.}, journal = {Frontiers in veterinary science}, volume = {5}, number = {}, pages = {4}, doi = {10.3389/fvets.2018.00004}, pmid = {29552564}, issn = {2297-1769}, abstract = {Understanding the role that facultative scavenger species may play in spreading infectious pathogens, and even becoming reservoirs for humans, domestic and wild ungulates or, on the contrary, preventing the spread of disease, requires a prior understanding of the pattern of carrion scavenging in specific scenarios. The objectives of this paper are (i) to describe the guild of vertebrate scavengers and (ii) to study the species-specific, habitat, and management-related factors involved in the usage of gut piles in South Central Spain (SCS), a tuberculosis (TB) endemic area. We used camera trapping at 18 hunting piles on seven hunting estates. A total of eight bird and five mammal taxa were detected at the remains of hunting piles. The most frequently detected species in terms of number of gut piles visited (78%) and scavenged (61%) was the red fox Vulpes vulpes, followed by the griffon vulture Gyps fulvus (56% as regards both presence and scavenging) and the raven Corvus corax (61 and 39% as regards presence and scavenging, respectively). We evidenced that griffon vultures accounted for most of the scavenging activity in open habitats, while facultative mammal scavengers, red fox, and wild boar Sus scrofa made the highest contribution to scavenging in vegetation-covered habitats. In the case of wild boar, the gut piles deposited during the evening and night favored higher rates of scavenging, while the opposite pattern was observed for griffons. Overall, our findings suggest that when disposing of hunting remains in areas of risk as regards disease transmission it is particularly important to consider the access that facultative mammals, and especially wild boar, have to material, while the presence of the resource needs to be safeguarded to protect specialist scavengers of conservation value. These results are of particular relevance in the case of wild boar in the current context of re-emerging TB and emerging African swine fever (ASF) in Europe.}, }
@article {pmid29551415, year = {2018}, author = {Wagener, L and Loconsole, M and Ditz, HM and Nieder, A}, title = {Neurons in the Endbrain of Numerically Naive Crows Spontaneously Encode Visual Numerosity.}, journal = {Current biology : CB}, volume = {28}, number = {7}, pages = {1090-1094.e4}, doi = {10.1016/j.cub.2018.02.023}, pmid = {29551415}, issn = {1879-0445}, abstract = {Endowed with an elaborate cerebral cortex, humans and other primates can assess the number of items in a set, or numerosity, from birth on [1] and without being trained [2]. Whether spontaneous numerosity extraction is a unique feat of the mammalian cerebral cortex [3-7] or rather an adaptive property that can be found in differently designed and independently evolved neural substrates, such as the avian enbrain [8], is unknown. To address this question, we recorded single-cell activity from the nidopallium caudolaterale (NCL), a high-level avian association brain area [9-11], of numerically naive crows. We found that a proportion of NCL neurons were spontaneously responsive to numerosity and tuned to the number of items, even though the crows were never trained to assess numerical quantity. Our data show that numerosity-selective neuronal responses are spontaneously present in the distinct endbrains of diverge vertebrate taxa. This seemingly hard-wired property of the avian endbrain to extract numerical quantity explains how birds in the wild, or right after hatching, can exploit numerical cues when making foraging or social decisions. It suggests that endbrain circuitries that evolved based on convergent evolution, such as the avian endbrain, give rise to the same numerosity code.}, }
@article {pmid29548501, year = {2018}, author = {Merzagora, I and Amadasi, A and Blandino, A and Travaini, G}, title = {The expert and the foreigner: Reflections of forensic transcultural psychopathology on a total of 86 reports by experts on criminal liability.}, journal = {International journal of law and psychiatry}, volume = {57}, number = {}, pages = {24-30}, doi = {10.1016/j.ijlp.2017.12.005}, pmid = {29548501}, issn = {1873-6386}, abstract = {In recent times Italy has been experiencing massive migration flows, therefore the attention on the issue of crimes committed by foreigners is increasing. But within trials, in the evaluation of criminal liability of foreigners, how do experts deal with them? Do the performed evaluations take cultural diversity into account? The present study took origin from these questions and examined a total of 86 reports by experts on criminal liability of foreign persons (16 females and 70 males). Examinees have been declared indictable in 31 cases (36%), totally mentally ill in 40 cases (45%) and with diminished liability in 15 cases (17%); when liability was excluded, examinees were diagnosed in 11 cases with mood disorders, in 23 cases with personality disorders, in 4 cases with adaptation disorders and post-traumatic stress disorder and in 10 cases with different diagnoses (in some cases more than one diagnosis was present). None of the reports used the section of the DSM concerning &quot;cultural framing&quot;. Tests were used in 48 surveys (56% of cases), with more tests for each examinee, for a total of 39 Rorschach, 14 Raven test, 8 Minnesota Multiphasic Personality Inventory - MMPI - 4 Wechsler Adult Intelligence Scale - WAIS - level test, 8 Thematic Apperception test. When subjects were diagnosed with mental disorder and with diminished liability, 42 (79%) were also socially dangerous. Results highlight the importance of the relationship between the expert and the foreigner. Many factors ought to be critically considered by experts dealing with foreigners, like cultural awareness, knowledge of verbal communication, critical consideration of meanings and diagnosis, knowledge of the foreigners' personal story, presence of tests with inexact information and cultural fallacy.}, }
@article {pmid29532636, year = {2018}, author = {Summa, M and Henttonen, H and Maunula, L}, title = {Human noroviruses in the faeces of wild birds and rodents-new potential transmission routes.}, journal = {Zoonoses and public health}, volume = {65}, number = {5}, pages = {512-518}, doi = {10.1111/zph.12461}, pmid = {29532636}, issn = {1863-2378}, abstract = {Human noroviruses (HuNoVs) are one of the leading global causes of diarrhoeal diseases and are transmitted mainly from person to person but also through contaminated food, water and fomites. The possible zoonotic nature of NoVs has occasionally been discussed, although the viruses are generally considered to be host-species-specific. We investigated whether wild birds and rodents could serve as carriers of HuNoVs, thereby transmitting the virus to humans directly or indirectly by contaminating foods. All samples, 115 avian and 100 rat faeces collected in springs 2009-2013 from dump sites, and 85 faeces from yellow-necked mice trapped in late autumn 2008 and 2009 after the rodents entered human settlements due to the first night frosts, were screened for HuNoV using real-time reverse transcription PCR. HuNoVs were detected in 31 (27%) faecal samples of wild birds, in two (2%) faecal samples of rats and in no samples of mice. Most (25) of the positive bird samples and both rat samples contained genogroup II, and six positive bird samples contained genogroup I HuNoV. The avian species shedding faeces containing HuNoVs were identified as gulls and crows using DNA barcoding. Our results show that wildlife, birds and rats in particular, is capable of spreading HuNoVs in the environment.}, }
@article {pmid29528812, year = {2018}, author = {Lawton, SJ and Weis, AM and Byrne, BA and Fritz, H and Taff, CC and Townsend, AK and Weimer, BC and Mete, A and Wheeler, S and Boyce, WM}, title = {Comparative analysis of Campylobacter isolates from wild birds and chickens using MALDI-TOF MS, biochemical testing, and DNA sequencing.}, journal = {Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc}, volume = {30}, number = {3}, pages = {354-361}, doi = {10.1177/1040638718762562}, pmid = {29528812}, issn = {1943-4936}, abstract = {Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was compared to conventional biochemical testing methods and nucleic acid analyses (16S rDNA sequencing, hippurate hydrolysis gene testing, whole genome sequencing [WGS]) for species identification of Campylobacter isolates obtained from chickens (Gallus gallus domesticus, n = 8), American crows (Corvus brachyrhynchos, n = 17), a mallard duck (Anas platyrhynchos, n = 1), and a western scrub-jay (Aphelocoma californica, n = 1). The test results for all 27 isolates were in 100% agreement between MALDI-TOF MS, the combined results of 16S rDNA sequencing, and the hippurate hydrolysis gene PCR (p = 0.0027, kappa = 1). Likewise, the identifications derived from WGS from a subset of 14 isolates were in 100% agreement with the MALDI-TOF MS identification. In contrast, biochemical testing misclassified 5 isolates of C. jejuni as C. coli, and 16S rDNA sequencing alone was not able to differentiate between C. coli and C. jejuni for 11 sequences (p = 0.1573, kappa = 0.0857) when compared to MALDI-TOF MS and WGS. No agreement was observed between MALDI-TOF MS dendrograms and the phylogenetic relationships revealed by rDNA sequencing or WGS. Our results confirm that MALDI-TOF MS is a fast and reliable method for identifying Campylobacter isolates to the species level from wild birds and chickens, but not for elucidating phylogenetic relationships among Campylobacter isolates.}, }
@article {pmid29517437, year = {2018}, author = {Carrera-Játiva, PD and Morgan, ER and Barrows, M and Wronski, T}, title = {GASTROINTESTINAL PARASITES IN CAPTIVE AND FREE-RANGING BIRDS AND POTENTIAL CROSS-TRANSMISSION IN A ZOO ENVIRONMENT.}, journal = {Journal of zoo and wildlife medicine : official publication of the American Association of Zoo Veterinarians}, volume = {49}, number = {1}, pages = {116-128}, doi = {10.1638/2016-0279R1.1}, pmid = {29517437}, issn = {1042-7260}, abstract = {Gastrointestinal parasites are commonly reported in wild birds, but transmission amongst avifauna in zoological settings, and between these captive birds and wild birds in surrounding areas, remains poorly understood. A survey was undertaken to investigate the occurrence of gastrointestinal parasites in captive and free-ranging birds at Bristol Zoo Gardens between May and July 2016. A total of 348 fecal samples from 32 avian species were examined using the Mini-FLOTAC flotation method. Parasites were detected in 31% (45/145) of samples from captive birds and in 65.5% (133/203) of samples from free-ranging birds. Parasites of captive individuals included ascarids (Heterakis spp. and other morphotypes), capillarids, oxyurids, strongyles, a trematode, and protozoans (Eimeria spp., Isospora spp., Caryospora sp., and Entamoeba spp.). Parasites of free-ranging birds included ascarids (Ascaridia spp., Porrocaecum spp., and other morphotypes), capillarids, oxyurids, strongyles (Syngamus spp. and other morphotypes), cestodes (Choanotaenia spp., Hymenolepis spp., and other morphotypes), a trematode, and protozoans (Eimeria spp., Isospora spp., Entamoeba spp.). Similar types of parasites were detected in captive and free-ranging birds, but capillarid ova morphology was similar only between closely related species, eg in corvids (captive azure-winged magpies [ Cyanipica cyana] and wild jackdaws [ Corvus monedula]) and between wild columbids (collared doves [ Streptopelia decaocto], rock doves [ Columba livia], and wood pigeons [ Columba palumbus]). The prevalence and intensity of nematodes and coccidia in birds housed outdoors did not differ statistically from species housed indoors. Results indicate that captive and free-ranging birds may share parasites when closely related, but this would need to be confirmed by the study of adult specimens and molecular tests. Determining which parasites are present in captive and free-ranging species in zoological parks will support the establishment of effective husbandry practices to maintain the health status of managed species.}, }
@article {pmid29514988, year = {2018}, author = {Xiao, M and Chen, W and Li, W and Zhao, J and Hong, YL and Nishiyama, Y and Miyoshi, T and Shawkey, MD and Dhinojwala, A}, title = {Elucidation of the hierarchical structure of natural eumelanins.}, journal = {Journal of the Royal Society, Interface}, volume = {15}, number = {140}, pages = {}, doi = {10.1098/rsif.2018.0045}, pmid = {29514988}, issn = {1742-5662}, abstract = {Eumelanin is one of the most ubiquitous pigments in living organisms and plays an important role in coloration and UV protection. Because eumelanin is highly cross-linked and insoluble in solvents, the chemical structure is still not completely known. In this study, we used atomic force microscopy, X-ray photoelectron spectroscopy and solid-state nuclear magnetic resonance (NMR) to compare intact eumelanosomes (pigment granules mostly made of eumelanin) from four phylogentically distant species: cuttlefish (Sepia officinalis) inks, black fish crow (Corvus ossifragus) feathers, iridescent wild turkey (Melleagris gallopavo) feathers and black human hair. We found that eumelanosomes from all four species are composed of subunit nanoparticles with a length of 10-60 nm, consistent with earlier observations in eumelanosomes from the sepia ink and human hair. The solid-state NMR results indicate the presence of quinone methide tautomers in all four eumelanins. We also found clear differences in the UV absorbance, the ratio of 5,6-dihydroxyindole-2-carboxylic acid/5,6-dihydroxyindole and protonated aryl carbon ratios in sepia eumelanin relative to the other three. This comparison of natural eumelanin across a phylogenetically broad group of organisms provides insights into the change in the eumelanin structure over the evolutionary history and enables the production of synthetic eumelanin with properties that are similar to natural eumelanin.}, }
@article {pmid29506438, year = {2018}, author = {Hofmeister, EK and Lund, M and Shearn Bochsler, V}, title = {West Nile Virus Infection in American Singer Canaries: An Experimental Model in a Highly Susceptible Avian Species.}, journal = {Veterinary pathology}, volume = {55}, number = {4}, pages = {531-538}, doi = {10.1177/0300985818760377}, pmid = {29506438}, issn = {1544-2217}, abstract = {This study investigated the susceptibility of American singer canaries (Serinus canaria) to West Nile virus (WNV) infection. Adult canaries were inoculated with 105, 102, and 101 plaque forming units (PFU) of WNV. All birds became infected and mortality occurred by 5 days postinoculation. The load of viral RNA as determined by RT-qPCR was dose dependent, and was higher at all doses than the level of viral RNA detected in American crows (Corvus brachyrhynchos) challenged with 105 PFU of WNV. In a subset of birds, viremia was detected by virus isolation; canaries inoculated with 101 PFU of WNV developed viremia exceeding 1010 PFU/mL serum, a log higher than American crows inoculated with 105 PFU of virus. In canaries euthanized at 3 days postinoculation, WNV was isolated at >107 PFU of virus/100 mg of lung, liver, heart, spleen, and kidney tissues. Pallor of the liver and splenomegaly were the most common macroscopic observations and histologic lesions were most severe in liver, spleen, and kidney, particularly in canaries challenged with 102 and 101 PFU. Immunoreactivity to WNV was pronounced in the liver and spleen. IgG antibodies to WNV were detected in serum by enzyme immunoassay in 11 of 21 (52%) challenged canaries and, in 4 of 5 (20%) of these sera, neutralization antibodies were detected at a titer ≥ 1:20. American singer canaries provide a useful model as this bird species is highly susceptible to WNV infection.}, }
@article {pmid29500409, year = {2018}, author = {Kearns, AM and Restani, M and Szabo, I and Schrøder-Nielsen, A and Kim, JA and Richardson, HM and Marzluff, JM and Fleischer, RC and Johnsen, A and Omland, KE}, title = {Genomic evidence of speciation reversal in ravens.}, journal = {Nature communications}, volume = {9}, number = {1}, pages = {906}, doi = {10.1038/s41467-018-03294-w}, pmid = {29500409}, issn = {2041-1723}, mesh = {Animals ; Breeding ; Crows/*genetics ; DNA, Mitochondrial/genetics ; Gene Flow ; *Genetic Speciation ; *Genome ; *Genomics ; Geography ; Hybridization, Genetic ; Introns/genetics ; Mosaicism ; *Phylogeny ; Polymorphism, Single Nucleotide ; Reproductive Isolation ; Sequence Analysis, DNA ; }, abstract = {Many species, including humans, have emerged via complex reticulate processes involving hybridisation. Under certain circumstances, hybridisation can cause distinct lineages to collapse into a single lineage with an admixed mosaic genome. Most known cases of such 'speciation reversal' or 'lineage fusion' involve recently diverged lineages and anthropogenic perturbation. Here, we show that in western North America, Common Ravens (Corvus corax) have admixed mosaic genomes formed by the fusion of non-sister lineages ('California' and 'Holarctic') that diverged ~1.5 million years ago. Phylogenomic analyses and concordant patterns of geographic structuring in mtDNA, genome-wide SNPs and nuclear introns demonstrate long-term admixture and random interbreeding between the non-sister lineages. In contrast, our genomic data support reproductive isolation between Common Ravens and Chihuahuan Ravens (C. cryptoleucus) despite extensive geographic overlap and a sister relationship between Chihuahuan Ravens and the California lineage. These data suggest that the Common Raven genome was formed by secondary lineage fusion and most likely represents a case of ancient speciation reversal that occurred without anthropogenic causes.}, }
@article {pmid29499250, year = {2018}, author = {Luo, Y and Zhang, L and Teng, Z and DeAngelis, DL}, title = {A parasitism-mutualism-predation model consisting of crows, cuckoos and cats with stage-structure and maturation delays on crows and cuckoos.}, journal = {Journal of theoretical biology}, volume = {446}, number = {}, pages = {212-228}, doi = {10.1016/j.jtbi.2018.02.028}, pmid = {29499250}, issn = {1095-8541}, abstract = {In this paper, a parasitism-mutualism-predation model is proposed to investigate the dynamics of multi-interactions among cuckoos, crows and cats with stage-structure and maturation time delays on cuckoos and crows. The crows permit the cuckoos to parasitize their nestlings (eggs) on the crow chicks (eggs). In return, the cuckoo nestlings produce a malodorous cloacal secretion to protect the crow chicks from predation by the cats, which is apparently beneficial to both the crow and cuckoo population. The multi-interactions, i.e., parasitism and mutualism between the cuckoos (nestlings) and crows (chicks), predation between the cats and crow chicks are modeled both by Holling-type II and Beddington-DeAngelis-type functional responses. The existence of positive equilibria of three subsystems of the model are discussed. The criteria for the global stability of the trivial equilibrium are established by the Krein-Rutman theorem and other analysis methods. Moreover, the threshold dynamics for the coexistence and weak persistence of the model are obtained, and we show, both analytically and numerically, that the stabilities of the interior equilibria may change with the increasing maturation time delays. We find there exists an evident difference in the dynamical properties of the parasitism-mutualism-predation model based on whether or not we consider the effects of stage-structure and maturation time delays on cuckoos and crows. Inclusion of stage structure results in many varied dynamical complexities which are difficult to encompass without this inclusion.}, }
@article {pmid29493658, year = {2017}, author = {Boucherie, PH and Sosa, S and Pasquaretta, C and Dufour, V}, title = {Erratum: A longitudinal network analysis of social dynamics in rooks Corvus frugilegus: repeated group modifications do not affect social network in captive rooks.}, journal = {Current zoology}, volume = {63}, number = {4}, pages = {477}, doi = {10.1093/cz/zox045}, pmid = {29493658}, issn = {1674-5507}, abstract = {[This corrects the article DOI: 10.1093/cz/zow083.].}, }
@article {pmid29492785, year = {2018}, author = {Wright, AA and Kelly, DM and Katz, JS}, title = {Comparing cognition by integrating concept learning, proactive interference, and list memory.}, journal = {Learning &amp; behavior}, volume = {46}, number = {2}, pages = {107-123}, doi = {10.3758/s13420-018-0316-3}, pmid = {29492785}, issn = {1543-4508}, abstract = {This article describes an approach for training a variety of species to learn the abstract concept of same/different, which in turn forms the basis for testing proactive interference and list memory. The stimulus set for concept-learning training was progressively doubled from 8, 16, 32, 64, 128 . . . to 1,024 different pictures with novel-stimulus transfer following learning. All species fully learned the same/different abstract concept: capuchin and rhesus monkeys learned more readily than pigeons; nutcrackers and magpies were at least equivalent to monkeys and transferred somewhat better following initial training sets. A similar task using the 1,024-picture set plus delays was used to test proactive interference on occasional trials. Pigeons revealed greater interference with 10-s than with 1-s delays, whereas delay time had no effect on rhesus monkeys, suggesting that the monkeys' interference was event based. This same single-item same/different task was expanded to a 4-item list memory task to test animal list memory. Humans were tested similarly with lists of kaleidoscope pictures. Delays between the list and test were manipulated, resulting in strong initial recency effects (i.e., strong 4th-item memory) at short delays and changing to a strong primacy effect (i.e., strong 1st-item memory) at long delays (pigeons 0-s to 10-s delays; monkeys 0-s to 30-s delays; humans 0-s to 100-s delays). Results and findings are discussed in terms of these species' cognition and memory comparisons, evolutionary implications, and future directions for testing other species in these synergistically related tasks.}, }
@article {pmid29492692, year = {2018}, author = {Layton-Matthews, K and Ozgul, A and Griesser, M}, title = {The interacting effects of forestry and climate change on the demography of a group-living bird population.}, journal = {Oecologia}, volume = {186}, number = {4}, pages = {907-918}, doi = {10.1007/s00442-018-4100-z}, pmid = {29492692}, issn = {1432-1939}, abstract = {Anthropogenic degradation of natural habitats is a global driver of wildlife population declines. Local population responses to such environmental perturbations are generally well understood, but in socially structured populations, interactions between environmental and social factors may influence population responses. Thus, understanding how habitat degradation affects the dynamics of these populations requires simultaneous consideration of social and environmental mechanisms underlying demographic responses. Here we investigated the effect of habitat degradation through commercial forestry on spatiotemporal dynamics of a group-living bird, the Siberian jay, Perisoreus infaustus, in boreal forests of northern Sweden. We assessed the interacting effects of forestry, climate and population density on stage-specific, seasonal life-history rates and population dynamics, using long-term, individual-based demographic data from 70 territories in natural and managed forests. Stage-specific survival and reproductive rates, and consequently population growth, were lower in managed forests than in natural forests. Population growth was most sensitive to breeder survival and was more sensitive to early dispersing juveniles than those delaying dispersal. Forestry decreased population growth in managed forests by reducing reproductive success and breeder survival. Increased snow depth improved winter survival, and warmer spring temperatures enhanced reproductive success, particularly in natural forests. Population growth was stable in natural forests but it was declining in managed forests, and this difference accelerated under forecasted climate scenarios. Thus, climatic change could exacerbate the rate of forestry-induced population decline through reduced snow cover in our study species, and in other species with similar life-history characteristics and habitat requirements.}, }
@article {pmid29492018, year = {2017}, author = {Duron, Q and Bourguet, E and De Meringo, H and Millon, A and Vidal, E}, title = {Invasive rats strengthen predation pressure on bird eggs in a South Pacific island rainforest.}, journal = {Current zoology}, volume = {63}, number = {6}, pages = {583-590}, doi = {10.1093/cz/zox009}, pmid = {29492018}, issn = {1674-5507}, abstract = {Invasive rats (Rattus spp.) are known to have pervasive impacts on island birds, particularly on their nesting success. To conserve or restore bird populations, numerous invasive rat control or eradication projects are undertaken on islands worldwide. However, such projects represent a huge investment and the decision-making process requires proper assessment of rat impacts. Here, we assessed the influence of two sympatric invasive rats (Rattus rattus and R. exulans) on native bird eggs in a New Caledonian rainforest, using artificial bird-nest monitoring. A total of 178 artificial nests containing two eggs of three different sizes were placed either on the ground or 1.5 m high and monitored at the start of the birds' breeding season. Overall, 12.4% of the nests were depredated during the first 7 days. At site 1, where nests were monitored during 16 days, 41.8% of the nests were depredated. The main predator was the native crow Corvus moneduloides, responsible for 62.9% of the overall predation events. Rats were responsible for only 22.9% of the events, and ate only small and medium eggs at both heights. Our experiment suggests that in New Caledonia, predation pressure by rats strengthens overall bird-nest predation, adding to that by native predators. Experimental rat control operations may allow reduced predation pressure on nests as well as the recording of biodiversity responses after rat population reduction.}, }
@article {pmid29491998, year = {2017}, author = {Boucherie, PH and Sosa, S and Pasquaretta, C and Dufour, V}, title = {A longitudinal network analysis of social dynamics in rooks corvus frugilegus: repeated group modifications do not affect social network in captive rooks.}, journal = {Current zoology}, volume = {63}, number = {4}, pages = {379-388}, doi = {10.1093/cz/zow083}, pmid = {29491998}, issn = {1674-5507}, abstract = {Numerous studies have investigated the remarkable variation of social features and the resulting structures across species. Indeed, relationships are dynamic and vary in time according to various factors such as environmental conditions or individuals attributes. However, few studies have investigated the processes that stabilize the structures within a given species, and the behavioral mechanisms that ensure their coherence and continuity across time. Here, we used a dynamic actor-based model, RSiena, to investigate the consistency of the temporal dynamic of relationships of a group of captive rooks facing recurrent modifications in group composition (i.e., the loss and introduction of individuals). We found that changes in relationships (i.e., formation and removal) followed consistent patterns regardless of group composition and sex-ratio. Rooks preferentially interacted with paired congeners (i.e., unpopular attachment) and were more likely to form relationships with individuals bonded to a current social partner (i.e., &quot;friends of friends&quot;, or triadic closure). The sex of individuals had no effect on the dynamic of relationships. This robust behavioral mechanisms formed the basis of inter-connected networks, composed of sub-structures of individuals emerging from the enmeshment of dyadic and triadic motifs. Overall, the present study reveals crucial aspects of the behavioral mechanisms shaping rooks social structure, suggesting that rooks live in a well-integrated society, going far beyond the unique monogamous pair-bond.}, }
@article {pmid29491996, year = {2017}, author = {Pesendorfer, MB and Sillett, TS and Morrison, SA}, title = {Spatially biased dispersal of acorns by a scatter-hoarding corvid may accelerate passive restoration of oak habitat on California's largest island.}, journal = {Current zoology}, volume = {63}, number = {4}, pages = {363-367}, doi = {10.1093/cz/zow075}, pmid = {29491996}, issn = {1674-5507}, abstract = {Scatter hoarding by corvids (crows, jays, magpies, and nutcrackers) provides seed dispersal for many large-seeded plants, including oaks and pines. When hoarding seeds, corvids often choose nonrandom locations throughout the landscape, resulting in differential survival of seeds. In the context of habitat restoration, such disproportional storing of seeds in areas suitable for germination and establishment can accelerate expansion and recovery of large-seeded tree populations and their associated ecosystems. Here, we investigate the spatial preferences of island scrub jays Aphelocoma insularis during scatter hoarding of acorns (Quercus spp.) on Santa Cruz Island. We use a large behavioral data set on the birds' behavior in combination with seedling surveys and spatial analysis to determine whether 1) island scrub jays disproportionally cache seeds in specific habitat types, and 2) whether the preferred habitat type is suitable for oak regeneration. Our results show that the jays nonrandomly cache acorns across the landscape; they use chaparral and coastal sage scrub disproportionally while avoiding open and grassy areas. The areas used most often for caching were also the areas with the highest oak seedling densities. We discuss the potential role of these findings for the recovery of Santa Cruz Island's oak habitat since the 1980s.}, }
@article {pmid29491479, year = {2018}, author = {Bose, A and Dürr, T and Klenke, RA and Henle, K}, title = {Collision sensitive niche profile of the worst affected bird-groups at wind turbine structures in the Federal State of Brandenburg, Germany.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {3777}, doi = {10.1038/s41598-018-22178-z}, pmid = {29491479}, issn = {2045-2322}, abstract = {Biodiversity-related impacts at wind energy facilities have increasingly become a cause of conservation concern, central issue being the collision of birds. Utilizing spatial information of their carcass detections at wind turbines (WTs), we quantified the detections in relation to the metric distances of the respective turbines to different land-use types. We used ecological niche factor analysis (ENFA) to identify combinations of land-use distances with respect to the spatial allocation of WTs that led to higher proportions of collisions among the worst affected bird-groups: Buntings, Crows, Larks, Pigeons and Raptors. We also assessed their respective similarities to the collision phenomenon by checking for overlaps amongst their distance combinations. Crows and Larks showed the narrowest &quot;collision sensitive niche&quot;; a part of ecological niche under higher risk of collisions with turbines, followed by that of Buntings and Pigeons. Raptors had the broadest niche showing significant overlaps with the collision sensitive niches of the other groups. This can probably be attributed to their larger home range combined with their hunting affinities to open landscapes. Identification of collision sensitive niches could be a powerful tool for landscape planning; helping avoid regions with higher risks of collisions for turbine allocations and thus protecting sensitive bird populations.}, }
@article {pmid29491247, year = {2018}, author = {Okamura, M and Kaneko, M and Ojima, S and Sano, H and Shindo, J and Shirafuji, H and Yamamoto, S and Tanabe, T and Yoshikawa, Y and Hu, DL}, title = {Differential Distribution of Salmonella Serovars and Campylobacter spp. Isolates in Free-Living Crows and Broiler Chickens in Aomori, Japan.}, journal = {Microbes and environments}, volume = {33}, number = {1}, pages = {77-82}, doi = {10.1264/jsme2.ME17183}, pmid = {29491247}, issn = {1347-4405}, abstract = {Salmonella and Campylobacter cause foodborne enteritis mainly via the consumption of raw/undercooked contaminated poultry meat and products. Broiler flocks are primarily colonized with these bacteria; however, the underlying etiology remains unclear. The present study was conducted in order to obtain further information on the prevalence and genotypic distribution of Salmonella and Campylobacter in free-living crows and broiler flocks in a region for 2 years, thereby facilitating estimations of the potential risk of transmission of C. jejuni from crows to broiler flocks. Salmonella serovars Bredeney and Derby were isolated from 8 and 3 out of 123 captured crows, respectively, both of which are not common in broiler chickens. Campylobacter were isolated from all 89 crows tested and C. jejuni was prevalent (85 crows). Pulsed field gel electrophoresis showed broad diversity in the crow isolates of C. jejuni. However, 3 crow isolates and 2 broiler isolates showing similar banding patterns were assigned to different sequence types in multi-locus sequence typing. These results indicate that crows do not share Salmonella serovars with broilers, and harbor various genotypes of C. jejuni that differ from those of broiler flocks. Thus, our results indicate that crows are not a potential vector of these bacteria to broiler flocks in this region.}, }
@article {pmid29475319, year = {2018}, author = {Romero-García, S and Moscoso-Mártir, A and Müller, J and Shen, B and Merget, F and Witzens, J}, title = {Wideband multi-stage CROW filters with relaxed fabrication tolerances.}, journal = {Optics express}, volume = {26}, number = {4}, pages = {4723-4737}, pmid = {29475319}, issn = {1094-4087}, abstract = {We present wideband and large free spectral range optical filters with steep passband edges for the selection of adjacent WDM communication channels that can be reliably fabricated with mainstream silicon photonics technology. The devices are based on three cascaded stages of coupled resonator optical waveguides loaded on a common bus waveguide. These stages differ in the number of resonators but are implemented with exactly identical unit cells, comprised of a matched racetrack resonator layout and a uniform spacing between cells. The different number of resonators in each stage allows a high rejection in the through port response enabled by the interleaved distribution of zeros. Furthermore, the exact replication of a unique cell avoids the passband ripple and high lobes in the stopband that typically arise in apodized coupled resonator optical waveguide based filters due to fabrication and coupling induced variations in the effective path length of each resonator. Silicon photonics filters designed for the selection of 9 adjacent optical carriers generated by a 100 GHz free spectral range comb laser have been successfully fabricated with 248 nm DUV lithography, achieving an out-of-band rejection above 11 dB and an insertion loss of less than 0.5 dB for the worst channels.}, }
@article {pmid29458978, year = {2018}, author = {Prassack, KA and Pante, MC and Njau, JK and de la Torre, I}, title = {The paleoecology of Pleistocene birds from Middle Bed II, at Olduvai Gorge, Tanzania, and the environmental context of the Oldowan-Acheulean transition.}, journal = {Journal of human evolution}, volume = {120}, number = {}, pages = {32-47}, doi = {10.1016/j.jhevol.2017.11.003}, pmid = {29458978}, issn = {1095-8606}, abstract = {Fossil bird data (community composition and taphonomic profiles) are used here to infer the environmental context of the Oldowan-Acheulean transitional period at Olduvai Gorge, Tanzania. This is the first comprehensive report on the Middle Bed II avifauna and includes fossils excavated by the Olduvai Geochronology and Archaeology Project (OGAP) and recently rediscovered fossils collected by Mary Leakey. Crane, ibis, darter, owl, raptor, crow, and vulture are reported from Bed II for the first time. The presence of these taxa, absent earlier in this Bed, point to a general opening and drying of the landscape with grassland and open woodland expansion. Taxa associated with dense, emergent wetland vegetation, such as dabbling ducks and rails, are uncommon and less diverse than earlier in Bed II. This suggests more mature wetlands with clearer waters. Cormorants continue to be common, but are less diverse. Cormorants and other roosting taxa provide evidence of trees in the area. Compared to lowermost Bed II, the Middle to Upper Bed II landscape is interpreted here as more open and drier (but not necessarily more arid), with matured wetlands, scattered trees, and a greater expansion of grasslands.}, }
@article {pmid29457405, year = {2017}, author = {Xu, L and Hou, WK and Xu, P}, title = {[Morphology characteristics of sural bean bone and it's role in knee joint diseases].}, journal = {Zhongguo gu shang = China journal of orthopaedics and traumatology}, volume = {30}, number = {11}, pages = {1074-1076}, pmid = {29457405}, issn = {1003-0034}, mesh = {Humans ; Knee Joint ; Osteoarthritis, Knee/diagnosis/*pathology ; Sesamoid Bones/*pathology ; }, abstract = {Fabella is a common sesamoid bone. In recent years, people have paid more attention to its anatomic location, distribution characteristics in crow, importance in stabilizing knee joint and related diseases. This article reviews the anatomy, distribution and the relationship between the calf bone and the knee joint diseases, so as to strengthen the attention of the bones in the diagnosis and treatment of knee diseases.}, }
@article {pmid29456325, year = {2017}, author = {Singh, Y and Makharia, A and Sharma, A and Agrawal, K and Varma, G and Yadav, T}, title = {A study on different forms of intelligence in Indian school-going children.}, journal = {Industrial psychiatry journal}, volume = {26}, number = {1}, pages = {71-76}, doi = {10.4103/ipj.ipj_61_16}, pmid = {29456325}, issn = {0972-6748}, abstract = {Introduction: Most definitions of intelligence focus on capabilities that are relevant to scholastic performances. However, there are seven forms of intelligences. There is a lack of data on multiple intelligences in Indian children. Hence, this study was conducted to assess different forms of intelligences in students and compared these diverse intelligences with intelligence quotient (IQ) scores.<br><br>Materials and Methods: In this cross-sectional observational study, we recruited 1065 school children between the age of 12 and 16 years from two government and 13 private schools in five towns, six cities, and two villages across India. All the children were administered multiple intelligences questionnaire by Armstrong, consisting of thirty true/false types of questions to assess the intelligences of a child in seven domains including linguistic skills, logical/mathematical abilities, musical skills, spatial intelligence, bodily-kinesthetic skills, intrapersonal intelligence, and interpersonal intelligence. IQ scores were assessed by Ravens Standard Progressive Matrices.<br><br>Results: We found that different students possessed different forms of intelligences and most students had more than one forms of intelligence. Of seven forms of intelligence, only three forms of intelligence such as logical/mathematical, musical, and spatial were positively correlated with the IQ score.<br><br>Conclusions: Even in the children with low IQ, many students had other forms of intelligences. The IQ scores correlated with only logical/mathematical, spatial, and musical intelligence. Hence, tapping the intelligences of students can help enhance their learning process. Our curriculum should have an amalgamation of teaching for all kinds of intelligences for maximum productivity.}, }
@article {pmid29447156, year = {2018}, author = {Maharaj, PD and Bosco-Lauth, AM and Langevin, SA and Anishchenko, M and Bowen, RA and Reisen, WK and Brault, AC}, title = {West Nile and St. Louis encephalitis viral genetic determinants of avian host competence.}, journal = {PLoS neglected tropical diseases}, volume = {12}, number = {2}, pages = {e0006302}, doi = {10.1371/journal.pntd.0006302}, pmid = {29447156}, issn = {1935-2735}, support = {AI065359/NH/NIH HHS/United States ; AI061822/NH/NIH HHS/United States ; AI55607/NH/NIH HHS/United States ; }, mesh = {Animals ; Bird Diseases/immunology/mortality/transmission/*virology ; Cross Protection/immunology ; Crows/virology ; Encephalitis Virus, St. Louis/*genetics/immunology/physiology ; Encephalitis, Viral/immunology/transmission/*veterinary/virology ; Finches/virology ; Host-Pathogen Interactions ; Humans ; Phenotype ; Sparrows/virology ; Viral Nonstructural Proteins/genetics/immunology ; Viremia ; Virulence/genetics ; Virus Replication ; West Nile Fever/immunology/transmission/*veterinary/virology ; West Nile virus/*genetics/immunology/physiology ; }, abstract = {West Nile virus (WNV) and St. Louis encephalitis (SLEV) virus are enzootically maintained in North America in cycles involving the same mosquito vectors and similar avian hosts. However, these viruses exhibit dissimilar viremia and virulence phenotypes in birds: WNV is associated with high magnitude viremias that can result in mortality in certain species such as American crows (AMCRs, Corvus brachyrhynchos) whereas SLEV infection yields lower viremias that have not been associated with avian mortality. Cross-neutralization of these viruses in avian sera has been proposed to explain the reduced circulation of SLEV since the introduction of WNV in North America; however, in 2015, both viruses were the etiologic agents of concurrent human encephalitis outbreaks in Arizona, indicating the need to re-evaluate host factors and cross-neutralization responses as factors potentially affecting viral co-circulation. Reciprocal chimeric WNV and SLEV viruses were constructed by interchanging the pre-membrane (prM)-envelope (E) genes, and viruses subsequently generated were utilized herein for the inoculation of three different avian species: house sparrows (HOSPs; Passer domesticus), house finches (Haemorhous mexicanus) and AMCRs. Cross-protective immunity between parental and chimeric viruses were also assessed in HOSPs. Results indicated that the prM-E genes did not modulate avian replication or virulence differences between WNV and SLEV in any of the three avian species. However, WNV-prME proteins did dictate cross-protective immunity between these antigenically heterologous viruses. Our data provides further evidence of the important role that the WNV / SLEV viral non-structural genetic elements play in viral replication, avian host competence and virulence.}, }
@article {pmid29439508, year = {2018}, author = {Fareed, J and Bacher, P and Jeske, W}, title = {Advances in Heparins and Related Research. An Epilogue.}, journal = {Molecules (Basel, Switzerland)}, volume = {23}, number = {2}, pages = {}, doi = {10.3390/molecules23020390}, pmid = {29439508}, issn = {1420-3049}, mesh = {Animals ; Biomedical Research/*history ; Blood Coagulation/physiology ; Cattle ; Heparin/analogs &amp; derivatives/biosynthesis/history/*therapeutic use ; Heparin Antagonists/therapeutic use ; History, 20th Century ; History, 21st Century ; Humans ; Practice Guidelines as Topic ; Protamines/therapeutic use ; Quality Control ; Sheep ; Swine ; Thrombosis/blood/*drug therapy/history/physiopathology ; }, abstract = {The discovery of heparin in 1916 by Jay McLean, a medical student at Johns Hopkins University, not only provided a universal anticoagulant, but also laid the foundation for the discipline of hemostasis and thrombosis[...].}, }
@article {pmid29434390, year = {2018}, author = {Rale, VK and Kalia, VC}, title = {The Torch Bearer Microbiologist: Prof. J(Jay) Vakil (1927-2017).}, journal = {Indian journal of microbiology}, volume = {58}, number = {1}, pages = {1-2}, doi = {10.1007/s12088-018-0707-3}, pmid = {29434390}, issn = {0046-8991}, }
@article {pmid29430125, year = {2018}, author = {Marafi, FAR and Rasheed, R and Usmani, S and Alkandari, F and Iqbal, A}, title = {Significance of 18F-sodium Fluoride Positron Emission Tomography in Characterization of POEMS Osteosclerotic Lesions Better Than 18F-fluorodeoxyglucose Positron Emission Tomography.}, journal = {Indian journal of nuclear medicine : IJNM : the official journal of the Society of Nuclear Medicine, India}, volume = {33}, number = {1}, pages = {76-78}, doi = {10.4103/ijnm.IJNM_125_17}, pmid = {29430125}, issn = {0972-3919}, abstract = {Crow-Fukase syndrome (POEMS syndrome) is a rare systemic paraneoplastic syndrome. Bone lesions are manifested by sclerotic osteoblastic lesions often associated with bone pain. Characterization of osseous lesions is always crucial for clinical correlation and better patient management. We present a case where 18F-fluorodeoxyglucose positron emission tomography (18F-FDG PET/CT) was unable to characterize a clinically symptomatic patient, and 18F-fluoride PET/CT showed excellent characterization of osteosclerotic lesions. The results were in correlation with already published data and showed that 18F-fluoride PET/CT has better uptake in osteoblastic lesions in POEMS syndrome when compared to 18F-FDG PET/CT and have superior imaging quality in assessing the bone lesions.}, }
@article {pmid29417053, year = {2017}, author = {Globig, A and Staubach, C and Sauter-Louis, C and Dietze, K and Homeier-Bachmann, T and Probst, C and Gethmann, J and Depner, KR and Grund, C and Harder, TC and Starick, E and Pohlmann, A and Höper, D and Beer, M and Mettenleiter, TC and Conraths, FJ}, title = {Highly Pathogenic Avian Influenza H5N8 Clade 2.3.4.4b in Germany in 2016/2017.}, journal = {Frontiers in veterinary science}, volume = {4}, number = {}, pages = {240}, doi = {10.3389/fvets.2017.00240}, pmid = {29417053}, issn = {2297-1769}, abstract = {Here, we report on the occurrence of highly pathogenic avian influenza (HPAI) H5Nx clade 2.3.4.4b in Germany. Between November 8, 2016, and September 30, 2017, more than 1,150 cases of HPAI H5Nx clade 2.3.4.4b in wild birds and 107 outbreaks in birds kept in captivity (92 poultry holdings and 15 zoos/animal parks) were reported in Germany. This HPAI epidemic is the most severe recorded in Germany so far. The viruses were apparently introduced by migratory birds, sparking an epidemic among wild birds across Germany with occasional incursions into poultry holdings, zoos and animal parks, which were usually rapidly detected and controlled by stamping out. HPAI viruses (mainly subtype H5N8, in a few cases also H5N5) were found in dead wild birds of at least 53 species. The affected wild birds were water birds (including gulls, storks, herons, and cormorants) and scavenging birds (birds of prey, owls, and crows). In a number of cases, substantial gaps in farm biosecurity may have eased virus entry into the holdings. In a second wave of the epidemic starting from February 2017, there was epidemiological and molecular evidence for virus transmission of the infections between commercial turkey holdings in an area of high poultry density, which caused approximately 25% of the total number of outbreaks in poultry. Biosecurity measures in poultry holdings should be adapted. This includes, inter alia, wearing of stable-specific protective clothing and footwear, cleaning, and disinfection of equipment that has been in contact with birds and prevention of contacts between poultry and wild water birds.}, }
@article {pmid29414945, year = {2018}, author = {Ashton, BJ and Ridley, AR and Edwards, EK and Thornton, A}, title = {Cognitive performance is linked to group size and affects fitness in Australian magpies.}, journal = {Nature}, volume = {554}, number = {7692}, pages = {364-367}, doi = {10.1038/nature25503}, pmid = {29414945}, issn = {1476-4687}, support = {BB/H021817/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, mesh = {Animals ; Animals, Wild/physiology ; Australia ; *Biological Evolution ; Cognition/*physiology ; Female ; *Genetic Fitness ; Intelligence/physiology ; Male ; Passeriformes/*physiology ; Population Density ; Reproduction/physiology ; *Social Behavior ; }, abstract = {The social intelligence hypothesis states that the demands of social life drive cognitive evolution. This idea receives support from comparative studies that link variation in group size or mating systems with cognitive and neuroanatomical differences across species, but findings are contradictory and contentious. To understand the cognitive consequences of sociality, it is also important to investigate social variation within species. Here we show that in wild, cooperatively breeding Australian magpies, individuals that live in large groups show increased cognitive performance, which is linked to increased reproductive success. Individual performance was highly correlated across four cognitive tasks, indicating a 'general intelligence factor' that underlies cognitive performance. Repeated cognitive testing of juveniles at different ages showed that the correlation between group size and cognition emerged in early life, suggesting that living in larger groups promotes cognitive development. Furthermore, we found a positive association between the task performance of females and three indicators of reproductive success, thus identifying a selective benefit of greater cognitive performance. Together, these results provide intraspecific evidence that sociality can shape cognitive development and evolution.}, }
@article {pmid29410861, year = {2018}, author = {McIvor, GE and Lee, VE and Thornton, A}, title = {Testing social learning of anti-predator responses in juvenile jackdaws: the importance of accounting for levels of agitation.}, journal = {Royal Society open science}, volume = {5}, number = {1}, pages = {171571}, doi = {10.1098/rsos.171571}, pmid = {29410861}, issn = {2054-5703}, support = {BB/H021817/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, abstract = {Social learning is often assumed to help young animals respond appropriately to potential threats in the environment. We brought wild, juvenile jackdaws briefly into captivity to test whether short exposures to conspecific vocalizations are sufficient to promote anti-predator learning. Individuals were presented with one of two models-a stuffed fox representing a genuine threat, or a toy elephant simulating a novel predator. Following an initial baseline presentation, juveniles were trained by pairing models with either adult mobbing calls, indicating danger, or contact calls suggesting no danger. In a final test phase with no playbacks, birds appeared to have habituated to the elephant, regardless of training, but responses to the fox remained high throughout, suggesting juveniles already recognized it as a predator before the experiment began. Training with mobbing calls did seem to generate elevated escape responses, but this was likely to be a carry-over effect of the playback in the previous trial. Overall, we found little evidence for social learning. Instead, individuals' responses were mainly driven by their level of agitation immediately preceding each presentation. These results highlight the importance of accounting for agitation in studies of anti-predator learning, and whenever animals are held in captivity for short periods.}, }
@article {pmid29386519, year = {2018}, author = {Stanford, R and Lockley, MG and Tucker, C and Godfrey, S and Stanford, SM}, title = {A diverse mammal-dominated, footprint assemblage from wetland deposits in the Lower Cretaceous of Maryland.}, journal = {Scientific reports}, volume = {8}, number = {1}, pages = {741}, doi = {10.1038/s41598-017-18619-w}, pmid = {29386519}, issn = {2045-2322}, abstract = {A newly discovered assemblage of predominantly small tracks from the Cretaceous Patuxent Formation at NASA's Goddard Space Flight Center, Maryland, reveals one of the highest track densities and diversities ever reported (~70 tracks, representing at least eight morphotypes from an area of only ~2 m2). The assemblage is dominated by small mammal tracks including the new ichnotxon Sederipes goddardensis, indicating sitting postures. Small crow-sized theropod trackways, the first from this unit, indicate social trackmakers and suggest slow-paced foraging behavior. Tracks of pterosaurs, and other small vertebrates suggest activity on an organic-rich substrate. Large well-preserved sauropod and nodosaurs tracks indicate the presence of large dinosaurs. The Patuxent Formation together with the recently reported Angolan assemblage comprise the world's two largest Mesozoic mammal footprint assemblages. The high density of footprint registration at the NASA site indicates special preservational and taphonomic conditions. These include early, penecontemporaneous deposition of siderite in organic rich, reducing wetland settings where even the flesh of body fossils can be mummified. Thus, the track-rich ironstone substrates of the Patuxent Formation, appear to preserve a unique vertebrate ichnofacies, with associated, exceptionally-preserved body fossil remains for which there are currently no other similar examples preserved in the fossil record.}, }
@article {pmid29382499, year = {2017}, author = {Sala, JE}, title = {[The jibarization of logos: how medical reductionism can kill].}, journal = {Boletin medico del Hospital Infantil de Mexico}, volume = {74}, number = {2}, pages = {154-163}, doi = {10.1016/j.bmhimx.2016.11.009}, pmid = {29382499}, issn = {1665-1146}, abstract = {In recent decades, a disciplinary and subdisciplinary proliferation has triggered both in the medical fields and science in general. This trend may be partially explained by two diachronic, dialectically interconnected facts: the deepening of technical, social and international division of labor in the globalized capitalist world, and the triumph of the reductionist program, mainly developed by the logical empiricism of the Vienna Circle. This paper aims to deepen the debate on the intricate links between medicine, biology, philosophy, reductionism and complex thought, by using two examples: a case report of current medicine and the situation experienced by a famous American scientist, Stephen Jay Gould, about his first cancer, an abdominal mesothelioma. We have witnessed how the two above-mentioned historical facts have been operating as a super-structure like a pair of &quot;tweezers&quot;, dismembering and compressing at the same moment the object of knowledge, the theories that allow their study, and the subject that receives the knowledge. This jibarization of logos is a real problem for public health, from the moment that it impacts, omnipresent, in the actual hegemonic medical model, leading to potentially dangerous attitudes to the various components of health systems.}, }
@article {pmid29375193, year = {2018}, author = {Maziarz, M and Piggott, C and Burgess, M}, title = {Predator recognition and differential behavioural responses of adult wood warblers Phylloscopus sibilatrix.}, journal = {Acta ethologica}, volume = {21}, number = {1}, pages = {13-20}, doi = {10.1007/s10211-017-0275-2}, pmid = {29375193}, issn = {0873-9749}, abstract = {Birds often engage in nest defence against predators to improve breeding success, but defence efficiency requires the capability to assess the threat level posed by potential predators. For species with low breeding-site tenacity, which may encounter varying occurrence and density of predators in different areas, threat recognition could be compromised due to naivety, and so predator recognition may focus on broad key features to diminish the risk of misidentification. We experimentally tested this hypothesis by recording behavioural reactions of the nomadic wood warbler Phylloscopus sibilatrix to objects reflecting various levels of threat: least weasel and Eurasian jay taxidermy mounts, an inanimate object and an empty display mount. To assess actual nest predators, we used remote cameras to record predation events at wood warbler nests. As in other studies in Western Europe, Eurasian jay was found to be the main nest predator, with occasional predation by least weasel. The reaction of adult warblers to the models was generally to remain silent and on nests during the incubation stage presumably due to the need to maintain efficient nest camouflage and concealment. During the nestling stage, behavioural responses of adult warblers, calling and suspended feeding of young, showed the strongest effects from the jay taxidermy mount, moderate to the weasel and weakest to the inanimate object and empty mount. As the reaction of wood warblers reflected the degree of genuine threat posed by the predators depicted by the models, we conclude that predator recognition may be present in this species.}, }
@article {pmid29373167, year = {2018}, author = {Claes, R and Muyshondt, PGG and Dirckx, JJJ and Aerts, P}, title = {Do high sound pressure levels of crowing in roosters necessitate passive mechanisms for protection against self-vocalization?.}, journal = {Zoology (Jena, Germany)}, volume = {126}, number = {}, pages = {65-70}, doi = {10.1016/j.zool.2017.12.002}, pmid = {29373167}, issn = {1873-2720}, mesh = {Animals ; Chickens/*physiology ; Crowding/psychology ; Ear/anatomy &amp; histology/physiology ; Female ; Male ; Sex Characteristics ; Sound/adverse effects ; Vocalization, Animal/*physiology ; }, abstract = {High sound pressure levels (>120dB) cause damage or death of the hair cells of the inner ear, hence causing hearing loss. Vocalization differences are present between hens and roosters. Crowing in roosters is reported to produce sound pressure levels of 100dB measured at a distance of 1m. In this study we measured the sound pressure levels that exist at the entrance of the outer ear canal. We hypothesize that roosters may benefit from a passive protective mechanism while hens do not require such a mechanism. Audio recordings at the level of the entrance of the outer ear canal of crowing roosters, made in this study, indeed show that a protective mechanism is needed as sound pressure levels can reach amplitudes of 142.3dB. Audio recordings made at varying distances from the crowing rooster show that at a distance of 0.5m sound pressure levels already drop to 102dB. Micro-CT scans of a rooster and chicken head show that in roosters the auditory canal closes when the beak is opened. In hens the diameter of the auditory canal only narrows but does not close completely. A morphological difference between the sexes in shape of a bursa-like slit which occurs in the outer ear canal causes the outer ear canal to close in roosters but not in hens.}, }
@article {pmid29364882, year = {2018}, author = {Torres-Vargas, J and Jiménez-Coello, M and Guzmán-Marín, E and Acosta-Viana, KY and Yadon, ZE and Gutiérrez-Blanco, E and Guillermo-Cordero, JL and Garg, NJ and Ortega-Pacheco, A}, title = {Quantitative and histological assessment of maternal-fetal transmission of Trypanosoma cruzi in guinea pigs: An experimental model of congenital Chagas disease.}, journal = {PLoS neglected tropical diseases}, volume = {12}, number = {1}, pages = {e0006222}, doi = {10.1371/journal.pntd.0006222}, pmid = {29364882}, issn = {1935-2735}, support = {R01 AI054578/NH/NIH HHS/United States ; }, mesh = {Animals ; Antibodies, Protozoan/blood ; Chagas Disease/*pathology/*transmission ; Disease Models, Animal ; Female ; Guinea Pigs ; Histocytochemistry ; Humans ; Immunoglobulin G/blood ; *Infectious Disease Transmission, Vertical ; *Maternal-Fetal Exchange ; Parasite Load ; Polymerase Chain Reaction ; Pregnancy ; Pregnancy Complications, Infectious/*pathology ; Trypanosoma cruzi/*isolation &amp; purification ; }, abstract = {OBJECTIVE: We evaluated the effect of Trypanosoma cruzi infection on fertility, gestation outcome, and maternal-fetal transmission in guinea pigs (Cavia porcellus).<br><br>METHODS: Animals were infected with T. cruzi H4 strain (TcI lineage) before gestation (IBG) or during gestation (IDG). Tissue and sera samples of dams and fetuses were obtained near parturition.<br><br>RESULTS: All IBG and IDG dams were seropositive by two tests, and exhibited blood parasite load of 1.62±2.2 and 50.1±62 parasites/μl, respectively, by quantitative PCR. Histological evaluation showed muscle fiber degeneration and cellular necrosis in all infected dams. Parasite nests were not detected in infected dams by histology. However, qPCR analysis detected parasites-eq/g heart tissue of 153±104.7 and 169.3±129.4 in IBG and IDG dams, respectively. All fetuses of infected dams were positive for anti-parasite IgG antibodies and tissue parasites by qPCR, but presented a low level of tissue inflammatory infiltrate. Fetuses of IDG (vs. IBG) dams exhibited higher degree of muscle fiber degeneration and cellular necrosis in the heart and skeletal tissues. The placental tissue exhibited no inflammatory lesions and amastigote nests, yet parasites-eq/g of 381.2±34.3 and 79.2±84.9 were detected in IDG and IBG placentas, respectively. Fetal development was compromised, and evidenced by a decline in weight, crow-rump length, and abdominal width in both groups.<br><br>CONCLUSIONS: T. cruzi TcI has a high capacity of congenital transmission even when it was inoculated at a very low dose before or during gestation. Tissue lesions, parasite load, and fetal under development provide evidence for high virulence of the parasite during pregnancy. Despite finding of high parasite burden by qPCR, placentas were protected from cellular damage. Our studies offer an experimental model to study the efficacy of vaccines and drugs against congenital transmission of T. cruzi. These results also call for T. cruzi screening in pregnant women and adequate follow up of the newborns in endemic areas.}, }
@article {pmid29361607, year = {2018}, author = {Stavenga, DG and Leertouwer, HL and Wilts, BD}, title = {Magnificent magpie colours by feathers with layers of hollow melanosomes.}, journal = {The Journal of experimental biology}, volume = {221}, number = {Pt 4}, pages = {}, doi = {10.1242/jeb.174656}, pmid = {29361607}, issn = {1477-9145}, abstract = {The blue secondary and purple-to-green tail feathers of magpies are structurally coloured owing to stacks of hollow, air-containing melanosomes embedded in the keratin matrix of the barbules. We investigated the spectral and spatial reflection characteristics of the feathers by applying (micro)spectrophotometry and imaging scatterometry. To interpret the spectral data, we performed optical modelling, applying the finite-difference time domain (FDTD) method as well as an effective media approach, treating the melanosome stacks as multi-layers with effective refractive indices dependent on the component media. The differently coloured magpie feathers are realised by adjusting the melanosome size, with the diameter of the melanosomes as well as their hollowness being the most sensitive parameters that influence the appearance of the feathers.}, }
@article {pmid29358606, year = {2018}, author = {St Clair, JJH and Klump, BC and Sugasawa, S and Higgott, CG and Colegrave, N and Rutz, C}, title = {Hook innovation boosts foraging efficiency in tool-using crows.}, journal = {Nature ecology &amp; evolution}, volume = {2}, number = {3}, pages = {441-444}, doi = {10.1038/s41559-017-0429-7}, pmid = {29358606}, issn = {2397-334X}, abstract = {The New Caledonian crow is the only non-human animal known to craft hooked tools in the wild, but the ecological benefit of these relatively complex tools remains unknown. Here, we show that crows acquire food several times faster when using hooked rather than non-hooked tools, regardless of tool material, prey type and extraction context. This implies that small changes to tool shape can strongly affect energy-intake rates, highlighting a powerful driver for technological advancement.}, }
@article {pmid29342669, year = {2017}, author = {Pepperberg, IM}, title = {&quot;Birdbrains&quot; should not be ignored in studying the evolution of g.}, journal = {The Behavioral and brain sciences}, volume = {40}, number = {}, pages = {e216}, doi = {10.1017/S0140525X16001758}, pmid = {29342669}, issn = {1469-1825}, abstract = {The authors evaluate evidence for general intelligence (g) in nonhumans but lean heavily toward mammalian data. They mention, but do not discuss in detail, evidence for g in nonmammalian species, for which substantive material exists. I refer to a number of avian studies, particularly in corvids and parrots, which would add breadth to the material presented in the target article.}, }
@article {pmid29338711, year = {2018}, author = {Shurulinkov, P and Spasov, L and Stoyanov, G and Chakarov, N}, title = {Blood parasite infections in a wild population of ravens (Corvus corax) in Bulgaria.}, journal = {Malaria journal}, volume = {17}, number = {1}, pages = {33}, doi = {10.1186/s12936-018-2179-7}, pmid = {29338711}, issn = {1475-2875}, support = {PIEF-GA-2013-625883//H2020 Marie Skłodowska-Curie Actions/ ; }, abstract = {BACKGROUND: Blood parasites have been studied intensely in many families of avian hosts, but corvids, a particularly cosmopolitan family, remain underexplored. Haemosporidian parasites of the common raven (Corvus corax) have not been studied, although it is the largest, most adaptable, and widespread corvid. Genetic sequence data from parasites of ravens can enhance the understanding of speciation patterns and specificity of haemosporidian parasites in corvids, and shed light how these hosts cope with parasite pressure.<br><br>METHODS: A baited cage trap was used to catch 86 ravens and a nested PCR protocol was used to amplify a 479 bp fragment of the haemosporidian cytochrome b gene from the samples. The obtained sequences were compared with the MalAvi database of all published haemosporidian lineages and a phylogenetic tree including all detected raven parasites was constructed. An examination of blood smears was performed for assessment of infection intensity.<br><br>RESULTS: Twenty blood parasite lineages were recovered from ravens caught in a wild population in Bulgaria. The prevalence of generalist Plasmodium lineages was 49%, and the prevalence of Leucocytozoon lineages was 31%. Out of 13 detected Leucocytozoon lineages six were known from different corvids, while seven others seem to be specific to ravens. A phylogenetic reconstruction suggests that Leucocytozoon lineages of ravens and other corvids are not monophyletic, with some groups appearing closely related to parasites of other host families.<br><br>CONCLUSIONS: Several different, morphologically cryptic groups of Leucocytozoon parasites appear to infect corvids. Ravens harbour both generalist corvid Leucocytozoon as well as apparently species-specific lineages. The extraordinary breeding ecology and scavenging lifestyle possibly allow ravens to evade vectors and have relatively low blood parasite prevalence compared to other corvids.}, }
@article {pmid29337074, year = {2018}, author = {Padget, O and Bond, SL and Kavelaars, MM and van Loon, E and Bolton, M and Fayet, AL and Syposz, M and Roberts, S and Guilford, T}, title = {In Situ Clock Shift Reveals that the Sun Compass Contributes to Orientation in a Pelagic Seabird.}, journal = {Current biology : CB}, volume = {28}, number = {2}, pages = {275-279.e2}, doi = {10.1016/j.cub.2017.11.062}, pmid = {29337074}, issn = {1879-0445}, abstract = {Compass orientation is central to the control of animal movement from the scale of local food-caching movements around a familiar area in parids [1] and corvids [2, 3] to the first autumn vector navigation of songbirds embarking on long-distance migration [4-6]. In the study of diurnal birds, where the homing pigeon, Columba livia, has been the main model, a time-compensated sun compass [7] is central to the two-step map-and-compass process of navigation from unfamiliar places, as well as guiding movement via a representation of familiar area landmarks [8-12]. However, its use by an actively navigating wild bird is yet to be shown. By phase shifting an animal's endogenous clock, known as clock-shifting [13-15], sun-compass use can be demonstrated when the animal incorrectly consults the sun's azimuthal position while homing after experimental displacement [15-17]. By applying clock-shift techniques at the nest of a wild bird during natural incubation, we show here that an oceanic navigator-the Manx shearwater, Puffinus puffinus-incorporates information from a time-compensated sun compass during homeward guidance to the breeding colony after displacement. Consistently with homing pigeons navigating within their familiar area [8, 9, 11, 18], we find that the effect of clock shift, while statistically robust, is partial in nature, possibly indicating the incorporation of guidance from landmarks into movement decisions.}, }
@article {pmid29330183, year = {2018}, author = {Sen, K and Lu, J and Mukherjee, P and Berglund, T and Varughese, E and Mukhopadhyay, AK}, title = {Campylobacter jejuni Colonization in the Crow Gut Involves Many Deletions within the Cytolethal Distending Toxin Gene Cluster.}, journal = {Applied and environmental microbiology}, volume = {84}, number = {6}, pages = {}, doi = {10.1128/AEM.01893-17}, pmid = {29330183}, issn = {1098-5336}, support = {EPA999999//Intramural EPA/ ; }, abstract = {Campylobacter spp. are major causes of gastroenteritis worldwide. The virulence potential of Campylobacter shed in crow feces obtained from a roost area in Bothell, Washington, was studied and compared with that from isolates from other parts of Washington and from a different crow species 7,000 miles away in Kolkata, India. Campylobacter organisms were isolated from 61% and 69% of the fecal samples obtained from Washington and Kolkata, respectively, and were confirmed to be C. jejuni The cytolethal distending toxin (CDT) gene cluster from these isolates revealed a truncated sequence of approximately 1,350 bp. Sequencing of the gene cluster revealed two types of mutations: a 668-bp deletion across cdtA and cdtB and a 51-bp deletion within cdtB Some strains had additional 20-bp deletions in cdtB In either case, a functional toxin is not expected; a functional toxin is produced by the expression of three tandem genes, cdtA, cdtB, and cdtC Reverse transcriptase PCR with total RNA extracted from the isolates showed no expression of cdtB A toxin assay performed with these isolates on HeLa cells failed to show cytotoxic effects on the cells. However, the isolates were able to colonize the chicken ceca for a period of at least 4 weeks, similar to that of a clinical isolate. Other virulence gene markers, flagellin A and CadF, were present in 100% of the isolates. Our study suggests that crows carry the bacterium C. jejuni but with a dysfunctional toxin protein that is expected to drastically reduce its potential to cause diarrhea.IMPORTANCE Campylobacters are a major cause of gastroenteritis in humans. Since outbreaks have most often been correlated with poultry or unpasteurized dairy products, contact with farm animals, or contaminated water, historically, the majority of the studies have been with campylobacter isolates from poultry, domestic animals, and human patients. However, the bacterium has a broad host range that includes birds. These reservoirs need to be investigated, because the identification of the source and a determination of the transmission routes for a pathogen are important for the development of evidence-based disease control programs. In this study, two species of the human-commensal crow, from two different geographical regions separated by 7,000 miles of land and water, have been examined for their ability to cause disease by shedding campylobacters. Our results show that the crow may not play a significant role in campylobacteriosis, because the campylobacter organisms they shed produce a nonfunctional toxin.}, }
@article {pmid29320499, year = {2018}, author = {Morrison, R and Reiss, D}, title = {Precocious development of self-awareness in dolphins.}, journal = {PloS one}, volume = {13}, number = {1}, pages = {e0189813}, doi = {10.1371/journal.pone.0189813}, pmid = {29320499}, issn = {1932-6203}, mesh = {Animals ; *Awareness ; Bottle-Nosed Dolphin/*physiology ; }, abstract = {Mirror-self recognition (MSR) is a behavioral indicator of self-awareness in young children and only a few other species, including the great apes, dolphins, elephants and magpies. The emergence of self-awareness in children typically occurs during the second year and has been correlated with sensorimotor development and growing social and self-awareness. Comparative studies of MSR in chimpanzees report that the onset of this ability occurs between 2 years 4 months and 3 years 9 months of age. Studies of wild and captive bottlenose dolphins (Tursiops truncatus) have reported precocious sensorimotor and social awareness during the first weeks of life, but no comparative MSR research has been conducted with this species. We exposed two young bottlenose dolphins to an underwater mirror and analyzed video recordings of their behavioral responses over a 3-year period. Here we report that both dolphins exhibited MSR, indicated by self-directed behavior at the mirror, at ages earlier than generally reported for children and at ages much earlier than reported for chimpanzees. The early onset of MSR in young dolphins occurs in parallel with their advanced sensorimotor development, complex and reciprocal social interactions, and growing social awareness. Both dolphins passed subsequent mark tests at ages comparable with children. Thus, our findings indicate that dolphins exhibit self-awareness at a mirror at a younger age than previously reported for children or other species tested.}, }
@article {pmid29316266, year = {2018}, author = {Subias, L and Griffin, AS and Guez, D}, title = {Inference by exclusion in the Red-tailed Black Cockatoo (Calyptorhynchus banksii).}, journal = {Integrative zoology}, volume = {}, number = {}, pages = {}, doi = {10.1111/1749-4877.12299}, pmid = {29316266}, issn = {1749-4877}, abstract = {Inference by exclusion is the ability to select a given option by excluding the others. When designed appropriately, tests of this ability can reveal choices that cannot be explained by associative processes. Over the past decade, exclusion reasoning has been explored in several non-human taxonomic groups including birds, mainly in Corvids and Parrots. To increase our understanding of the taxonomic distribution of exclusion reasoning and therefore its evolution, we investigated exclusion performances in Red-tailed Black cockatoos (Calyptorhynchus banksii), an Australian relative of the Goffin cockatoo (Cacatua goffinia), using a food-finding task. Cockatoos were required to find a food item hidden in one of the two experimenter's hands. Following training sessions in which they reliably selected the closed baited hand they had just been shown open, each individual was tested on four different conditions. Critical to demonstrating exclusion reasoning was the condition in which they were shown the empty hand and then offered a choice of both closed hands. The performance of all birds was above chance on all experimental conditions but not on an olfactory and/or cuing control condition. The results suggest that the birds might be able to infer by exclusion, although an explanation based on rule learning cannot be excluded. This first experiment in Red-tailed Black cockatoo highlights this species' potential as a model to study avian cognition and paves the pathway for future investigations.}, }
@article {pmid29312032, year = {2017}, author = {Schoppek, W and Fischer, A}, title = {Common Process Demands of Two Complex Dynamic Control Tasks: Transfer Is Mediated by Comprehensive Strategies.}, journal = {Frontiers in psychology}, volume = {8}, number = {}, pages = {2145}, doi = {10.3389/fpsyg.2017.02145}, pmid = {29312032}, issn = {1664-1078}, abstract = {Although individual differences in complex problem solving (CPS) are well-established, relatively little is known about the process demands that are common to different dynamic control (CDC) tasks. A prominent example is the VOTAT strategy that describes the separate variation of input variables (&quot;Vary One Thing At a Time&quot;) for analyzing the causal structure of a system. To investigate such comprehensive knowledge elements and strategies, we devised the real-time driven CDC environment Dynamis2 and compared it with the widely used CPS test MicroDYN in a transfer experiment. One hundred sixty five subjects participated in the experiment, which completely combined the role of MicroDYN and Dynamis2 as source or target problem. Figural reasoning was assessed using a variant of the Raven Test. We found the expected substantial correlations among figural reasoning and performance in both CDC tasks. Moreover, MicroDYN and Dynamis2 share 15.4% unique variance controlling for figural reasoning. We found positive transfer from MicroDYN to Dynamis2, but no transfer in the opposite direction. Contrary to our expectation, transfer was not mediated by VOTAT but by an approach that is characterized by setting all input variables to zero after an intervention and waiting a certain time. This strategy (called PULSE strategy) enables the problem solver to observe the eigendynamics of the system. We conclude that for the study of complex problem solving it is important to employ a range of different CDC tasks in order to identify components of CPS. We propose that besides VOTAT and PULSE other comprehensive knowledge elements and strategies, which contribute to successful CPS, should be investigated. The positive transfer from MicroDYN to the more complex and dynamic Dynamis2 suggests an application of MicroDYN as training device.}, }
@article {pmid29307740, year = {2018}, author = {Kang, Y and Shen, X and Yuan, R and Xiang, B and Fang, Z and Murphy, RW and Liao, M and Shen, Y and Ren, T}, title = {Pathogenicity and transmissibility of three avian influenza A (H5N6) viruses isolated from wild birds.}, journal = {The Journal of infection}, volume = {76}, number = {3}, pages = {286-294}, doi = {10.1016/j.jinf.2017.12.012}, pmid = {29307740}, issn = {1532-2742}, abstract = {Since 2013, highly pathogenic H5N6 avian influenza viruses (AIVs) have emerged in poultry and caused sporadic human infections in Asia. The recent discovery of three new avian H5N6 viruses - A/oriental magpie-robin/Guangdong/SW8/2014 (H5N6), A/common moorhen/Guangdong/GZ174/2014 (H5N6) and A/Pallas's sandgrouse/Guangdong/ZH283/2015 (H5N6) - isolated from apparently healthy wild birds in Southern China in 2014-2015 raises great concern for the spread of these highly pathogenic AIVs (HPAIVs) and their potential threat to human and animal health. In our study, we conducted animal experiments and tested their pathogenicity in ducks, chickens and mice. Ducks can carry and shed the H5N6 HPAIVs, but show no ill effects. On the other hand, these H5N6 HPAIVs can efficiently infect, transmit and cause death in chickens. Due to the overlap of habitats, domestic ducks play an important role in circulating AIVs between poultry and wild birds. Our results raise the possibility that wild birds disseminate these H5N6 HPAIVs to poultry along their flyways and thus pose a great threat to the poultry industry. These viruses are also highly pathogenic to mice, suggesting they pose a potential threat to mammals and, thus, public health. One virus isolated in 2015 replicates much more efficiently and is more lethal in these animals than the two other viruses isolated in 2014. It seems that the H5N6 viruses tend to be more lethal as time passes. Therefore, it is necessary to vigilantly monitor H5N6 HPAIVs in wild birds and poultry.}, }
@article {pmid29304032, year = {2018}, author = {Eggers, MJ and Doyle, JT and Lefthand, MJ and Young, SL and Moore-Nall, AL and Kindness, L and Medicine, RO and Ford, TE and Dietrich, E and Parker, AE and Hoover, JH and Camper, AK}, title = {Community Engaged Cumulative Risk Assessment of Exposure to Inorganic Well Water Contaminants, Crow Reservation, Montana.}, journal = {International journal of environmental research and public health}, volume = {15}, number = {1}, pages = {}, doi = {10.3390/ijerph15010076}, pmid = {29304032}, issn = {1660-4601}, support = {P50 ES026102/ES/NIEHS NIH HHS/United States ; P20 GM104417/GM/NIGMS NIH HHS/United States ; P20 MD002317/MD/NIMHD NIH HHS/United States ; P20 RR016455/RR/NCRR NIH HHS/United States ; K12 GM088021/GM/NIGMS NIH HHS/United States ; P20 GM103474/GM/NIGMS NIH HHS/United States ; }, abstract = {An estimated 11 million people in the US have home wells with unsafe levels of hazardous metals and nitrate. The national scope of the health risk from consuming this water has not been assessed as home wells are largely unregulated and data on well water treatment and consumption are lacking. Here, we assessed health risks from consumption of contaminated well water on the Crow Reservation by conducting a community-engaged, cumulative risk assessment. Well water testing, surveys and interviews were used to collect data on contaminant concentrations, water treatment methods, well water consumption, and well and septic system protection and maintenance practices. Additive Hazard Index calculations show that the water in more than 39% of wells is unsafe due to uranium, manganese, nitrate, zinc and/or arsenic. Most families' financial resources are limited, and 95% of participants do not employ water treatment technologies. Despite widespread high total dissolved solids, poor taste and odor, 80% of families consume their well water. Lack of environmental health literacy about well water safety, pre-existing health conditions and limited environmental enforcement also contribute to vulnerability. Ensuring access to safe drinking water and providing accompanying education are urgent public health priorities for Crow and other rural US families with low environmental health literacy and limited financial resources.}, }
@article {pmid29299036, year = {2017}, author = {Szipl, G and Ringler, E and Spreafico, M and Bugnyar, T}, title = {Calls during agonistic interactions vary with arousal and raise audience attention in ravens.}, journal = {Frontiers in zoology}, volume = {14}, number = {}, pages = {57}, doi = {10.1186/s12983-017-0244-7}, pmid = {29299036}, issn = {1742-9994}, abstract = {Background: Acoustic properties of vocalizations can vary with the internal state of the caller, and may serve as reliable indicators for a caller's emotional state, for example to prevent conflicts. Thus, individuals may associate distinct characteristics in acoustic signals of conspecifics with specific social contexts, and adjust their behaviour accordingly to prevent escalation of conflicts. Common ravens (Corvus corax) crowd-forage with individuals of different age classes, sex, and rank, assemble at feeding sites, and engage in agonistic interactions of varying intensity. Attacked individuals frequently utter defensive calls in order to appease the aggressor. Here, we investigated if acoustic properties of defensive calls change with varying levels of aggression, and if bystanders respond to these changes.<br><br>Results: Individuals were more likely to utter defensive calls when the attack involved contact aggression, and when the attacker was higher in rank than the victim. Defensive calls produced during intense conflicts were longer and uttered at higher rates, and showed higher fundamental frequency- and amplitude-related measures than calls uttered during low-intensity aggression, indicating arousal-based changes in defensive calls. Playback experiments showed that ravens were more likely to react in response to defensive calls with higher fundamental frequency by orientating towards the speakers as compared to original calls and calls manipulated in duration.<br><br>Conclusions: Arousal-based changes are encoded in acoustic parameters of defensive calls in attacked ravens, and bystanders in the audience pay attention to the degree of arousal in attacked conspecifics. Our findings imply that common ravens can regulate conflicts with conspecifics by means of vocalizations, and are able to gather social knowledge from conspecific calls.}, }
@article {pmid29292361, year = {2017}, author = {Nieder, A}, title = {Evolution of cognitive and neural solutions enabling numerosity judgements: lessons from primates and corvids.}, journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences}, volume = {373}, number = {1740}, pages = {}, doi = {10.1098/rstb.2016.0514}, pmid = {29292361}, issn = {1471-2970}, mesh = {Animals ; *Cognition ; *Crows/physiology ; Judgment ; Macaca mulatta/*physiology/*psychology ; Neurons/physiology ; Parietal Lobe/physiology ; Telencephalon/physiology ; }, abstract = {Brains that are capable of representing numerosity, the number of items in a set, have arisen repeatedly and independently in different animal taxa. This review compares the cognitive and physiological mechanisms found in a nonhuman primate, the rhesus macaque, and a corvid songbird, the carrion crow, in order to elucidate the evolutionary adaptations underlying numerical competence. Monkeys and corvids are known for their advanced cognitive competence, despite them both having independently and distinctly evolved endbrains that resulted from a long history of parallel evolution. In both species, numerosity is represented as an analogue magnitude by an approximate number system that obeys the Weber-Fechner Law. In addition, the activity of numerosity-selective neurons in the fronto-parietal association cortex of monkeys and the telencephalic associative area nidopallium caudolaterale of crows mirrors the animals' performance. In both species' brains, neuronal activity is tuned to a preferred numerosity, encodes the numerical value in an approximate fashion, and is best represented on a logarithmic scale. Collectively, the data show an impressive correspondence of the cognitive and neuronal mechanisms for numerosity representations across monkeys and crows. This suggests that remotely related vertebrates with distinctly developed endbrains adopted similar physiological solutions to common computational problems in numerosity processing.This article is part of a discussion meeting issue 'The origins of numerical abilities'.}, }
@article {pmid29292354, year = {2017}, author = {Hannagan, T and Nieder, A and Viswanathan, P and Dehaene, S}, title = {A random-matrix theory of the number sense.}, journal = {Philosophical transactions of the Royal Society of London. Series B, Biological sciences}, volume = {373}, number = {1740}, pages = {}, doi = {10.1098/rstb.2017.0253}, pmid = {29292354}, issn = {1471-2970}, mesh = {Adolescent ; Animals ; Child ; Child, Preschool ; *Cognition ; *Discrimination (Psychology) ; Haplorhini/*physiology/psychology ; Humans ; Infant ; *Models, Neurological ; Psychophysics ; }, abstract = {Number sense, a spontaneous ability to process approximate numbers, has been documented in human adults, infants and newborns, and many other animals. Species as distant as monkeys and crows exhibit very similar neurons tuned to specific numerosities. How number sense can emerge in the absence of learning or fine tuning is currently unknown. We introduce a random-matrix theory of self-organized neural states where numbers are coded by vectors of activation across multiple units, and where the vector codes for successive integers are obtained through multiplication by a fixed but random matrix. This cortical implementation of the 'von Mises' algorithm explains many otherwise disconnected observations ranging from neural tuning curves in monkeys to looking times in neonates and cortical numerotopy in adults. The theory clarifies the origin of Weber-Fechner's Law and yields a novel and empirically validated prediction of multi-peak number neurons. Random matrices constitute a novel mechanism for the emergence of brain states coding for quantity.This article is part of a discussion meeting issue 'The origins of numerical abilities'.}, }
@article {pmid29285478, year = {2017}, author = {Najafi, M and Akouchekian, S and Ghaderi, A and Mahaki, B and Rezaei, M}, title = {Multiple Intelligences Profiles of Children with Attention Deficit and Hyperactivity Disorder in Comparison with Nonattention Deficit and Hyperactivity Disorder.}, journal = {Advanced biomedical research}, volume = {6}, number = {}, pages = {148}, doi = {10.4103/abr.abr_222_15}, pmid = {29285478}, issn = {2277-9175}, abstract = {Background: Attention deficit and hyperactivity disorder (ADHD) is a common psychological problem during childhood. This study aimed to evaluate multiple intelligences profiles of children with ADHD in comparison with non-ADHD.<br><br>Materials and Methods: This cross-sectional descriptive analytical study was done on 50 children of 6-13 years old in two groups of with and without ADHD. Children with ADHD were referred to Clinics of Child and Adolescent Psychiatry, Isfahan University of Medical Sciences, in 2014. Samples were selected based on clinical interview (based on Diagnostic and Statistical Manual of Mental Disorders IV and parent-teacher strengths and difficulties questionnaire), which was done by psychiatrist and psychologist. Raven intelligence quotient (IQ) test was used, and the findings were compared to the results of multiple intelligences test. Data analysis was done using a multivariate analysis of covariance using SPSS20 software.<br><br>Results: Comparing the profiles of multiple intelligence among two groups, there are more kinds of multiple intelligences in control group than ADHD group, a difference which has been more significant in logical, interpersonal, and intrapersonal intelligence (P < 0.05). There was no significant difference with the other kinds of multiple intelligences in two groups (P > 0.05). The IQ average score in the control group and ADHD group was 102.42 ± 16.26 and 96.72 ± 16.06, respectively, that reveals the negative effect of ADHD on IQ average value. There was an insignificance relationship between linguistic and naturalist intelligence (P > 0.05). However, in other kinds of multiple intelligences, direct and significant relationships were observed (P < 0.05).<br><br>Conclusions: Since the levels of IQ (Raven test) and MI in control group were more significant than ADHD group, ADHD is likely to be associated with logical-mathematical, interpersonal, and intrapersonal profiles.}, }
@article {pmid29282545, year = {2017}, author = {Janaydeh, M and Ismail, A and Omar, H and Zulkifli, SZ and Bejo, MH and Aziz, NAA}, title = {Relationship between Pb and Cd accumulations in house crow, their habitat, and food content from Klang area, Peninsular Malaysia.}, journal = {Environmental monitoring and assessment}, volume = {190}, number = {1}, pages = {47}, doi = {10.1007/s10661-017-6416-2}, pmid = {29282545}, issn = {1573-2959}, mesh = {Animals ; Birds ; Cadmium/analysis/*metabolism ; Crows/*metabolism ; *Ecosystem ; *Environmental Monitoring ; Environmental Pollutants/analysis/*metabolism ; Environmental Pollution/statistics &amp; numerical data ; Feathers/chemistry ; Female ; Food Chain ; Humans ; Lead/analysis/*metabolism ; Malaysia ; Male ; Metals, Heavy/analysis ; Soil ; }, abstract = {Heavy metal pollution has become a global concern due to accumulation in tissue and transferable effects to humans via the food chain. This study focused on monitoring the accumulation of cadmium (Cd) and lead (Pb) in surface soil and body content: bone, heart, brain, liver, lung, muscle, kidney, feathers, feces, and gizzard contents of house crow Corvus splendens in the Klang region, Malaysia. The results revealed the occurrence of Pb and Cd in all biological samples from house crows, food contents, and surface soil samples. Heart and kidney accrued high amounts of Cd, while high amounts of Pb were found to accumulate in bones and feathers. Major discrepancies were also discovered in the concentrations of metals between juvenile and adults, as well as female and male bird samples. Concentrations of Pb and Cd in house crow internal tissues correlated significantly with that of bird feathers, but none could be established with that of surface soil. In addition, a significant correlation was observed between Pb concentration in the internal tissues to that of the feces, but the same was not the case when compared with the surface soil concentration. Metal accrual in the house crows feathers and feces may be through a long-term transmission via the food chain, which are eliminated from feathers via molting. This may suggest the utility of molted breast feathers of house crow in the bio-monitoring of Cd and Pb contamination, whereas feces of house crow appear only to be suitable for the bio-monitoring of Pb contamination.}, }
@article {pmid29274762, year = {2018}, author = {Gallup, GG and Anderson, JR}, title = {The &quot;olfactory mirror&quot; and other recent attempts to demonstrate self-recognition in non-primate species.}, journal = {Behavioural processes}, volume = {148}, number = {}, pages = {16-19}, doi = {10.1016/j.beproc.2017.12.010}, pmid = {29274762}, issn = {1872-8308}, mesh = {Animals ; Behavior, Animal/*physiology ; *Ego ; Olfactory Perception/*physiology ; Recognition (Psychology)/*physiology ; Smell/physiology ; }, abstract = {The recent attempt by Horowitz (2017) to develop an &quot;olfactory mirror&quot; test of self-recognition in domestic dogs raises some important questions about the kinds of data that are required to provide definitive evidence for self-recognition in dogs and other species. We conclude that the &quot;olfactory mirror&quot; constitutes a compelling analog to the mark test for mirror self-recognition in primates, but despite claims to the contrary neither dogs, elephants, dolphins, magpies, horses, manta rays, squid, nor ants have shown compelling, reproducible evidence for self-recognition in any modality.}, }
@article {pmid29273913, year = {2018}, author = {Layes, S and Lalonde, R and Bouakkaz, Y and Rebai, M}, title = {Effectiveness of working memory training among children with dyscalculia: evidence for transfer effects on mathematical achievement-a pilot study.}, journal = {Cognitive processing}, volume = {19}, number = {3}, pages = {375-385}, doi = {10.1007/s10339-017-0853-2}, pmid = {29273913}, issn = {1612-4790}, abstract = {We examined whether the working memory (WM) capacity of developmentally dyscalculic children can be improved by a WM training program and whether outcomes relate to mathematical performance. The experimental design comprised two groups with developmental dyslexia with grade 4 schooling: an experimental group (n = 14; mean age = 129.74 months) and a control group (n = 14; mean age = 126.9 months). All participants were assessed on measures of WM, mathematic attainment, and nonverbal mental ability (Raven test) before and after training. The WM training program focused on manipulating and maintaining arithmetic information. The results show that both WM and mathematical performances improved significantly after intervention, indicating a strong relationship between these two constructs. The control group improved slightly in Raven's progressive matrices and a reading number task. These findings are discussed in terms of near and far transfer toward trained and untrained skills and stress the positive impact of WM training on learning mathematics in children with dyscalculia.}, }
@article {pmid29257965, year = {2017}, author = {van Casteren, A}, title = {Tool Use: Crows Craft the Right Tool for the Job.}, journal = {Current biology : CB}, volume = {27}, number = {24}, pages = {R1314-R1316}, doi = {10.1016/j.cub.2017.10.022}, pmid = {29257965}, issn = {1879-0445}, abstract = {New research into tool crafting in New Caledonian crows has uncovered factors that influence tool shape and the foraging advantages that these characteristics confer.}, }
@article {pmid29249025, year = {2018}, author = {Grúz, A and Déri, J and Szemerédy, G and Szabó, K and Kormos, É and Bartha, A and Lehel, J and Budai, P}, title = {Monitoring of heavy metal burden in wild birds at eastern/north-eastern part of Hungary.}, journal = {Environmental science and pollution research international}, volume = {25}, number = {7}, pages = {6378-6386}, doi = {10.1007/s11356-017-1004-0}, pmid = {29249025}, issn = {1614-7499}, abstract = {Concentrations of different heavy metals (As, Cd, Cr, Cu, Hg, Pb, Zn) were examined in the contour feathers of long-eared owl (Asio otus), little owl (Athene noctua), tawny owl (Strix aluco), barn owl (Tyto alba), Eurasian sparrowhawk (Accipiter nisus), rook (Corvus frugilegus), hooded crow (Corvus cornix), carrion crow (Corvus corone), common buzzard (Buteo buteo) and barn swallow (Hirundo rustica). The samples were collected from the Hortobágyi Madárpark (Bird Hospital Foundation) in Hungary. The bird species were classified into six groups based on their nourishment. Feathers were analysed by inductively coupled plasma optical emission spectroscopy (ICP-OES). The aim of our study was to determine the concentration of the above-mentioned heavy metals in the six different groups and to compare them by the groups, to find a possible connection between the concentrations and the age of birds and to get some information about the heavy metal burden of the environment. The highest As concentration was measured in little owl (0.65 ± 0.56 mg/kg). The highest Cd, Cr and Pb concentration was found in the feathers of barn swallow (0.13 ± 0.06 mg/kg; 1.69 ± 0.44 mg/kg; 5.36 ± 1.46 mg/kg), while the highest Cu and Hg concentration (65.45 ± 17.66 mg/kg; 2.72 ± 1.08 mg/kg) in sparrowhawk feathers and the highest Zn concentration in owls (157.21 ± 57.3 mg/kg). Statistically significant difference has been determined between the juvenile and adult crows in the case of Cd (p = 0.011). The higher concentration was measured in adults (0.14 ± 0.04 mg/kg) than that in juveniles (0.08 ± 0.02 mg/kg). Based on our results, the examined area is not contaminated by these heavy metals on that level, which can cause any adverse effect or poisoning in birds, so this region is safe to wildlife.}, }
@article {pmid29248926, year = {2017}, author = {Segal, O and Kaplan, D and Patael, S and Kishon-Rabin, L}, title = {Comprehension of &quot;Narrow Focus&quot; by Adolescents in the Autism Spectrum.}, journal = {Folia phoniatrica et logopaedica : official organ of the International Association of Logopedics and Phoniatrics (IALP)}, volume = {69}, number = {1-2}, pages = {67-77}, doi = {10.1159/000477399}, pmid = {29248926}, issn = {1421-9972}, mesh = {Adolescent ; Autism Spectrum Disorder/complications/*psychology ; Case-Control Studies ; Child ; *Comprehension ; Education, Special/methods ; Emotions ; Female ; Humans ; Male ; Pitch Discrimination ; Speech Disorders/etiology/*psychology ; Theory of Mind ; Young Adult ; }, abstract = {OBJECTIVE: The study compared the performance of adolescents with autistic spectrum disorder (ASD) to that of age-matched peers with typical development (TD) and cognitive language-matched peers with TD on measures of identification and comprehension of &quot;narrow focus.&quot;<br><br>PARTICIPANTS: Forty-nine participants, 17 autistic, 17 TD peers matched for age and sex, and 15 TD children matched for expressive vocabulary participated in the study.<br><br>METHOD: The Hebrew Narrow Focus Test (HNFT) was used. The HNFT includes 3 subtests. The first subtest (A) required identification of the stressed word in the sentence based on psychoacoustic abilities alone. The second (B) and third (C) subtests required understanding the meaning of focused stress in different contexts. In subtest B, the meaning of &quot;narrow focus&quot; was to contrast other possibilities related to the lexical-grammatical role of the stressed word in the sentence, whereas in subtest C, the meaning was to indicate a mistake.<br><br>RESULTS: ASD participants showed reduced performance compared to peers across all the subtests of the HNFT, but similar performance compared to TD children in subtests A and B and better performance on subtest C. A significant correlation was found between the Raven test for assessing nonverbal intelligence and subtests B and C of the HNFT in the group of adolescents with ASD.<br><br>CONCLUSIONS: Comprehension of narrow focus in adolescents with ASD who study in a special educational system is related to their cognitive-linguistic abilities and not to the autistic condition by itself or to its severity.}, }
@article {pmid29244826, year = {2017}, author = {Baldow, C and Salentin, S and Schroeder, M and Roeder, I and Glauche, I}, title = {MAGPIE: Simplifying access and execution of computational models in the life sciences.}, journal = {PLoS computational biology}, volume = {13}, number = {12}, pages = {e1005898}, doi = {10.1371/journal.pcbi.1005898}, pmid = {29244826}, issn = {1553-7358}, mesh = {Biological Science Disciplines/*statistics &amp; numerical data ; Computational Biology ; Computer Simulation ; Humans ; *Models, Biological ; Models, Statistical ; Programming Languages ; Reproducibility of Results ; *Software ; Systems Biology ; }, abstract = {Over the past decades, quantitative methods linking theory and observation became increasingly important in many areas of life science. Subsequently, a large number of mathematical and computational models has been developed. The BioModels database alone lists more than 140,000 Systems Biology Markup Language (SBML) models. However, while the exchange within specific model classes has been supported by standardisation and database efforts, the generic application and especially the re-use of models is still limited by practical issues such as easy and straight forward model execution. MAGPIE, a Modeling and Analysis Generic Platform with Integrated Evaluation, closes this gap by providing a software platform for both, publishing and executing computational models without restrictions on the programming language, thereby combining a maximum on flexibility for programmers with easy handling for non-technical users. MAGPIE goes beyond classical SBML platforms by including all models, independent of the underlying programming language, ranging from simple script models to complex data integration and computations. We demonstrate the versatility of MAGPIE using four prototypic example cases. We also outline the potential of MAGPIE to improve transparency and reproducibility of computational models in life sciences. A demo server is available at magpie.imb.medizin.tu-dresden.de.}, }
@article {pmid29241959, year = {2018}, author = {Holcomb, GW}, title = {The Journal of Pediatric Surgery: Its First 50 Years.}, journal = {Journal of pediatric surgery}, volume = {53}, number = {2}, pages = {212-216}, doi = {10.1016/j.jpedsurg.2017.11.007}, pmid = {29241959}, issn = {1531-5037}, mesh = {Child ; History, 20th Century ; History, 21st Century ; Humans ; Pediatrics/*history ; Periodicals as Topic/*history ; *Surgical Procedures, Operative ; United Kingdom ; }, abstract = {This article is based on the Journal of Pediatric Surgery Lecture at the 2017 meeting of the British Association of Pediatric Surgeons. This lecture was renamed The Jay L. Grosfeld /Journal of Pediatric Surgery Lecture in honor of Dr. Jay L. Grosfeld who was Editor-in-Chief of the Journal of Pediatric Surgery (JPS) from 1994 until his passing in 2016. The first part of this paper recounts the first 50years of JPS starting with the efforts of Drs. Koop and Gans to start a Journal devoted to Pediatric Surgery. The second part of the paper reviews the top ten citations in the first 50years of JPS. Finally, the last part of the article discusses what the future may hold for JPS.}, }
@article {pmid29238838, year = {2017}, author = {Jayakumar, KL and Samimi, SS}, title = {Jay Frank Schamberg, MD-Beyond the Eponymous Disease.}, journal = {JAMA dermatology}, volume = {153}, number = {12}, pages = {1242}, doi = {10.1001/jamadermatol.2017.4273}, pmid = {29238838}, issn = {2168-6084}, }
@article {pmid29238522, year = {2017}, author = {Dohms, KM and Graham, BA and Burg, TM}, title = {Multilocus genetic analyses and spatial modeling reveal complex population structure and history in a widespread resident North American passerine (Perisoreus canadensis).}, journal = {Ecology and evolution}, volume = {7}, number = {23}, pages = {9869-9889}, doi = {10.1002/ece3.3478}, pmid = {29238522}, issn = {2045-7758}, abstract = {An increasing body of studies of widely distributed, high latitude species shows a variety of refugial locations and population genetic patterns. We examined the effects of glaciations and dispersal barriers on the population genetic patterns of a widely distributed, high latitude, resident corvid, the gray jay (Perisoreus canadensis), using the highly variable mitochondrial DNA (mtDNA) control region and microsatellite markers combined with species distribution modeling. We sequenced 914 bp of mtDNA control region for 375 individuals from 37 populations and screened seven loci for 402 individuals from 27 populations across the gray jay range. We used species distribution modeling and a range of phylogeographic analyses (haplotype diversity, ΦST, SAMOVA, FST, Bayesian clustering analyses) to examine evolutionary history and population genetic structure. MtDNA and microsatellite markers revealed significant genetic differentiation among populations with high concordance between markers. Paleodistribution models supported at least five potential areas of suitable gray jay habitat during the last glacial maximum and revealed distributions similar to the gray jay's contemporary during the last interglacial. Colonization from and prolonged isolation in multiple refugia is evident. Historical climatic fluctuations, the presence of multiple dispersal barriers, and highly restricted gene flow appear to be responsible for strong genetic diversification and differentiation in gray jays.}, }
@article {pmid29238321, year = {2017}, author = {Kabadayi, C and Jacobs, I and Osvath, M}, title = {The Development of Motor Self-Regulation in Ravens.}, journal = {Frontiers in psychology}, volume = {8}, number = {}, pages = {2100}, doi = {10.3389/fpsyg.2017.02100}, pmid = {29238321}, issn = {1664-1078}, abstract = {Inhibitory control refers to the ability to stop impulses in favor of more appropriate behavior, and it constitutes one of the underlying cognitive functions associated with cognitive flexibility. Much attention has been given to cross-species comparisons of inhibitory control; however, less is known about how and when these abilities develop. Mapping the ontogeny of inhibitory control in different species may therefore reveal foundational elements behind cognitive processes and their evolution. In this study, we tested the development of motor self-regulation in raven chicks (Corvus corax), using two detour tasks that required inhibition of motor impulses to directly reach for a visible reward behind a barrier. One task included a mesh barrier, which partly occluded the reward, and the other task used a completely transparent barrier, the cylinder task. The results suggest that the more visible a reward is, the more difficult it is to inhibit motor impulses toward it, and further, that this inhibitory challenge gradually decreases during development. The mesh barrier is reliably detoured before the animals pass the task with the wholly transparent cylinder. As the majority of the birds begun testing as nestlings, and as we provided them with experiences they normally would not receive in a nest, it is likely that they showed the earliest possible onset of these skills. A control subject, tested at a later age, showed that the mesh detours required no particular training, but that tasks including complete transparency likely require more specific experiences. Adult ravens without explicit training are highly proficient in inhibitory detour tasks, and, together with chimpanzees, they are the best performers of all tested species in the cylinder task. Our results suggest that their skills develop early in life, around their third month. Their developmental pattern of inhibitory skills for detours resembles that of children and rhesus macaques, albeit the pace of development is markedly faster in ravens. Investigating the development of cognition is crucial to understanding its foundations within and across species.}, }
@article {pmid29236583, year = {2018}, author = {Steensma, DP}, title = {The Raven.}, journal = {Journal of clinical oncology : official journal of the American Society of Clinical Oncology}, volume = {36}, number = {5}, pages = {512-513}, doi = {10.1200/JCO.2017.76.3458}, pmid = {29236583}, issn = {1527-7755}, }
@article {pmid29233938, year = {2018}, author = {Bustillo-Avendaño, E and Ibáñez, S and Sanz, O and Sousa Barros, JA and Gude, I and Perianez-Rodriguez, J and Micol, JL and Del Pozo, JC and Moreno-Risueno, MA and Pérez-Pérez, JM}, title = {Regulation of Hormonal Control, Cell Reprogramming, and Patterning during De Novo Root Organogenesis.}, journal = {Plant physiology}, volume = {176}, number = {2}, pages = {1709-1727}, doi = {10.1104/pp.17.00980}, pmid = {29233938}, issn = {1532-2548}, abstract = {Body regeneration through formation of new organs is a major question in developmental biology. We investigated de novo root formation using whole leaves of Arabidopsis (Arabidopsis thaliana). Our results show that local cytokinin biosynthesis and auxin biosynthesis in the leaf blade followed by auxin long-distance transport to the petiole leads to proliferation of J0121-marked xylem-associated tissues and others through signaling of INDOLE-3-ACETIC ACID INDUCIBLE28 (IAA28), CRANE (IAA18), WOODEN LEG, and ARABIDOPSIS RESPONSE REGULATORS1 (ARR1), ARR10, and ARR12. Vasculature proliferation also involves the cell cycle regulator KIP-RELATED PROTEIN2 and ABERRANT LATERAL ROOT FORMATION4, resulting in a mass of cells with rooting competence that resembles callus formation. Endogenous callus formation precedes specification of postembryonic root founder cells, from which roots are initiated through the activity of SHORT-ROOT, PLETHORA1 (PLT1), and PLT2. Primordia initiation is blocked in shr plt1 plt2 mutant. Stem cell regulators SCHIZORIZA, JACKDAW, BLUEJAY, and SCARECROW also participate in root initiation and are required to pattern the new organ, as mutants show disorganized and reduced number of layers and tissue initials resulting in reduced rooting. Our work provides an organ regeneration model through de novo root formation, stating key stages and the primary pathways involved.}, }
@article {pmid29229413, year = {2018}, author = {Taufique, SKT and Prabhat, A and Kumar, V}, title = {Constant light environment suppresses maturation and reduces complexity of new born neuron processes in the hippocampus and caudal nidopallium of a diurnal corvid: Implication for impairment of the learning and cognitive performance.}, journal = {Neurobiology of learning and memory}, volume = {147}, number = {}, pages = {120-127}, doi = {10.1016/j.nlm.2017.12.001}, pmid = {29229413}, issn = {1095-9564}, abstract = {Periodic day-night environment shapes the temporal pattern in the behaviour and physiology (e.g. 24-h activity-rest and sleep-wake cycles) and the advanced brain function, such as learning, memory and decision making. In a previous study, we showed the abolition of 24-h rhythm in the activity-rest pattern, and an attenuated cognitive performance in diurnal Indian house crows (Corvus splendens) under constant light (no-night; LL) environment. Present study extended this, and investigated LL-induced effects on the neurogenesis (birth, maturation and neurite complexity of new born neurons) in the hippocampus and caudal nidopallium, the brain regions directly associated with learning and cognition in birds. We performed immunohistochemistry of doublecortin (DCX; a neurogenesis marker) and tyrosine hydroxylase (TH, a key enzyme of the dopamine biosynthesis) in the brain section containing hippocampus or caudal nidopallium of Indian house crows exposed for 2 weeks to LL, with controls maintained under 12L:12D. As expected, crows showed arrhythmicity with a significantly reduced rest period in the 24-h activity-rest pattern, and a decreased cognitive performance when tested for the spatial and pattern association learning tasks under LL. Importantly, there was a significant decrease in DCX-immunoreactive (ir) cells and, as shown by Sholl analysis, in the complexity of DCX-ir neurites in both, the hippocampus and caudal nidopallium of crows under LL, as compared to those under 12L:12D. The anatomical proximity of DCX-ir neurons with TH-ir fibers suggested a functional association of the new born hippocampal and caudal nidopallial neurons with the learning, and perhaps cognition in Indian house crows. These results give insights into possible impact of the loss of night on brain health and functions in an emerging ecosystem in which other diurnal species including humans may be inadvertently exposed to an illuminated night, such as in an overly lighted metropolitan urban habitat.}, }
@article {pmid29225028, year = {2017}, author = {Sugasawa, S and Klump, BC and St Clair, JJH and Rutz, C}, title = {Causes and Consequences of Tool Shape Variation in New Caledonian Crows.}, journal = {Current biology : CB}, volume = {27}, number = {24}, pages = {3885-3890.e4}, doi = {10.1016/j.cub.2017.11.028}, pmid = {29225028}, issn = {1879-0445}, mesh = {Age Factors ; Animals ; Crows/*physiology ; Feeding Behavior ; Female ; Male ; *Tool Use Behavior ; }, abstract = {Hominins have been making tools for over three million years [1], yet the earliest known hooked tools appeared as recently as 90,000 years ago [2]. Hook innovation is likely to have boosted our ancestors' hunting and fishing efficiency [3], marking a major transition in human technological evolution. The New Caledonian crow is the only non-human animal known to craft hooks in the wild [4, 5]. Crows manufacture hooked stick tools in a multi-stage process, involving the detachment of a branch from suitable vegetation; &quot;sculpting&quot; of a terminal hook from the nodal joint; and often additional adjustments, such as length trimming, shaft bending, and bark stripping [4, 6, 7]. Although tools made by a given population share key design features [4, 6, 8], they vary appreciably in overall shape and hook dimensions. Using wild-caught, temporarily captive crows, we experimentally investigated causes and consequences of variation in hook-tool morphology. We found that bird age, manufacture method, and raw-material properties influenced tool morphology, and that hook geometry in turn affected crows' foraging efficiency. Specifically, hook depth varied with both detachment technique and plant rigidity, and deeper hooks enabled faster prey extraction in the provided tasks. Older crows manufactured tools of distinctive shape, with pronounced shaft curvature and hooks of intermediate depth. Future work should explore the interactive effects of extrinsic and intrinsic factors on tool production and deployment. Our study provides a quantitative assessment of the drivers and functional significance of tool shape variation in a non-human animal, affording valuable comparative insights into early hominin tool crafting [9].}, }
@article {pmid29217466, year = {2018}, author = {Elderbrock, EK and Small, TW and Schoech, SJ}, title = {Influence of corticosterone treatment on nestling begging in Florida scrub-jays (Aphelocoma coerulescens).}, journal = {General and comparative endocrinology}, volume = {259}, number = {}, pages = {213-222}, doi = {10.1016/j.ygcen.2017.12.003}, pmid = {29217466}, issn = {1095-6840}, mesh = {Animals ; *Birds ; Corticosterone/pharmacology/*therapeutic use ; Female ; Nesting Behavior/*physiology ; }, abstract = {Altricial young are dependent on adults for protection and food, and they display nutritional need by begging to elicit feeding from parents. Begging at high levels can be energetically expensive and attract predators; thus, an individual must balance its nutritional needs with these potential costs. Further, because a parent is limited in the amount of food it can provide, begging can contribute to both parent-offspring conflict and sibling-sibling competition. Many extrinsic and intrinsic factors may contribute to begging behavior. One intrinsic factor of interest is corticosterone (CORT), a metabolic hormone hypothesized to play a role in regulating a nestling's begging behavior. We investigated the hypothesis that increased exposure to CORT influences nestling begging behavior in an altricial species, the Florida scrub-jay (Aphelocoma coerulescens). We treated one nestling per treatment nest with a twice-daily dose of exogenous hormone via a CORT-injected waxworm, whereas a second individual received a vehicle-injected waxworm. We monitored individual nestling and adult behavior at all nests with the use of high-definition video cameras on several days during treatment. We found no difference in begging rate between CORT fed and vehicle fed nestlings within a treatment nest. Further, to determine whether CORT treatment had indirect effects on the entire brood, we monitored additional nests, in which nestlings were not manipulated. When treatment and controls were compared, overall begging rates of nestlings in treatment nests were greater than those in control nests. This result suggests that CORT treatment of an individual altered its behavior, as well as that of its siblings.}, }
@article {pmid29213080, year = {2017}, author = {Danel, S and Osiurak, F and von Bayern, AMP}, title = {From the Age of 5 Humans Decide Economically, Whereas Crows Exhibit Individual Preferences.}, journal = {Scientific reports}, volume = {7}, number = {1}, pages = {17043}, doi = {10.1038/s41598-017-16984-0}, pmid = {29213080}, issn = {2045-2322}, abstract = {Human societies greatly depend on tools, which spare us considerable time and effort. Humans might have evolved a bias to employ tools, using them even when they are unnecessary. This study aimed to investigate whether adult humans and a distantly related habitually tool-using vertebrate species, the New Caledonian crow (Corvus moneduloides), use tools depending on their necessity. In addition, children aged 3 to 5 years were examined to investigate the developmental pattern. The task involved choosing between using a body part (i.e. crows: beak; humans: hand) or a tool for retrieving a reward from a box. All subjects were tested in two conditions. In the Body+/Tool- condition, using the body was more efficient than using the tool, and conversely in the Body-/Tool+ condition. Our results suggest that the capacity to employ tools economically develops late in humans. Crows, however, failed to choose economically. At the individual level, some subjects exhibited striking individual preferences for either using a tool or their beak throughout the task. Whether such biases depend on individual experience or whether they are genetically determined remains to be investigated. Our findings provide new insights about tool use and its cognitive implementation in two outstanding tool-using taxa.}, }
@article {pmid29210086, year = {2018}, author = {Jenner, RA}, title = {Evolution Is Linear: Debunking Life's Little Joke.}, journal = {BioEssays : news and reviews in molecular, cellular and developmental biology}, volume = {40}, number = {1}, pages = {}, doi = {10.1002/bies.201700196}, pmid = {29210086}, issn = {1521-1878}, abstract = {Linear depictions of the evolutionary process are ubiquitous in popular culture, but linear evolutionary imagery is strongly rejected by scientists who argue that evolution branches. This point is frequently illustrated by saying that we didn't evolve from monkeys, but that we are related to them as collateral relatives. Yet, we did evolve from monkeys, but our monkey ancestors are extinct, not extant. Influential voices, such as the late Stephen Jay Gould, have misled audiences for decades by falsely portraying the linear and branching aspects of evolution to be in conflict, and by failing to distinguish between the legitimate linearity of evolutionary descent, and the branching relationships among collateral relatives that result when lineages of ancestors diverge. The purpose of this article is to correct the widespread misplaced rejection of linear evolutionary imagery, and to re-emphasize the basic truth that the evolutionary process is fundamentally linear.}, }
@article {pmid29187607, year = {2017}, author = {Found, R}, title = {Interactions between cleaner-birds and ungulates are personality dependent.}, journal = {Biology letters}, volume = {13}, number = {11}, pages = {}, doi = {10.1098/rsbl.2017.0536}, pmid = {29187607}, issn = {1744-957X}, mesh = {Aggression ; Animals ; *Behavior, Animal ; Deer/*psychology ; *Passeriformes ; Personality ; }, abstract = {While a growing body of literature explores the ecological implications of consistent individual variation in the behaviour of wildlife, few studies have looked at the reciprocal influences of personality within interspecific interactions, despite the potentially significant impacts on biodiversity. Here I used two species involved in cleaner-bird behaviour-black-billed magpies (Pica pica) and Rocky mountain elk (Cervus canadensis)-to show that the exhibition of mutualistic behaviour can depend on the personality of the individual involved. I recorded suites of correlated behaviours in both elk and magpies to derive personality gradients from 'shy' to 'bold', which I compared with observations of interspecific interactions. I measured each half of this mutualistic relationship separately. I found that bold elk were more likely to aggressively reject magpie landings, while shy elk allowed magpies to land and groom them. Contrastingly, I found it was bold magpies that were willing to risk landings, while shy magpies rarely attempted landings. These results show that the exhibition of interspecific behaviour is predicated on the personality of the individuals, and thus likely contributes to the selection and maintenance of personality variation within populations.}, }
@article {pmid29180719, year = {2018}, author = {Krzemińska, U and Morales, HE and Greening, C and Nyári, ÁS and Wilson, R and Song, BK and Austin, CM and Sunnucks, P and Pavlova, A and Rahman, S}, title = {Population mitogenomics provides insights into evolutionary history, source of invasions and diversifying selection in the House Crow (Corvus splendens).}, journal = {Heredity}, volume = {120}, number = {4}, pages = {296-309}, doi = {10.1038/s41437-017-0020-7}, pmid = {29180719}, issn = {1365-2540}, abstract = {The House Crow (Corvus splendens) is a useful study system for investigating the genetic basis of adaptations underpinning successful range expansion. The species originates from the Indian subcontinent, but has successfully spread through a variety of thermal environments across Asia, Africa and Europe. Here, population mitogenomics was used to investigate the colonisation history and to test for signals of molecular selection on the mitochondrial genome. We sequenced the mitogenomes of 89 House Crows spanning four native and five invasive populations. A Bayesian dated phylogeny, based on the 13 mitochondrial protein-coding genes, supports a mid-Pleistocene (~630,000 years ago) divergence between the most distant genetic lineages. Phylogeographic patterns suggest that northern South Asia is the likely centre of origin for the species. Codon-based analyses of selection and assessments of changes in amino acid properties provide evidence of positive selection on the ND2 and ND5 genes against a background of purifying selection across the mitogenome. Protein homology modelling suggests that four amino acid substitutions inferred to be under positive selection may modulate coupling efficiency and proton translocation mediated by OXPHOS complex I. The identified substitutions are found within native House Crow lineages and ecological niche modelling predicts suitable climatic areas for the establishment of crow populations within the invasive range. Mitogenomic patterns in the invasive range of the species are more strongly associated with introduction history than climate. We speculate that invasions of the House Crow have been facilitated by standing genetic variation that accumulated due to diversifying selection within the native range.}, }
@article {pmid29175405, year = {2018}, author = {Yang, F and Xie, S and Liu, J and Wei, C and Zhang, H and Chen, T and Zhang, J}, title = {Arsenic concentrations and speciation in wild birds from an abandoned realgar mine in China.}, journal = {Chemosphere}, volume = {193}, number = {}, pages = {777-784}, doi = {10.1016/j.chemosphere.2017.11.098}, pmid = {29175405}, issn = {1879-1298}, mesh = {Animals ; Arsenates ; Arsenic/*analysis/chemistry ; Arsenicals/*analysis ; Arsenites ; *Birds ; Cacodylic Acid/analysis ; China ; Chromatography, High Pressure Liquid/methods ; Feathers/chemistry ; Mass Spectrometry/methods ; *Mining ; Muscle, Skeletal/chemistry ; Passeriformes ; Sulfides ; }, abstract = {Birds are at a higher level in the food chain; however, the potential bioaccumulation and biotransformation of arsenic (As) in birds in As mines has rarely been studied. In this study, four passerine bird species (tree sparrow [Passer montanus], light-vented bulbul [Pycnonotus sinensis], Garrulax canorus [Leucodioptron canorus], and magpie [Pica pica]) were collected from an abandoned As mine in China. The highest recorded As concentrations were 4.95 mg/kg and 51.65 mg/kg in muscles and feathers, respectively. Detection using high-performance liquid chromatography inductively coupled plasma mass spectrometry (HPLC-ICP-MS) revealed six As species, including arsenite (As(III)), arsenate (As(V)), dimethylarsinic acid (DMA), monomethylarsonic acid (MMA), arsenobetaine (AsB) and arsenocholine (AsC), with the former three species as the dominant (>92%) and the latter three as the minor As species (<6.17%). Further analysis of the selected bird samples using the X-ray absorption near edge structure (XANES) technique revealed the existence of As(III)-tris-glutathione (As(III)-GSH), which can be regarded as equivalent to the non-extractable and unidentified As form in the HPLC-ICP-MS data. Both methods revealed similar patterns of As species in the birds from the As mine, with muscles containing mainly inorganic As and DMA and feathers containing mainly inorganic As. The results of this study contribute to the knowledge regarding As accumulation and speciation in terrestrial organisms.}, }
@article {pmid29167158, year = {2017}, author = {Farrar, DR and Stensvold, MC}, title = {Observations on bipolar disjunctions of moonwort ferns (Botrychium, Ophioglossaceae).}, journal = {American journal of botany}, volume = {}, number = {}, pages = {}, doi = {10.3732/ajb.1700166}, pmid = {29167158}, issn = {1537-2197}, abstract = {Peter Raven, in 1963, included two fern taxa of the genus Botrychium in his list of plant species exhibiting American amphitropical bipolar disjunctions. He attributed the southern hemisphere occurrences to post-Pleistocene long-distance dispersal from counterparts in the northern hemisphere, probably assisted by annual bird migrations between the disjunct areas. Using genetic evidence gathered through worldwide analyses of phylogenetic relationship in Botrychium, we now review and reconsider Raven's conclusions. Genetic similarities indicate that South American Botrychium dusenii is an allotetraploid taxon closely related to B. spathulatum, a North American endemic, and that B. lunaria in New Zealand possesses a genotype identical to that of a taxon in North America derived through introgressive hybridization between B. lunaria and an endemic North American species, B. neolunaria Both North American counterparts exhibit Raven's characteristics of bipolar disjuncts in their occurrence in mountain and coastal meadows, copious production of small propagules (spores in Botrychium), occurrence in habitats frequented by transpolar bird migrants, and ability to found new colonies through inbreeding. We discuss these characteristics in Botrychium and relative to other ferns and suggest further studies on Botrychium and related taxa to address questions of time, number, and mode of bipolar dispersals.}, }
@article {pmid29154697, year = {2017}, author = {Dujela, M and Hyer, CF and Berlet, GC}, title = {Rate of Subtalar Joint Arthrodesis After Retrograde Tibiotalocalcaneal Arthrodesis With Intramedullary Nail Fixation: Evaluation of the RAIN Database.}, journal = {Foot &amp; ankle specialist}, volume = {}, number = {}, pages = {1938640017740674}, doi = {10.1177/1938640017740674}, pmid = {29154697}, issn = {1938-7636}, abstract = {BACKGROUND: Hindfoot arthritis or significant deformity involving the ankle and subtalar joint (STJ) is a disabling condition with few salvage options. Many surgeons note a decreased STJ fusion rate compared with ankle union when a retrograde nail construct is used. The purpose of this study was to report the STJ fusion rate of tibiotalocalcaneal (TTC) arthrodesis with retrograde nail.<br><br>METHODS: A chart and radiographic review was performed. TTC fusions performed in patients with osteoarthritis, posttraumatic arthritis, or deformity correction with retrograde nail fixation were included. Exclusion criteria included neuropathy, Charcot arthropathy, and failed total ankle replacement.<br><br>RESULTS: Ultimately, 66 retrograde TTC fusions (in 63 patients) met inclusion criteria. The average age was 57.0 years. There were 29 female and 34 male patients. Radiographic fusion of the ankle and STJ was demonstrated in 68.2% of the patients. There were 11 cases (16.7%) of ankle arthrodesis with STJ nonunion, 6 cases (9.1%) of STJ fusion but ankle nonunion, and 4 cases (6.1%) of stable radiographic nonunion of both joints. The mean time to subtalar fusion was 112.1 days. One patient required revision surgery and conversion to below-knee amputation. One patient required a CROW walker for assistance with gait.<br><br>CONCLUSION: A 22.8% radiographic nonunion rate of the STJ was noted in retrograde TTC fusion. Despite this, patients were stable and pain free.<br><br>LEVELS OF EVIDENCE: Level IV: Retrospective Case series.}, }
@article {pmid29154295, year = {2017}, author = {}, title = {Professional Tribute: Jay Neufeld.}, journal = {Journal of pediatric rehabilitation medicine}, volume = {10}, number = {3-4}, pages = {159-160}, doi = {10.3233/PRM-170468}, pmid = {29154295}, issn = {1875-8894}, }
@article {pmid29142017, year = {2017}, author = {Banerjee, S and Perelson, AS and Moses, M}, title = {Modelling the effects of phylogeny and body size on within-host pathogen replication and immune response.}, journal = {Journal of the Royal Society, Interface}, volume = {14}, number = {136}, pages = {}, doi = {10.1098/rsif.2017.0479}, pmid = {29142017}, issn = {1742-5662}, support = {P20 RR018754/RR/NCRR NIH HHS/United States ; R01 AI028433/AI/NIAID NIH HHS/United States ; R01 OD011095/OD/NIH HHS/United States ; }, mesh = {Animals ; *Birds/immunology/virology ; *Body Size ; Host-Parasite Interactions/*immunology ; Humans ; *Models, Immunological ; *Phylogeny ; West Nile virus/*physiology ; }, abstract = {Understanding how quickly pathogens replicate and how quickly the immune system responds is important for predicting the epidemic spread of emerging pathogens. Host body size, through its correlation with metabolic rates, is theoretically predicted to impact pathogen replication rates and immune system response rates. Here, we use mathematical models of viral time courses from multiple species of birds infected by a generalist pathogen (West Nile Virus; WNV) to test more thoroughly how disease progression and immune response depend on mass and host phylogeny. We use hierarchical Bayesian models coupled with nonlinear dynamical models of disease dynamics to incorporate the hierarchical nature of host phylogeny. Our analysis suggests an important role for both host phylogeny and species mass in determining factors important for viral spread such as the basic reproductive number, WNV production rate, peak viraemia in blood and competency of a host to infect mosquitoes. Our model is based on a principled analysis and gives a quantitative prediction for key epidemiological determinants and how they vary with species mass and phylogeny. This leads to new hypotheses about the mechanisms that cause certain taxonomic groups to have higher viraemia. For example, our models suggest that higher viral burst sizes cause corvids to have higher levels of viraemia and that the cellular rate of virus production is lower in larger species. We derive a metric of competency of a host to infect disease vectors and thereby sustain the disease between hosts. This suggests that smaller passerine species are highly competent at spreading the disease compared with larger non-passerine species. Our models lend mechanistic insight into why some species (smaller passerine species) are pathogen reservoirs and some (larger non-passerine species) are potentially dead-end hosts for WNV. Our techniques give insights into the role of body mass and host phylogeny in the spread of WNV and potentially other zoonotic diseases. The major contribution of this work is a computational framework for infectious disease modelling at the within-host level that leverages data from multiple species. This is likely to be of interest to modellers of infectious diseases that jump species barriers and infect multiple species. Our method can be used to computationally determine the competency of a host to infect mosquitoes that will sustain WNV and other zoonotic diseases. We find that smaller passerine species are more competent in spreading the disease than larger non-passerine species. This suggests the role of host phylogeny as an important determinant of within-host pathogen replication. Ultimately, we view our work as an important step in linking within-host viral dynamics models to between-host models that determine spread of infectious disease between different hosts.}, }
@article {pmid29131787, year = {2017}, author = {Rubin, R}, title = {Mary Crow: leader in research on systemic lupus erythematosus.}, journal = {Lancet (London, England)}, volume = {390}, number = {10103}, pages = {1636}, doi = {10.1016/S0140-6736(17)32554-0}, pmid = {29131787}, issn = {1474-547X}, }
@article {pmid29130067, year = {2017}, author = {Li, Y and Hannaford, B}, title = {Gaussian Process Regression for Sensorless Grip Force Estimation of Cable Driven Elongated Surgical Instruments.}, journal = {IEEE robotics and automation letters}, volume = {2}, number = {3}, pages = {1312-1319}, doi = {10.1109/LRA.2017.2666420}, pmid = {29130067}, issn = {2377-3766}, support = {R21 EB016122/EB/NIBIB NIH HHS/United States ; }, abstract = {Haptic feedback is a critical but a clinically missing component in robotic Minimally Invasive Surgeries. This paper proposes a Gaussian Process Regression(GPR) based scheme to address the gripping force estimation problem for clinically commonly used elongated cable-driven surgical instruments. Based on the cable-driven mechanism property studies and surgical robotic system properties, four different Gaussian Process Regression filters were designed and analyzed, including: one GPR filter with 2-dimensional inputs, one GPR filter with 3-dimensional inputs, one GPR Unscented Kalman Filter (UKF) with 2-dimensional inputs, and one GPR UKF with 3-dimensional inputs. The four proposed methods were compared with the dynamic model based UKF filter on a 10mm gripper on the Raven-II surgical robot platform. The experimental results demonstrated that the four proposed methods outperformed the dynamic model based method on precision and reliability without parameter tuning. And surprisingly, among the four methods, the simplest GPR Filter with 2-dimensional inputs has the best performance.}, }
@article {pmid29129070, year = {2017}, author = {Librizzi, M and Caradonna, F and Cruciata, I and Dębski, J and Sansook, S and Dadlez, M and Spencer, J and Luparello, C}, title = {Molecular Signatures Associated with Treatment of Triple-Negative MDA-MB231 Breast Cancer Cells with Histone Deacetylase Inhibitors JAHA and SAHA.}, journal = {Chemical research in toxicology}, volume = {30}, number = {12}, pages = {2187-2196}, doi = {10.1021/acs.chemrestox.7b00269}, pmid = {29129070}, issn = {1520-5010}, mesh = {Antineoplastic Agents/chemistry/*pharmacology ; Cell Line, Tumor ; Computational Biology ; Dose-Response Relationship, Drug ; Drug Screening Assays, Antitumor ; Ferrous Compounds/chemistry/*pharmacology ; Histone Deacetylase Inhibitors/chemistry/*pharmacology ; Humans ; Hydroxamic Acids/chemistry/*pharmacology ; Structure-Activity Relationship ; Triple Negative Breast Neoplasms/*drug therapy/*genetics/pathology ; }, abstract = {Jay Amin hydroxamic acid (JAHA; N8-ferrocenylN1-hydroxy-octanediamide) is a ferrocene-containing analogue of the histone deacetylase inhibitor (HDACi) suberoylanilide hydroxamic acid (SAHA). JAHA's cytotoxic activity on MDA-MB231 triple negative breast cancer (TNBC) cells at 72 h has been previously demonstrated with an IC50 of 8.45 μM. JAHA's lethal effect was found linked to perturbations of cell cycle, mitochondrial activity, signal transduction, and autophagy mechanisms. To glean novel insights on how MDA-MB231 breast cancer cells respond to the cytotoxic effect induced by JAHA, and to compare the biological effect with the related compound SAHA, we have employed a combination of differential display-PCR, proteome analysis, and COMET assay techniques and shown some differences in the molecular signature profiles induced by exposure to either HDACis. In particular, in contrast to the more numerous and diversified changes induced by SAHA, JAHA has shown a more selective impact on expression of molecular signatures involved in antioxidant activity and DNA repair. Besides expanding the biological knowledge of the effect exerted by the modifications in compound structures on cell phenotype, the molecular elements put in evidence in our study may provide promising targets for therapeutic interventions on TNBCs.}, }
@article {pmid29128976, year = {2018}, author = {Hartmann, K and Veit, L and Nieder, A}, title = {Neurons in the crow nidopallium caudolaterale encode varying durations of visual working memory periods.}, journal = {Experimental brain research}, volume = {236}, number = {1}, pages = {215-226}, doi = {10.1007/s00221-017-5120-3}, pmid = {29128976}, issn = {1432-1106}, support = {NI 618/6-1//Deutsche Forschungsgemeinschaft/International ; }, abstract = {Adaptive sequential behaviors rely on the bridging and integration of temporally separate information for the realization of prospective goals. Corvids' remarkable behavioral flexibility is thought to depend on the workings of the nidopallium caudolaterale (NCL), a high-level avian associative forebrain area. We trained carrion crows to remember visual items for three alternating delay durations in a delayed match-to-sample task and recorded single-unit activity from the NCL. Sample-selective delay activity, a correlate of visual working memory, was maintained throughout different working memory durations. Delay responses remained selective for the same preferred sample item across blocks with different delay durations. However, selectivity strength decreased with increasing delay durations, mirroring worsened behavioral performance with longer memory delays. Behavioral relevance of delay activity was further evidenced by reduced encoding of the preferred sample item during error trials. In addition, NCL neurons adapted their time-dependent discharges to blocks of different memory durations, so that delay duration could be successfully classified based on population activity a few trials after the delay duration switched. Therefore, NCL neurons not only maintain information from individual trials, but also keep track of the duration for which this information is needed in the context of the task. These results strengthen the role of corvid NCL in maintaining working memory for flexible control of temporally extended goal-directed behavior.}, }
@article {pmid29098484, year = {2017}, author = {Rudwick, MJS}, title = {The Fate of the Method of 'Paradigms' in Paleobiology.}, journal = {Journal of the history of biology}, volume = {}, number = {}, pages = {}, doi = {10.1007/s10739-017-9501-z}, pmid = {29098484}, issn = {1573-0387}, abstract = {An earlier article described the mid-twentieth century origins of the method of &quot;paradigms&quot; in paleobiology, as a way of making testable hypotheses about the functional morphology of extinct organisms. The present article describes the use of &quot;paradigms&quot; through the 1970s and, briefly, to the end of the century. After I had proposed the paradigm method to help interpret the ecological history of brachiopods, my students developed it in relation to that and other invertebrate phyla, notably in Euan Clarkson's analysis of vision in trilobites. David Raup's computer-aided &quot;theoretical morphology&quot; was then combined with my functional or adaptive emphasis, in Adolf Seilacher's tripartite &quot;constructional morphology.&quot; Stephen Jay Gould, who had strongly endorsed the method, later switched to criticizing the &quot;adaptationist program&quot; he claimed it embodied. Although the explicit use of paradigms in paleobiology had declined by the end of the century, the method was tacitly subsumed into functional morphology as &quot;biomechanics.&quot;}, }
@article {pmid29084259, year = {2017}, author = {Johnsen, A and Kearns, AM and Omland, KE and Anmarkrud, JA}, title = {Sequencing of the complete mitochondrial genome of the common raven Corvus corax (Aves: Corvidae) confirms mitogenome-wide deep lineages and a paraphyletic relationship with the Chihuahuan raven C. cryptoleucus.}, journal = {PloS one}, volume = {12}, number = {10}, pages = {e0187316}, doi = {10.1371/journal.pone.0187316}, pmid = {29084259}, issn = {1932-6203}, mesh = {Animals ; Crows/classification/*genetics ; *Genome, Mitochondrial ; Phylogeny ; Species Specificity ; }, abstract = {Previous studies based on single mitochondrial markers have shown that the common raven (Corvus corax) consists of two highly diverged lineages that are hypothesised to have undergone speciation reversal upon secondary contact. Furthermore, common ravens are paraphyletic with respect to the Chihuahuan raven (C. cryptoleucus) based on mitochondrial DNA (mtDNA). Here we explore the causes of mtDNA paraphyly by sequencing whole mitochondrial genomes of 12 common ravens from across the Northern Hemisphere, in addition to three Chihuahuan ravens and one closely related brown-necked raven (C. ruficollis) using a long-range PCR protocol. Our raven mitogenomes ranged between 16925-16928 bp in length. GC content varied from 43.3% to 43.8% and the 13 protein coding genes, two rRNAs and 22 tRNAs followed a standard avian mitochondrial arrangement. The overall divergence between the two common raven clades was 3% (range 0.3-5.8% in 16 regions including the protein coding genes, rRNAs and the control region). Phylogenies constructed from whole mitogenomes recovered the previously found mitochondrial sister relationship between the common raven California clade and the Chihuahuan raven (overall divergence 1.1%), which strengthens the hypothesis that mtDNA paraphyly in the common raven results from speciation reversal of previously distinct Holarctic and California lineages.}, }
@article {pmid29081434, year = {2017}, author = {Herzberg, D}, title = {Entitled to Addiction?: Pharmaceuticals, Race, and America's First Drug War.}, journal = {Bulletin of the history of medicine}, volume = {91}, number = {3}, pages = {586-623}, doi = {10.1353/bhm.2017.0061}, pmid = {29081434}, issn = {1086-3176}, support = {G13 LM012050/LM/NLM NIH HHS/United States ; }, mesh = {Drug and Narcotic Control/*history/legislation &amp; jurisprudence ; History, 20th Century ; Humans ; Racism/*history ; Substance-Related Disorders/*history/psychology ; United States ; United States Food and Drug Administration/*history/organization &amp; administration ; }, abstract = {This article rethinks the formative decades of American drug wars through a social history of addiction to pharmaceutical narcotics, sedatives, and stimulants in the first half of the twentieth century. It argues, first, that addiction to pharmaceutical drugs is no recent aberration; it has historically been more extensive than &quot;street&quot; or illicit drug use. Second, it argues that access to psychoactive pharmaceuticals was a problematic social entitlement constructed as distinctively medical amid the racialized reforms of the Progressive Era. The resulting drug control regime provided inadequate consumer protection for some (through the FDA), and overly punitive policing for others (through the FBN). Instead of seeing these as two separate stories-one a liberal triumph and the other a repressive scourge-both should be understood as part of the broader establishment of a consumer market for drugs segregated by class and race like other consumer markets developed in the era of Progressivism and Jim Crow.}, }
@article {pmid29078034, year = {2018}, author = {Hill, SD and Aryal, A and Pawley, MDM and Ji, W}, title = {So much for the city: Urban-rural song variation in a widespread Asiatic songbird.}, journal = {Integrative zoology}, volume = {13}, number = {2}, pages = {194-205}, doi = {10.1111/1749-4877.12284}, pmid = {29078034}, issn = {1749-4877}, mesh = {*Animal Distribution ; Animals ; Asia ; Cities ; Male ; Noise ; Songbirds/*physiology ; Vocalization, Animal/*physiology ; }, abstract = {Song plays a fundamental role in intraspecific communication in songbirds. The temporal and structural components of songs can vary in different habitats. These include urban habitats where anthropogenic sounds and alteration of habitat structure can significantly affect songbird vocal behavior. Urban-rural variations in song complexity, song length and syllable rate are not fully understood. In this study, using the oriental magpie-robin (Copsychus saularis) as a model, we investigated urban-rural variation in song complexity, song length, syllable rate, syllable length and inter-syllable interval. Comparing urban and rural songs from 7 countries across its natural Asiatic range (Bangladesh, India, Malaysia, Nepal, Singapore, Sri Lanka and Thailand), we found no significant differences in oriental magpie-robin song complexity. However, we found significant differences in temporal song variables between urban and rural sites. Longer songs and inter-syllable intervals in addition to slower syllable rates within urban sites contributed the most to this variance. This indicates that the urban environment may have driven production of longer and slower songs to maximize efficient transmission of important song information in urban habitats.}, }
@article {pmid29074881, year = {2017}, author = {Scasta, JD and Stam, B and Windh, JL}, title = {Rancher-reported efficacy of lethal and non-lethal livestock predation mitigation strategies for a suite of carnivores.}, journal = {Scientific reports}, volume = {7}, number = {1}, pages = {14105}, doi = {10.1038/s41598-017-14462-1}, pmid = {29074881}, issn = {2045-2322}, abstract = {Pastoralists have dealt with livestock losses from predators for millennia, yet effective mitigation strategies that balance wildlife conservation and sustainable agriculture are still needed today. In Wyoming, USA, 274 ranchers responded to a retrospective survey, and rated the efficacy of predation mitigation strategies for foxes, dogs, coyotes, wolves, bobcats, mountain lions, bears, and birds (buzzards, eagles, hawks, ravens). Rancher reported efficacy of mitigation varied by predator species, mitigation strategy, and lethality of strategies, but not livestock type. Ranchers perceive they were most effective at mitigating predation by foxes and coyotes, moderately effective at mitigating large carnivores, and the least effective at mitigating birds. Ranchers also reported that avian predators seem to be the most challenging predator type. The general perception was lethal mitigation strategies were more effective than non-lethal strategies, with guard animals showing the most potential among the non-lethal options. In general, ranchers did not perceive non-lethal strategies as a proxy for lethal strategies. However, a few ranchers reported being successful with non-lethal options such as herding, fencing, and stalling at night but more details about such successful applications are needed. Innovation in current or novel non-lethal mitigation strategies, and examples of efficacy, are needed to justify producer adoption.}, }
@article {pmid29065635, year = {2017}, author = {Li, X and Alemzadeh, H and Chen, D and Kalbarczyk, Z and Iyer, RK and Kesavadas, T}, title = {Surgeon Training in Telerobotic Surgery via a Hardware-in-the-Loop Simulator.}, journal = {Journal of healthcare engineering}, volume = {2017}, number = {}, pages = {6702919}, doi = {10.1155/2017/6702919}, pmid = {29065635}, issn = {2040-2295}, abstract = {This work presents a software and hardware framework for a telerobotic surgery safety and motor skill training simulator. The aims are at providing trainees a comprehensive simulator for acquiring essential skills to perform telerobotic surgery. Existing commercial robotic surgery simulators lack features for safety training and optimal motion planning, which are critical factors in ensuring patient safety and efficiency in operation. In this work, we propose a hardware-in-the-loop simulator directly introducing these two features. The proposed simulator is built upon the Raven-II™ open source surgical robot, integrated with a physics engine and a safety hazard injection engine. Also, a Fast Marching Tree-based motion planning algorithm is used to help trainee learn the optimal instrument motion patterns. The main contributions of this work are (1) reproducing safety hazards events, related to da Vinci™ system, reported to the FDA MAUDE database, with a novel haptic feedback strategy to provide feedback to the operator when the underlying dynamics differ from the real robot's states so that the operator will be aware and can mitigate the negative impact of the safety-critical events, and (2) using motion planner to generate semioptimal path in an interactive robotic surgery training environment.}, }
@article {pmid29062203, year = {2017}, author = {Fadel, HM and Afifi, R and Al-Qabili, DM}, title = {Characterization and zoonotic impact of Shiga toxin producing Escherichia coli in some wild bird species.}, journal = {Veterinary world}, volume = {10}, number = {9}, pages = {1118-1128}, doi = {10.14202/vetworld.2017.1118-1128}, pmid = {29062203}, issn = {0972-8988}, abstract = {AIM: Wild birds are considered silent vectors of some zoonotic water and food borne pathogens of public health significance. Owing to the importance of Shiga toxin producing Escherichia coli (STEC) as the most pathogenic among the emerging diarrheagenic E. coli groups that can infect man; the present study was designed to detect the occurrence of STEC among wild birds in Egypt.<br><br>MATERIALS AND METHODS: A total of 177 intestinal content swab samples originating from five wild bird species were investigated for the presence of E. coli and STEC by standard culture methods. Suspect STEC isolates were further characterized by serotyping, random amplified polymorphic DNA polymerase chain reaction (RAPD PCR), antimicrobial resistance pattern and PCR detection of stx1, stx2, and eae genes.<br><br>RESULTS: A total of 30 suspect STEC isolates from 30 positive birds' samples were detected and identified on STEC CHROMagar (semi-captive pigeons, 15; house crows, 8; cattle egrets, 3; moorhens, 2; and house teals, 2). 25 isolates were grouped into 13 serogroups (O:20, O:25, O:26, O:27, O:63, O:78, O:111, O:114, O:125, O:128, O:142, O:153, and O:158), while five were rough strains. The distribution of STEC virulence genes among wild birds was as follows: 16 birds carried stx1 gene only (nine pigeons [28.1%], six crows [7.1%], and one cattle egret [5.6%]). Stx1 and stx2 genes together were detected in four birds (one cattle egret [5.6%], two moorhens [6.1%], and one house teal, [10%]). Only one pigeon (3.1%) possessed the three alleles. Disk diffusion test results showed that cefixime was the most effective against STEC serotypes with (93.3%) sensitivity, followed by gentamycin (56.7%), and amoxicillin (50%). On the other hand, all the recovered STEC isolates were resistant to cefotaxime, doxycycline, cephalothin, and sulfisoxazole. RAPD fingerprinting using primers OPA-2 and OPA-9 showed that STEC isolates were heterogeneous; they yielded 30 and 27 different clusters, respectively.<br><br>CONCLUSIONS: Wild birds carry STEC and may add to the contamination of the surrounding environment.}, }
@article {pmid29053429, year = {2018}, author = {Allen, CR and Mara, A and Tulman, ER and Ley, DH and Geary, SJ}, title = {HOUSE FINCH (HAEMORHOUS MEXICANUS)-ASSOCIATED MYCOPLASMA GALLISEPTICUM IDENTIFIED IN LESSER GOLDFINCH (SPINUS PSALTRIA) AND WESTERN SCRUB JAY (APHELOCOMA CALIFORNICA) USING STRAIN-SPECIFIC QUANTITATIVE PCR.}, journal = {Journal of wildlife diseases}, volume = {54}, number = {1}, pages = {180-185}, doi = {10.7589/2017-04-079}, pmid = {29053429}, issn = {1943-3700}, abstract = {: In 1994 Mycoplasma gallisepticum was found to be the etiologic agent of House Finch (Haemorhous mexicanus) conjunctivitis, a rapidly expanding epidemic caused by a genetically discrete, House Finch-associated strain of M. gallisepticum (HFMG). While most prominent in House Finches, HFMG has been reported in other members of the family Fringillidae, including American Goldfinches (Spinus tristis), Purple Finches (Haemorhous purpureus), Pine Grosbeaks (Pinicola enucleator), and Evening Grosbeaks (Coccothraustes vespertinus). Herein we report two new potential host species of HFMG strain, the Lesser Goldfinch (Spinus psaltria), belonging to the Fringillidae family, and the Western (California) Scrub Jay (Aphelocoma californica), belonging to the Corvidae family. The latter is one of only two reports of HFMG being found outside the Fringillidae family, and of these is the only one reported outside of captivity. Furthermore, non-HFMG M. gallisepticum was identified in an American Crow (Corvus brachyrhynchos), indicating presence of additional strains in wild birds. Strain typing of M. gallisepticum isolates was done via HFMG-specific quantitative PCR analysis and validated using random amplified polymorphic DNA analysis. Our results suggested an expanded host range of HFMG strain, and further suggested that the host range of HFMG was not limited to members of the family Fringillidae.}, }
@article {pmid29052057, year = {2018}, author = {Kaszab, E and Marton, S and Forró, B and Bali, K and Lengyel, G and Bányai, K and Fehér, E}, title = {Characterization of the genomic sequence of a novel CRESS DNA virus identified in Eurasian jay (Garrulus glandarius).}, journal = {Archives of virology}, volume = {163}, number = {1}, pages = {285-289}, doi = {10.1007/s00705-017-3598-4}, pmid = {29052057}, issn = {1432-8798}, support = {Momentum//Magyar Tudományos Akadémia/ ; Bolyai scholarship//Magyar Tudományos Akadémia/ ; Bolyai scholarship//Magyar Tudományos Akadémia/ ; }, mesh = {Animals ; Bird Diseases/*virology ; DNA Viruses/*isolation &amp; purification ; DNA, Circular ; *Genome, Viral ; Genomics/*methods ; Passeriformes/*virology ; Phylogeny ; }, abstract = {Circular replication associated protein (Rep)-encoding ssDNA (CRESS DNA) viruses have diverse genomic architecture and are widely distributed in different ecosystems. In this study we characterized the complete genomic sequence of a novel circovirus-like virus, Garrulus glandarius associated circular virus-1 (GgaCV-1). The genome size (1971 nt) and other features (the nonanucleotide, rolling circle replication motif and SF3 helicase motif) are also reminiscent of circoviruses. Similar genomes with uni-directionally localized and overlapping rep and cap genes are typical of type V CRESS DNA viruses that were identified in invertebrates and environmental samples of aquatic ecosystems. GgaCV-1 showed the highest aa identity with partial rep sequences detected in bat feces (77%) and with the rep (54%) and cap (42%) of Lake Sarah-associated circular virus-23 of New Zealand freshwater mussel origin. A dietary origin for GgaCV-1 could not be excluded as the virus was detected in the cloacal swab specimen of an Eurasian jay. Further studies may help to reveal the linkage among variable organisms regarding virus transmission.}, }
@article {pmid29036268, year = {2018}, author = {Krieger, N and Jahn, JL and Waterman, PD and Chen, JT}, title = {Breast Cancer Estrogen Receptor Status According to Biological Generation: US Black and White Women Born 1915-1979.}, journal = {American journal of epidemiology}, volume = {187}, number = {5}, pages = {960-970}, doi = {10.1093/aje/kwx312}, pmid = {29036268}, issn = {1476-6256}, abstract = {Evidence suggests that contemporary population distributions of estrogen-receptor (ER) status among breast cancer patients may be shaped by earlier major societal events, such as the 1965 abolition of legal racial discrimination in the United States (state and local &quot;Jim Crow&quot; laws) and the Great Famine in China (1959-1961). We analyzed changes in ER status in relation to Jim Crow birthplace among the 46,417 black and 339,830 white US-born, non-Hispanic women in the Surveillance, Epidemiology, and End Results (SEER) 13 Registry Group who were born between 1915 and 1979 and diagnosed (ages 25-84 years, inclusive) during 1992-2012. We grouped the cases according to birth cohort and quantified the rate of change using the haldane (which scales change in relation to biological generation). The percentage of ER-positive cases rose according to birth cohort (1915-1919 to 1975-1979) only among women diagnosed before age 55. Changes according to biological generation were greater among black women than among white women, and among black women, they were greatest among those born in Jim Crow (versus non-Jim Crow) states, with this group being the only group to exhibit high haldane values (>|0.3|, indicating high rate of change). Our study's analytical approach and findings underscore the need to consider history and societal context when analyzing ER status among breast cancer patients and racial/ethnic inequities in its distribution.}, }
@article {pmid29018253, year = {2017}, author = {Bakonyi, T and Erdélyi, K and Brunthaler, R and Dán, Á and Weissenböck, H and Nowotny, N}, title = {Usutu virus, Austria and Hungary, 2010-2016.}, journal = {Emerging microbes &amp; infections}, volume = {6}, number = {10}, pages = {e85}, doi = {10.1038/emi.2017.72}, pmid = {29018253}, issn = {2222-1751}, mesh = {Animals ; Animals, Wild ; Austria/epidemiology ; Bird Diseases/epidemiology/pathology/*virology ; Communicable Diseases, Emerging/epidemiology/*veterinary ; Epidemiological Monitoring ; *Flavivirus/classification/isolation &amp; purification ; Flavivirus Infections/epidemiology/pathology/*veterinary ; Genome, Viral ; Hungary/epidemiology ; Phylogeny ; Viral Nonstructural Proteins/genetics ; }, abstract = {Usutu virus (USUV, Flaviviridae) was first reported in Europe in Austria in 2001, where it caused wild bird (mainly blackbird) mortality until 2005. Since 2006 no further USUV cases were diagnosed in the country. However, the virus emerged in other European countries (Hungary, Italy, Switzerland, Spain, Germany and the Czech Republic) between 2005 and 2011. In 2016, widespread USUV-associated wild bird mortality was observed in Germany, France, Belgium and the Netherlands. In this study, we report the results of passive monitoring for USUV in Austria and Hungary between 2010 and 2016. In Hungary, USUV caused sporadic cases of wild bird mortality between 2010 and 2015 (altogether 18 diagnosed cases), whereas in summer and autumn 2016 the number of cases considerably increased to 12 (ten blackbirds, one Eurasian jay and one starling). In Austria, USUV was identified in two blackbirds in 2016. Phylogenetic analyses of coding-complete genomes and partial regions of the NS5 protein gene revealed that USUVs from Hungary between 2010 and 2015 are closely related to the virus that emerged in Austria in 2001 and in Hungary in 2005, while one Hungarian sequence from 2015 and all sequences from Hungary and Austria from 2016 clustered together with USUV sequences reported from Italy between 2009 and 2010. The results of the study indicate continuous USUV circulation in the region and exchange of USUV strains between Italy, Austria and Hungary.Emerging Microbes &amp;Infections (2017) 6, e85; doi:10.1038/emi.2017.72; published online 11 October 2017.}, }
@article {pmid28989768, year = {2017}, author = {Lambert, ML and Schiestl, M and Schwing, R and Taylor, AH and Gajdon, GK and Slocombe, KE and Seed, AM}, title = {Function and flexibility of object exploration in kea and New Caledonian crows.}, journal = {Royal Society open science}, volume = {4}, number = {9}, pages = {170652}, doi = {10.1098/rsos.170652}, pmid = {28989768}, issn = {2054-5703}, abstract = {A range of non-human animals frequently manipulate and explore objects in their environment, which may enable them to learn about physical properties and potentially form more abstract concepts of properties such as weight and rigidity. Whether animals can apply the information learned during their exploration to solve novel problems, however, and whether they actually change their exploratory behaviour to seek functional information about objects have not been fully explored. We allowed kea (Nestor notabilis) and New Caledonian crows (Corvus moneduloides) to explore sets of novel objects both before and after encountering a task in which some of the objects could function as tools. Following this, subjects were given test trials in which they could choose among the objects they had explored to solve a tool-use task. Several individuals from both species performed above chance on these test trials, and only did so after exploring the objects, compared with a control experiment with no prior exploration phase. These results suggest that selection of functional tools may be guided by information acquired during exploration. Neither kea nor crows changed the duration or quality of their exploration after learning that the objects had a functional relevance, suggesting that birds do not adjust their behaviour to explicitly seek this information.}, }
@article {pmid28985619, year = {2017}, author = {Abbo, BG and Hulslander, LE and Goldade, DA}, title = {Determination of 20, 25-diazacholesterol in avian matrices by high performance liquid chromatography/tandem mass spectrometry.}, journal = {Journal of chromatography. B, Analytical technologies in the biomedical and life sciences}, volume = {1065-1066}, number = {}, pages = {129-133}, doi = {10.1016/j.jchromb.2017.09.028}, pmid = {28985619}, issn = {1873-376X}, mesh = {Animals ; Azacosterol/*analysis ; *Birds ; Chromatography, High Pressure Liquid/*methods ; Contraceptive Agents/*analysis ; Limit of Detection ; Linear Models ; Liver/chemistry ; Pest Control ; Reproducibility of Results ; Solid Phase Extraction/methods ; Tandem Mass Spectrometry/*methods ; Tissue Distribution ; }, abstract = {Wildlife contraceptives are an emerging tool for minimizing human-wildlife conflicts. One promising avian contraceptive compound, 20,25-diazacholesterol (DAC), reduces fertility by inhibiting cholesterol synthesis. A reliable analytical method for DAC was required in support of its registration for use as a reproductive control agent in pest bird species. A liquid chromatographic method employing tandem mass spectrometry (LC-MS/MS) was developed for the analysis of tissue extracts following solid phase extraction clean-up. Tissues analyzed were whole body samples from crows, monk parakeets, and quails and liver samples from crows and quails. Excellent sensitivity and selectivity was afforded by tandem mass spectrometry. The method accuracy of DAC from various tissue samples fortified at parts-per-million (ppm) and parts-per-billion (ppb) concentrations was high (>90%) with excellent precision (<10% relative standard deviation). Lower limits of detection were excellent in all tissues types, ranging from 1 to 11ppb in whole body matrices and 9.9-34ppb in liver matrices.}, }
@article {pmid28978738, year = {2017}, author = {Ręk, P and Magrath, RD}, title = {Deceptive vocal duets and multimodal display in a songbird.}, journal = {Proceedings. Biological sciences}, volume = {284}, number = {1864}, pages = {}, doi = {10.1098/rspb.2017.1774}, pmid = {28978738}, issn = {1471-2954}, mesh = {Animals ; Australian Capital Territory ; Female ; Male ; Songbirds/*physiology ; *Territoriality ; *Vocalization, Animal ; }, abstract = {Many group-living animals cooperatively signal to defend resources, but what stops deceptive signalling to competitors about coalition strength? Cooperative-signalling species include mated pairs of birds that sing duets to defend their territory. Individuals of these species sometimes sing 'pseudo-duets' by mimicking their partner's contribution, but it is unknown if these songs are deceptive, or why duets are normally reliable. We studied pseudo-duets in Australian magpie-larks, Grallina cyanoleuca, and tested whether multimodal signalling constrains deception. Magpie-larks give antiphonal duets coordinated with a visual display, with each sex typically choosing a different song type within the duet. Individuals produced pseudo-duets almost exclusively during nesting when partners were apart, but the two song types were used in sequence rather than antiphonally. Strikingly, birds hid and gave no visual displays, implying deceptive suppression of information. Acoustic playbacks showed that pseudo-duets provoked the same response from residents as true duets, regardless of whether they were sequential or antiphonal, and stronger response than that to true duets consisting of a single song type. By contrast, experiments with robot models showed that songs accompanied by movements of two birds prompted stronger responses than songs accompanied by movements of one bird, irrespective of the number of song types or singers. We conclude that magpie-larks used deceptive pseudo-duets when partners were apart, and suppressed the visual display to maintain the subterfuge. We suggest that the visual component of many species' duets provides the most reliable information about the number of signallers and may have evolved to maintain honesty in duet communication.}, }
@article {pmid28974636, year = {2017}, author = {Maartens, A}, title = {An interview with Jayaraj Rajagopal.}, journal = {Development (Cambridge, England)}, volume = {144}, number = {19}, pages = {3389-3391}, doi = {10.1242/dev.158220}, pmid = {28974636}, issn = {1477-9129}, mesh = {Animals ; Developmental Biology/*history ; History, 20th Century ; History, 21st Century ; Stem Cell Research ; }, abstract = {Jayaraj (Jay) Rajagopal is a Principal Investigator at the Center for Regenerative Medicine at Massachusetts General Hospital and an Associate Professor of Medicine at Harvard Medical School. A Howard Hughes Medical Institute Faculty Scholar, his lab works on the development and regeneration of the lung. He uses stem cell and animal models to develop novel insights that hopefully will provide inspiration for therapies to help treat human lung disease. He was awarded the Dr Susan Lim Award for Outstanding Young Investigator at the 2017 International Society for Stem Cell Research (ISSCR) meeting in Boston (MA,USA), where we met him to talk about how a fish tank started a life-long fascination with the lung, the transition to running his own lab, and his optimism for the future of both basic stem cell research and its clinical translation.}, }
@article {pmid28971040, year = {2017}, author = {Jo, SY and Hwang, JW and Pyun, SB}, title = {Relationship Between Cognitive Function and Dysphagia After Stroke.}, journal = {Annals of rehabilitation medicine}, volume = {41}, number = {4}, pages = {564-572}, doi = {10.5535/arm.2017.41.4.564}, pmid = {28971040}, issn = {2234-0645}, abstract = {OBJECTIVE: To investigate the characteristics of cognitive deficits in patients with post-stroke dysphagia, and to analyze the relationships between cognitive dysfunction and severity of dysphagia in supratentorial stroke.<br><br>METHODS: A total of 55 patients with first-ever supratentorial lesion stroke were enrolled retrospectively, within 3 months of onset. We rated dysphagia from 0 (normal) to 4 (severe) using the dysphagia severity scale (DSS) through clinical examinations and videofluoroscopic swallowing studies (VFSS). The subjects were classified either as non-dysphagic (scale 0) or dysphagic (scale 1 to 4). We compared general characteristics, stroke severity and the functional scores of the two groups. We then performed comprehensive cognitive function tests and investigated the differences in cognitive performance between the two groups, and analyzed the correlation between cognitive test scores, DSS, and parameters of oral and pharyngeal phase.<br><br>RESULTS: Fugl-Meyer motor assessment, the Berg Balance Scale, and the Korean version of the Modified Barthel Index showed significant differences between the two groups. Cognitive test scores for the dysphagia group were significantly lower than the non-dysphagia group. Significant correlations were shown between dysphagia severity and certain cognitive subtest scores: visual span backward (p=0.039), trail making tests A (p=0.042) and B (p=0.002), and Raven progressive matrices (p=0.002). The presence of dysphagia was also significantly correlated with cognitive subtests, in particular for visual attention and executive attention (odds ratio [OR]=1.009; 95% confidence interval [CI], 1.002-1.016; p=0.017). Parameters of premature loss were also significantly correlated with the same subtests (OR=1.009; 95% CI, 1.002-1.016; p=0.017).<br><br>CONCLUSION: Our results suggest that cognitive function is associated with the presence and severity of post-stroke dysphagia. Above all, visual attention and executive functions may have meaningful influence on the oral phase of swallowing in stroke patients with supratentorial lesions.}, }
@article {pmid28968822, year = {2017}, author = {McPhatter, LP and Su, T and Williams, G and Cheng, ML and Dhillon, M and Gerry, AC}, title = {Host-Feeding Patterns of Culex stigmatosoma (Diptera: Culicidae) in Southern California.}, journal = {Journal of medical entomology}, volume = {54}, number = {6}, pages = {1750-1757}, doi = {10.1093/jme/tjx154}, pmid = {28968822}, issn = {1938-2928}, mesh = {Animals ; *Birds ; California ; Cattle ; Cities ; *Culex ; Dogs ; Ecosystem ; Feeding Behavior ; Humans ; }, abstract = {Knowledge of the blood-feeding patterns exhibited by arthropod vectors is essential for understanding the complex dynamics of vector-borne disease transmission. Some species of mosquitoes belonging to the genus Culex have been implicated as having major roles in the transmission of arboviruses such as West Nile virus, Saint Louis encephalitis virus, and Western equine encephalitis virus. Although the host-feeding patterns for many of these Culex species are well studied, the host-feeding patterns of Culex stigmatosoma Dyar are relatively poorly studied, even though this species is suspected to be an important maintenance vector for West Nile virus and other arboviruses. In the current study, bloodmeals from 976 blood-engorged Cx. stigmatosoma, collected from 30 sites in southern California from 2009-2012, were processed for vertebrate host identification by nucleotide sequencing following polymerase chain reaction to amplify portions of the cytochrome oxidase I and cytochrome b genes of vertebrate animals. Vertebrate DNA was amplified, sequenced, and identified from a total of 647 Cx. stigmatosoma bloodmeals, revealing that 98.6% of bloodmeals were from birds, 1.2% from three mammal species, and a single bloodmeal was from a reptile species. In total, 40 different host species were identified. The greatest number of bloodmeals identified was from domestic chicken (Gallus gallus domesticus L.) (38% of bloodmeals), house sparrow (Passer domesticus L.) (23%), house finch (Haemorhous mexicanus Müller) (17%), American crow (Corvus brachyrhynchos L.) (4%), and mourning dove (Zenaida macroura L.) (3%). However, chicken bloodmeals were identified almost entirely from a single site where mosquito collection devices were placed in the near vicinity of confined domestic chickens. The strongly ornithophilic feeding behavior shown in this study for Cx. stigmatosoma supports the hypothesis that this mosquito species may be an important maintenance (or endemic) vector for arboviruses that circulate among susceptible birds.}, }
@article {pmid28968179, year = {2017}, author = {Krawiec, M and Woźniak-Biel, A and Bednarski, M and Wieliczko, A}, title = {Antimicrobial Susceptibility and Genotypic Characteristic of Campylobacter spp. Isolates from Free-Living Birds in Poland.}, journal = {Vector borne and zoonotic diseases (Larchmont, N.Y.)}, volume = {17}, number = {11}, pages = {755-763}, doi = {10.1089/vbz.2017.2116}, pmid = {28968179}, issn = {1557-7759}, mesh = {Animals ; Animals, Wild ; Anti-Bacterial Agents/pharmacology ; Bird Diseases/epidemiology/*microbiology ; *Birds ; Campylobacter/*drug effects/*genetics ; Campylobacter Infections/epidemiology/microbiology/*veterinary ; *Drug Resistance, Bacterial ; Poland/epidemiology ; }, abstract = {Campylobacter spp. is the most commonly reported, bacterial cause of human foodborne infection worldwide. Commercial poultry and free-living birds are natural reservoirs of three particular species: Campylobacter jejuni, Campylobacter coli, and Campylobacter lari. The aim of this study was to determine the genotypic characteristics and antibiotic susceptibility of 43 Campylobacter strains, obtained from free-living birds, in Poland. In total, 700 birds were examined. The strains were isolated from 43 birds (6.14%) from the feces of 7 wild bird species: Mallard ducks Anas platyrhynchos (29 positive/121 tested), great cormorants Phalacrocorax carbo (5/77), velvet scoters Melanitta fusca (4/30), tawny owls Strix aluco (2/5), common buzzard Buteo buteo (1/3), rook Corvus frugilegus (1/6), and Eurasian tree sparrow Passer montanus (1/30). Thirty-eight (88.37%) of obtained strains belonged to C. jejuni and five (11.63%) to C. coli. Other 428 examined birds from different bird species were Campylobacter negative. The antimicrobial susceptibility to nine antimicrobials was also studied in investigated isolates of Campylobacter spp. Sixteen of the examined strains (37.21% of all positive samples) showed susceptibility to all of the nine antimicrobials. Moreover, the prevalence of selected virulence genes, such as flaA, cadF, ceuE, virB11, cdtA, cdtB, and cdtC were all analyzed. The virulence gene that was found most frequently in total number of Campylobacter strains was ceuE (72.10%) and other genes, such as flaA, cadF, cdtA, cdtB, and cdtC, were found in over 60% of all examined strains. Variable antimicrobial susceptibility and the presence of different virulence genes of examined strains, isolated from free-living birds, suggest that special attention should be given to wild birds and any potential approaches to the control of antibiotic-resistant Campylobacter should be discussed.}, }
@article {pmid28966011, year = {2017}, author = {Nic Lughadha, E and Bachman, SP and Govaerts, R}, title = {Plant States and Fates: Response to Pimm and Raven.}, journal = {Trends in ecology &amp; evolution}, volume = {32}, number = {12}, pages = {887-889}, doi = {10.1016/j.tree.2017.09.005}, pmid = {28966011}, issn = {1872-8383}, mesh = {*Plants ; }, }
@article {pmid28963599, year = {2017}, author = {Stanton, L and Davis, E and Johnson, S and Gilbert, A and Benson-Amram, S}, title = {Adaptation of the Aesop's Fable paradigm for use with raccoons (Procyon lotor): considerations for future application in non-avian and non-primate species.}, journal = {Animal cognition}, volume = {20}, number = {6}, pages = {1147-1152}, doi = {10.1007/s10071-017-1129-z}, pmid = {28963599}, issn = {1435-9456}, mesh = {Animals ; *Cognition ; Female ; Male ; *Problem Solving ; Raccoons/*psychology ; Reward ; *Tool Use Behavior ; }, abstract = {To gain a better understanding of the evolution of animal cognition, it is necessary to test and compare the cognitive abilities of a broad array of taxa. Meaningful inter-species comparisons are best achieved by employing universal paradigms that standardize testing among species. Many cognitive paradigms, however, have been tested in only a few taxa, mostly birds and primates. One such example, known as the Aesop's Fable paradigm, is designed to assess causal understanding in animals using water displacement. To evaluate the universal effectiveness of the Aesop's Fable paradigm, we applied this paradigm to a previously untested taxon, the raccoon (Procyon lotor). We first trained captive raccoons to drop stones into a tube of water to retrieve a floating food reward. Next, we presented successful raccoons with objects that differed in the amount of water they displaced to determine whether raccoons could select the most functional option. Raccoons performed differently than corvids and human children did in previous studies of Aesop's Fable, and we found raccoons to be innovative in many aspects of this task. We suggest that raccoon performance in this paradigm reflected differences in tangential factors, such as behavior, morphology, and testing procedures, rather than cognitive deficiencies. We also present insight into previously undocumented challenges that should better inform future Aesop's Fable studies incorporating more diverse taxa.}, }
@article {pmid28953940, year = {2017}, author = {Lee, SI and Lee, H and Jablonski, PG and Choe, JC and Husby, M}, title = {Microbial abundance on the eggs of a passerine bird and related fitness consequences between urban and rural habitats.}, journal = {PloS one}, volume = {12}, number = {9}, pages = {e0185411}, doi = {10.1371/journal.pone.0185411}, pmid = {28953940}, issn = {1932-6203}, mesh = {Animals ; Climate ; Colony Count, Microbial ; *Ecosystem ; Eggs/*microbiology ; Passeriformes/*microbiology/physiology ; Real-Time Polymerase Chain Reaction ; }, abstract = {Urban environments present novel and challenging habitats to wildlife. In addition to well-known difference in abiotic factors between rural and urban environments, the biotic environment, including microbial fauna, may also differ significantly. In this study, we aimed to compare the change in microbial abundance on eggshells during incubation between urban and rural populations of a passerine bird, the Eurasian Magpie (Pica pica), and examine the consequences of any differences in microbial abundances in terms of hatching success and nestling survival. Using real-time PCR, we quantified the abundances of total bacteria, Escherichia coli/Shigella spp., surfactin-producing Bacillus spp. and Candida albicans on the eggshells of magpies. We found that urban magpie eggs harboured greater abundances of E. coli/Shigella spp. and C. albicans before incubation than rural magpie eggs. During incubation, there was an increase in the total bacterial load, but a decrease in C. albicans on urban eggs relative to rural eggs. Rural eggs showed a greater increase in E. coli/Shigella spp. relative to their urban counterpart. Hatching success of the brood was generally lower in urban than rural population. Nestling survival was differentially related with the eggshell microbial abundance between urban and rural populations, which was speculated to be the result of the difference in the strength of the interaction among the microbes. This is the first demonstration that avian clutches in urban and rural populations differ in eggshell microbial abundance, which can be further related to the difference in hatching success and nestling survival in these two types of environments. We suggest that future studies on the eggshell microbes should investigate the interaction among the microbes, because the incubation and/or environmental factors such as urbanization or climate condition can influence the dynamic interactions among the microbes on the eggshells which can further determine the breeding success of the parents.}, }
@article {pmid28946631, year = {2017}, author = {Neary, J and Goodwin, SE and Cohen, LB and Neuman, MG}, title = {Alcohol Misuse Link to POEMS Syndrome in a Patient.}, journal = {Cancers}, volume = {9}, number = {10}, pages = {}, doi = {10.3390/cancers9100129}, pmid = {28946631}, issn = {2072-6694}, abstract = {Previously called Crow-Fukase syndrome, POEMS syndrome is characterized by poly-neuropathy, osteo-sclerotic myeloma, organomegaly, endocrinopathy, monoclonal plasma cell disorder, and skin changes. Extremely elevated levels of serum vascular endothelial growth factor (VEGF) are characteristic of the syndrome. Chronic hepatitis B (HBV) and C (HCV) infections can also be present in POEMS. The pathogenesis of the syndrome is not well understood. The link between chronic alcohol consumption and this malignant condition has not been reported until now. In addition, no previous study has evaluated the influence of cytokine and chemokines or viruses in the severity and evolution of POEMS.<br><br>OBJECTIVES: (1) to describe a heavy-alcohol user, who was diagnosed with POEMS; (2) to demonstrate the utility of quantitative measurement of serum levels of VEGF in the diagnosis of POEMS and the monitoring of therapeutic interventions; (3) to demonstrate that overproduction of pro-inflammatory cytokines is a characteristic of POEMS.<br><br>METHODS: We describe a case of a POEMS patient presenting HCV and who is a heavy drinker; we compare the serum levels of cytokines and chemokines between the POEMS patient with 80 patients with HCV, 12 healthy controls, and 80 individuals with alcoholic liver disease (ALD). We quantified (ELISA pg/mL) the levels of VEGF, Interferon gamma (IFN-γ), Tumor Necrosis Factor alpha (TNF-α), Regulated-upon-Activation Normal-T-cell-Expressed and presumably-Secreted (RANTES), and Nuclear Factor kappa-B (NFκB).<br><br>RESULTS: In POEMS patients, VEGF levels were elevated versus control or other diseases, TNFα levels were higher versus control, but lower when compared with HCV or ALD patients. VEGF levels in POEMS patients decreased with therapeutic intervention.<br><br>CONCLUSIONS: Chronic alcohol misuse can be a strong risk factor to rare malignancies such as POEMS syndrome. Extreme elevation of VEGF levels is diagnostic for POEMS syndrome, and should be followed to assess response to therapy. In addition, other comorbidities should be considered individually to ensure personalized therapeutic intervention.}, }
@article {pmid28940309, year = {2017}, author = {Gone, JP}, title = {&quot;It Felt Like Violence&quot;: Indigenous Knowledge Traditions and the Postcolonial Ethics of Academic Inquiry and Community Engagement.}, journal = {American journal of community psychology}, volume = {60}, number = {3-4}, pages = {353-360}, doi = {10.1002/ajcp.12183}, pmid = {28940309}, issn = {1573-2770}, abstract = {In a 2014 presentation at an academic conference featuring an American Indian community audience, I critically engaged the assumptions and commitments of Indigenous Research Methodologies. These methodologies have been described as approaches and procedures for conducting research that stem from long-subjugated Indigenous epistemologies (or &quot;ways of knowing&quot;). In my presentation, I described a Crow Indian religious tradition known as a skull medicine as an example of an indigenous way of knowing, referring to a historical photograph of a skull medicine bundle depicted on an accompanying slide. This occasioned consternation among many in attendance, some of whom later asserted that it was unethical for me to have presented this information because of Indigenous cultural proscriptions against publicizing sacred knowledge and photographing sacred objects. This ethical challenge depends on enduring religious sensibilities in Northern Plains Indian communities, as embedded within a postcolonial political critique concerning the accession of sacred objects by Euro-American collectors during the early 20th century. I complicate these ethical claims by considering competing goods that are valued by community psychologists, ultimately acknowledging that the associated ethical challenge resists resolution in terms that would be acceptable to diverse constituencies.}, }
@article {pmid28931706, year = {2017}, author = {Zinman, B and Skyler, JS and Riddle, MC and Ferrannini, E}, title = {Diabetes Research and Care Through the Ages.}, journal = {Diabetes care}, volume = {40}, number = {10}, pages = {1302-1313}, doi = {10.2337/dci17-0042}, pmid = {28931706}, issn = {1935-5548}, mesh = {California ; Congresses as Topic ; Diabetes Mellitus/*diet therapy/*drug therapy ; Diet ; *Disease Management ; Follow-Up Studies ; Humans ; Hypoglycemic Agents/blood/therapeutic use ; Insulin/blood/therapeutic use ; *Research Design ; Societies, Medical ; }, abstract = {As has been well established, the Diabetes Care journal's most visible signature event is the Diabetes Care Symposium held each year during the American Diabetes Association's Scientific Sessions. Held this past year on 10 June 2017 in San Diego, California, at the 77th Scientific Sessions, this event has become one of the most attended sessions during the Scientific Sessions. Each year, in order to continue to have the symposium generate interest, we revise the format and content of this event. For this past year, our 6th annual symposium, I felt it was time to provide a comprehensive overview of our efforts in diabetes care to determine, first and foremost, how we arrived at our current state of management. I also felt the narrative needed to include the current status of management, especially with a focus toward cardiovascular disease, and finally, we wanted to ask what the future holds. Toward this goal, I asked four of the most noted experts in the world to provide their opinion on this topic. The symposium started with a very thoughtful presentation by Dr. Jay Skyler entitled &quot;A Look Back as to How We Got Here.&quot; That was followed by two lectures on current concepts by Dr. Bernard Zinman entitled &quot;Current Treatment Paradigms Today-How Well Are We Doing?&quot; and by Dr. Matthew Riddle entitled &quot;Evolving Concepts and Future Directions for Cardiovascular Outcomes Trials.&quot; The final lecture for the symposium was delivered by Dr. Ele Ferrannini and was entitled &quot;What Does the Future Hold?&quot; As always, a well-attended and well-received symposium is now the norm for our signature event and our efforts were rewarded by the enthusiasm of the attendees. This narrative summarizes the lectures held at the symposium.-William T. CefaluChief Scientific, Medical &amp; Mission Officer, American Diabetes Association.}, }
@article {pmid28929247, year = {2017}, author = {Kabadayi, C and Krasheninnikova, A and O'Neill, L and van de Weijer, J and Osvath, M and von Bayern, AMP}, title = {Are parrots poor at motor self-regulation or is the cylinder task poor at measuring it?.}, journal = {Animal cognition}, volume = {20}, number = {6}, pages = {1137-1146}, doi = {10.1007/s10071-017-1131-5}, pmid = {28929247}, issn = {1435-9456}, mesh = {Animals ; Behavior, Animal ; Female ; *Inhibition (Psychology) ; Male ; Parrots/*physiology ; Psychomotor Performance ; Research Design ; *Self-Control ; }, abstract = {The ability to inhibit unproductive motor responses triggered by salient stimuli is a fundamental inhibitory skill. Such motor self-regulation is thought to underlie more complex cognitive mechanisms, like self-control. Recently, a large-scale study, comparing 36 species, found that absolute brain size best predicted competence in motor inhibition, with great apes as the best performers. This was challenged when three Corvus species (corvids) were found to parallel great apes despite having much smaller absolute brain sizes. However, new analyses suggest that it is the number of pallial neurons, and not absolute brain size per se, that correlates with levels of motor inhibition. Both studies used the cylinder task, a detour-reaching test where food is presented behind a transparent barrier. We tested four species from the order Psittaciformes (parrots) on this task. Like corvids, many parrots have relatively large brains, high numbers of pallial neurons, and solve challenging cognitive tasks. Nonetheless, parrots performed markedly worse than the Corvus species in the cylinder task and exhibited strong learning effects in performance and response times. Our results suggest either that parrots are poor at controlling their motor impulses, and hence that pallial neuronal numbers do not always correlate with such skills, or that the widely used cylinder task may not be a good measure of motor inhibition.}, }
@article {pmid28927634, year = {2017}, author = {Redshaw, J and Taylor, AH and Suddendorf, T}, title = {Flexible Planning in Ravens?.}, journal = {Trends in cognitive sciences}, volume = {21}, number = {11}, pages = {821-822}, doi = {10.1016/j.tics.2017.09.001}, pmid = {28927634}, issn = {1879-307X}, abstract = {Across two different contexts, Kabadayi and Osvath found that ravens preferentially selected items that could be used to obtain future rewards. Do these results demand a rethink of the evolution of flexible planning, or are there leaner alternative explanations for the performance of ravens?}, }
@article {pmid28925618, year = {2017}, author = {Oldham, KT}, title = {In memoriam: Jay L. Grosfeld, MD, FACS, champion for pediatric surgery patients.}, journal = {Bulletin of the American College of Surgeons}, volume = {102}, number = {1}, pages = {73-74}, pmid = {28925618}, issn = {0002-8045}, mesh = {General Surgery/*history ; History, 20th Century ; History, 21st Century ; Humans ; Pediatrics/*history ; United States ; }, }
@article {pmid28922382, year = {2017}, author = {Canestrari, D and Bolopo, D and Turlings, TCJ and Röder, G and Marcos, JM and Baglione, V}, title = {Formal comment to Soler et al.: Great spotted cuckoo nestlings have no antipredatory effect on magpie or carrion crow host nests in southern Spain.}, journal = {PloS one}, volume = {12}, number = {9}, pages = {e0184446}, doi = {10.1371/journal.pone.0184446}, pmid = {28922382}, issn = {1932-6203}, mesh = {Animals ; *Birds ; Crows ; Nesting Behavior ; *Passeriformes ; Spain ; }, }
@article {pmid28914409, year = {2018}, author = {Despinoy, F and Zemiti, N and Forestier, G and Sánchez, A and Jannin, P and Poignet, P}, title = {Evaluation of contactless human-machine interface for robotic surgical training.}, journal = {International journal of computer assisted radiology and surgery}, volume = {13}, number = {1}, pages = {13-24}, doi = {10.1007/s11548-017-1666-6}, pmid = {28914409}, issn = {1861-6429}, mesh = {Gestures ; Humans ; Robotic Surgical Procedures/*education/methods ; *User-Computer Interface ; }, abstract = {PURPOSE: Teleoperated robotic systems are nowadays routinely used for specific interventions. Benefits of robotic training courses have already been acknowledged by the community since manipulation of such systems requires dedicated training. However, robotic surgical simulators remain expensive and require a dedicated human-machine interface.<br><br>METHODS: We present a low-cost contactless optical sensor, the Leap Motion, as a novel control device to manipulate the RAVEN-II robot. We compare peg manipulations during a training task with a contact-based device, the electro-mechanical Sigma.7. We perform two complementary analyses to quantitatively assess the performance of each control method: a metric-based comparison and a novel unsupervised spatiotemporal trajectory clustering.<br><br>RESULTS: We show that contactless control does not offer as good manipulability as the contact-based. Where part of the metric-based evaluation presents the mechanical control better than the contactless one, the unsupervised spatiotemporal trajectory clustering from the surgical tool motions highlights specific signature inferred by the human-machine interfaces.<br><br>CONCLUSIONS: Even if the current implementation of contactless control does not overtake manipulation with high-standard mechanical interface, we demonstrate that using the optical sensor complete control of the surgical instruments is feasible. The proposed method allows fine tracking of the trainee's hands in order to execute dexterous laparoscopic training gestures. This work is promising for development of future human-machine interfaces dedicated to robotic surgical training systems.}, }
@article {pmid28905251, year = {2017}, author = {Brecht, KF and Wagener, L and Ostojić, L and Clayton, NS and Nieder, A}, title = {Comparing the face inversion effect in crows and humans.}, journal = {Journal of comparative physiology. A, Neuroethology, sensory, neural, and behavioral physiology}, volume = {203}, number = {12}, pages = {1017-1027}, doi = {10.1007/s00359-017-1211-7}, pmid = {28905251}, issn = {1432-1351}, support = {NI 618/7-1//Deutsche Forschungsgemeinschaft/ ; }, mesh = {Adult ; Animals ; Crows/*physiology ; Facial Recognition/*physiology ; Female ; Humans ; Male ; Young Adult ; }, abstract = {Humans show impaired recognition of faces that are presented upside down, a phenomenon termed face inversion effect, which is thought to reflect the special relevance of faces for humans. Here, we investigated whether a phylogenetically distantly related avian species, the carrion crow, with similar socio-cognitive abilities to human and non-human primates, exhibits a face inversion effect. In a delayed matching-to-sample task, two crows had to differentiate profiles of crow faces as well as matched controls, presented both upright and inverted. Because crows can discriminate humans based on their faces, we also assessed the face inversion effect using human faces. Both crows performed better with crow faces than with human faces and performed worse when responding to inverted pictures in general compared to upright pictures. However, neither of the crows showed a face inversion effect. For comparative reasons, the tests were repeated with human subjects. As expected, humans showed a face-specific inversion effect. Therefore, we did not find any evidence that crows-like humans-process faces as a special visual stimulus. Instead, individual recognition in crows may be based on cues other than a conspecific's facial profile, such as their body, or on processing of local features rather than holistic processing.}, }
@article {pmid28901322, year = {2017}, author = {Hou, Y and Zhao, X and Chen, J and Zhou, J and Chen, W and Mao, H and Chen, R}, title = {Effects of Macrothele raven venom on intrarenal invasion and metastasis of H22 liver cancer cells in mice.}, journal = {Journal of cancer research and therapeutics}, volume = {13}, number = {4}, pages = {725-729}, doi = {10.4103/jcrt.JCRT_1286_16}, pmid = {28901322}, issn = {1998-4138}, mesh = {Animals ; Apoptosis/drug effects ; Arachnida/chemistry ; Carcinoma, Hepatocellular/*drug therapy/genetics/pathology ; Cell Line, Tumor ; Cell Proliferation/*drug effects ; Humans ; Liver Neoplasms/*drug therapy/pathology ; Mice ; Neoplasm Invasiveness/pathology ; Neoplasm Metastasis ; Phosphatidylinositol 3-Kinases/genetics ; Proto-Oncogene Proteins c-akt/genetics ; Signal Transduction/drug effects ; TOR Serine-Threonine Kinases/genetics ; Venoms/*administration &amp; dosage/chemistry ; Xenograft Model Antitumor Assays ; }, abstract = {BACKGROUND: Extrahepatic metastatic hepatocellular carcinoma (HCC) and its insensitivity to chemotherapy are the main causes of poor prognosis in patients with HCC. This study investigated the anti-cancer effect of Macrothele raveni venom on intrarenal metastatic HCC.<br><br>MATERIALS AND METHODS: Subrenal capsule xenograft model of HCC was established by inoculation of H22 liver cancer cells.<br><br>RESULTS: The general health, histology, and molecular changes were observed after administering 10 times of different dose of Macrothele raven venom injections. A volume of 0.8 μg/ml and 1.0 μg/ml of Macrothele raven venom significantly improved general health status in mice with subrenal capsule HCC tumors. Hematoxylin and eosin staining showed that Macrothele raven venom dose-dependently reduced invasion and metastasis of liver cancer cells in the kidney. Immunohistochemistry and real-time polymerase chain reaction showed that Macrothele raven venom injection dose-dependently decreased PI3K mRNA and protein, Akt protein, and mTOR mRNA expression, but increased Bad mRNA and protein expression in the kidney with H22 tumor cell invasion. 0.8 μg/ml is the most effective dose for the treatment of intrarenal metastatic HCC.<br><br>CONCLUSIONS: Macrothele raven venom dose-dependently inhibits invasion and metastasis of intrarenal metastatic HCC through inhibition of PI3K-Akt-mTOR signaling and increase of Bad expression.}, }
@article {pmid28899382, year = {2017}, author = {Schmid, S and Fachet, K and Dinkel, A and Mackenstedt, U and Woog, F}, title = {Carrion crows (Corvus corone) of southwest Germany: important hosts for haemosporidian parasites.}, journal = {Malaria journal}, volume = {16}, number = {1}, pages = {369}, doi = {10.1186/s12936-017-2023-5}, pmid = {28899382}, issn = {1475-2875}, mesh = {Age Factors ; Animals ; *Crows ; DNA, Protozoan/analysis ; Female ; Germany/epidemiology ; Haemosporida/classification/*isolation &amp; purification ; Male ; *Phylogeny ; Polymerase Chain Reaction/veterinary ; Prevalence ; Protozoan Infections, Animal/*epidemiology/parasitology ; Species Specificity ; }, abstract = {BACKGROUND: Avian malaria parasites (Plasmodium spp.) and other Haemosporida (Haemoproteus and Leucocytozoon spp.) form a diverse group of vector-transmitted blood parasites that are abundant in many bird families. Recent studies have suggested that corvids may be an important host for Plasmodium spp. and Leucocytozoon spp.<br><br>METHODS: To investigate the diversity of Haemosporida of resident carrion crows (Corvus corone) and Eurasian Magpies (Pica pica) in southwest Germany, 100 liver samples of corvids were examined using a nested PCR method to amplify a 1063 bp fragment of the haemosporidian mitochondrial cytochrome b gene. The phylogenetic relationship of parasite lineages obtained from these birds was inferred.<br><br>RESULTS: Haemosporidian DNA was detected in 85 carrion crows (89.5%) and in all five Eurasian Magpies. The most abundant parasite genus was Leucocytozoon with a prevalence of 85.3% (n = 95). 65.3% of the samples (n = 62) contained multiple infections. Thirteen haemosporidian lineages were isolated from the corvid samples. Female carrion crows were more likely infected with haemosporidian parasites than males.<br><br>DISCUSSION: This study provides the first insight into the diversity of haemosporidian parasites of corvids in Germany. Very high prevalences were found and based on the applied diagnostic method also a high amount of multiple infections could be detected. Due to the high diversity of haemosporidian parasites found in corvids, they seem to be excellent model organisms to test species deliminations in haemosporidian parasites.}, }
@article {pmid28895948, year = {2017}, author = {Marley, SA and Erbe, C and Kent, CPS}, title = {Underwater recordings of the whistles of bottlenose dolphins in Fremantle Inner Harbour, Western Australia.}, journal = {Scientific data}, volume = {4}, number = {}, pages = {170126}, doi = {10.1038/sdata.2017.126}, pmid = {28895948}, issn = {2052-4463}, mesh = {Animals ; *Bottle-Nosed Dolphin ; *Vocalization, Animal ; Western Australia ; }, abstract = {Dolphins use frequency-modulated whistles for a variety of social functions. Whistles vary in their characteristics according to context, such as activity state, group size, group composition, geographic location, and ambient noise levels. Therefore, comparison of whistle characteristics can be used to address numerous research questions regarding dolphin populations and behaviour. However, logistical and economic constraints on dolphin research have resulted in data collection biases, inconsistent analytical approaches, and knowledge gaps. This Data Descriptor presents an acoustic dataset of bottlenose dolphin (Tursiops aduncus) whistles recorded in the Fremantle Inner Harbour, Western Australia. Data were collected using an autonomous recorder and analysed using a range of acoustic measurements. Acoustic data review identified 336 whistles, which were subsequently measured for six key characteristics using Raven Pro software. Of these, 164 'high-quality' whistles were manually measured to provide an additional five acoustic characteristics. Digital files of individual whistles and corresponding measurements make this dataset available to researchers to address future questions regarding variations within and between dolphin communities.}, }
@article {pmid28878059, year = {2017}, author = {Laumer, IB and Bugnyar, T and Reber, SA and Auersperg, AMI}, title = {Can hook-bending be let off the hook? Bending/unbending of pliant tools by cockatoos.}, journal = {Proceedings. Biological sciences}, volume = {284}, number = {1862}, pages = {}, doi = {10.1098/rspb.2017.1026}, pmid = {28878059}, issn = {1471-2954}, mesh = {Animals ; *Cockatoos ; *Learning ; *Tool Use Behavior ; }, abstract = {The spontaneous crafting of hook-tools from bendable material to lift a basket out of a vertical tube in corvids has widely been used as one of the prime examples of animal tool innovation. However, it was recently suggested that the animals' solution was hardly innovative but strongly influenced by predispositions from habitual tool use and nest building. We tested Goffin's cockatoo, which is neither a specialized tool user nor a nest builder, on a similar task set-up. Three birds individually learned to bend hook tools from straight wire to retrieve food from vertical tubes and four subjects unbent wire to retrieve food from horizontal tubes. Pre-experience with ready-made hooks had some effect but was not necessary for success. Our results indicate that the ability to represent and manufacture tools according to a current need does not require genetically hardwired behavioural routines, but can indeed arise innovatively from domain general cognitive processing.}, }
@article {pmid28874242, year = {2017}, author = {Viuff, SL and Plenge, U and Belhage, B and Boushel, R and Koester, T}, title = {Effects of low-dose recombinant human erythropoietin treatment on cognitive performance.}, journal = {Danish medical journal}, volume = {64}, number = {9}, pages = {}, pmid = {28874242}, issn = {2245-1919}, abstract = {INTRODUCTION: High-dose recombinant human erythropoietin (rhEpo) has been shown to improve cognitive performance in both healthy volunteers and in patients suffering from diseases affecting the brain. The aim of this study was to examine whether administration of low-dose and even micro-dose rhEpo improves cognitive performance in healthy volunteers.<br><br>METHODS: We enrolled 25 healthy volunteers in a double-blind, randomised, placebo-controlled study to receive either low-dose rhEpo (n = 8, 60 IU/kg/week), micro-dose rhEpo (n = 9, 20 IU/kg/week), or saline (n = 8) for four weeks. Two cognitive performance-tests, the Raven Standard Progressive Matrices (Raven) and the Number Finder (NUFI), were performed during the first and last day of the study period. Semi-structured interviews were conducted weekly and were coded according to a scale.<br><br>RESULTS: Subjects receiving micro-dose rhEpo improved significantly measured by the Raven score (p = 0.04), and subjects receiving low-dose rhEpo treatment improved significantly measured by the NUFI score (p = 0.047), whereas no improvement was found in experienced cognitive performance in any of the groups. We found no significant difference in either Raven, NUFI or self-reported results between the groups.<br><br>CONCLUSIONS: In this small study, we found no significant effect of low-dose or micro-dose rhEpo on visual attention, cognitive performance in complex cognitive tasks or self-experienced cognitive performance compared with placebo.<br><br>FUNDING: The Aase and Ejnar Danielsen's Foundation. Danish Ministry of Science, Innovation and Higher Education.<br><br>TRIAL REGISTRATION: ClinicalTrials.gov identifier: NCT03093506.}, }
@article {pmid28874011, year = {2017}, author = {Thiemann, TC and Woodward, DL and Fang, Y and Ryan, BM and Nelms, BM and Scott, JJ and Reisen, WK}, title = {Abundance and Bloodfeeding Patterns of Mosquitoes (Diptera: Culicidae) in an Oak Woodland on the Eastern Slope of the Northern Coast Range of California.}, journal = {Journal of medical entomology}, volume = {54}, number = {5}, pages = {1344-1353}, doi = {10.1093/jme/tjx078}, pmid = {28874011}, issn = {1938-2928}, mesh = {Animals ; *Birds ; California ; Culicidae/enzymology/genetics/*physiology ; Electron Transport Complex IV/genetics ; Feeding Behavior ; Female ; *Food Chain ; Forests ; Insect Proteins/genetics ; *Mammals ; Population Dynamics ; Seasons ; Sequence Analysis, DNA ; }, abstract = {The abundance and bloodfeeding patterns of mosquitoes was studied from 2008 to 2010 at an 18 ha. oak woodland in Lake County, CA. Host-seeking females were collected weekly from sunset to sunrise by paired dry-ice-baited CDC style traps, whereas resting females were aspirated from paired walk-in red boxes. Sequences of the COI gene amplified from bloodmeals from engorged resting females were used to identify the bloodmeal hosts. Aedes sierrensis (Ludlow) and Aedes increpitus Dyar complex mosquitoes were univoltine, although the timing of emergence and abundance varied temporally and seemed weather dependent. Abundance of both Anopheles franciscanus McCracken and Anopheles freeborni Aitken peaked in mid to late summer. Females of both genera bloodfed primarily on mule deer and black-tailed jackrabbits, and few fed on either dogs or humans that were consistently present within the woodland. In contrast, multivoltine Culex tarsalis Coquillett and Culex stigmatosoma Dyar were abundant throughout summer, especially from July to September. Both Culex species bloodfed on a wide variety of avian hosts, with most bloodmeals originating from California scrub-jay, wild turkey, oak titmouse, and house finch. Culex tarsalis fed on proportionately more mammals as summer progressed, peaking at 33% in September.}, }
@article {pmid28873035, year = {2017}, author = {DeCarlo, C and Omar, AH and Haroun, MI and Bigler, L and Bin Rais, MN and Abu, J and Omar, AR and Mohammed, HO}, title = {Potential Reservoir and Associated Factors for West Nile Virus in Three Distinct Climatological Zones.}, journal = {Vector borne and zoonotic diseases (Larchmont, N.Y.)}, volume = {17}, number = {10}, pages = {709-713}, doi = {10.1089/vbz.2016.2098}, pmid = {28873035}, issn = {1557-7759}, mesh = {Animals ; Birds/*virology ; Climate ; Disease Reservoirs/*veterinary ; Malaysia/epidemiology ; Mammals/*virology ; Qatar/epidemiology ; United States/epidemiology ; West Nile Fever/epidemiology/*veterinary/virology ; West Nile virus/*isolation &amp; purification ; Zoonoses ; }, abstract = {West Nile virus (WNV) is a zoonotic single-strand RNA arbovirus (family Flaviviridae: Flavivirus), transmitted among avian hosts in enzootic cycles by a mosquito vector. The virus has a significant disease effect on humans and equines when it bridges into a cycle with various sequelae with epidemic potential. This study was carried out to identify the potential spectrum of WNV hosts in three geographic areas with climatologically distinct features: Malaysia, Qatar, and the United States of America (U.S.). Serum samples were collected from avian and mammal species suspected to be reservoirs for the virus at these areas in a cross-sectional epidemiologic study. The samples were tested for the presence of antibodies against the virus using an enzyme-linked immunosorbent assay. Data on putative risk factors were also collected and analyzed for significance of association with seropositivity using the logistic regression analysis. Among the tested avian and mammalian species, raccoons had the highest seroconversion rate (54%) followed by crows (30%), horses (27%), camels (10%), other avian species (7%), and canine species (3%). It was almost twice as likely to detect seroconversion among these mammalian and avian species in the fall in comparison to other seasons of the year. Only mammalian and avian species and seasons of the year were significantly associated with the likelihood of seroconversion to WNV when we controlled for other factors in the multivariate analysis. Our data from the U.S. showed that raccoons and camels are susceptible to infection by the virus and may play a role in the perpetuation of endemic foci for the disease.}, }
@article {pmid28861014, year = {2017}, author = {Franco, MDG and Beja, MJ and Candeias, A and Santos, N}, title = {Emotion Understanding, Social Competence and School Achievement in Children from Primary School in Portugal.}, journal = {Frontiers in psychology}, volume = {8}, number = {}, pages = {1376}, doi = {10.3389/fpsyg.2017.01376}, pmid = {28861014}, issn = {1664-1078}, abstract = {This study analyzes the relationship between emotion understanding and school achievement in children of primary school, considering age, gender, fluid intelligence, mother's educational level and social competence. In this study participated 406 children of primary school. The instruments used were the Test of Emotion Comprehension, Colored Progressive Matrices of Raven, Socially Action and Interpersonal Problem Solving Scale. The structural equation model showed the relationship between the emotion understanding and school performance depends on a mediator variable that in the context of the study was designated social competence. Age appear as an explanatory factor of the differences found, the mother's educational level only predicts significantly social emotional competence, fluid intelligence is a predictor of emotion understanding, school achievement and social emotional competence. Regarding the influence of sex, emotional understanding does not emerge as a significant predictor of social emotional competence in girls or boys. Multiple relationships between the various factors associated with school achievement and social emotional competence are discussed as well as their implications in promoting child development and school success.}, }
@article {pmid28857604, year = {2017}, author = {Schwing, R and Weber, S and Bugnyar, T}, title = {Kea (Nestor notabilis) decide early when to wait in food exchange task.}, journal = {Journal of comparative psychology (Washington, D.C. : 1983)}, volume = {131}, number = {4}, pages = {269-276}, doi = {10.1037/com0000086}, pmid = {28857604}, issn = {1939-2087}, support = {//Austrian Science Fund (FWF)/ ; }, mesh = {Animals ; Behavior, Animal/*physiology ; Delay Discounting/*physiology ; Female ; Food ; Male ; Psittaciformes/*physiology ; }, abstract = {The ability to forego an immediate reward in favor of a bigger or better one at a later point has been linked with advanced cognitive skills, such as impulse control and forward-planning, and can be assessed by the classic food exchange paradigm. While the ability to perform in such tasks has long been regarded as an exclusive trait of humans and some mammals, that is, primates and dogs, in recent years some bird species have been found to perform similarly as primates. Here we test 10 captive kea (Nestor notabilis), using a food exchange paradigm standardized in earlier experiments, but adding the use of a container to hold the initial item. The subjects reached waiting times of up to 160 s. They also showed significantly different results depending on the difference in the preference level for the presented food items, as well as clearly nonrandom waiting times, displaying forward-planning and economic evaluation of the situation at hand. As in most other species, results were markedly better when exchanging for quality as opposed to quantity. These results provide further evidence for temporal discounting in birds and fit in with the data gained on corvids and parrots in recent years. (PsycINFO Database Record}, }
@article {pmid28847742, year = {2017}, author = {Fausto, F and Cuevas, E and Valdivia, A and González, A}, title = {A global optimization algorithm inspired in the behavior of selfish herds.}, journal = {Bio Systems}, volume = {160}, number = {}, pages = {39-55}, doi = {10.1016/j.biosystems.2017.07.010}, pmid = {28847742}, issn = {1872-8324}, mesh = {*Algorithms ; Animals ; Biological Evolution ; Crows/physiology ; Insecta/physiology ; *Mass Behavior ; *Predatory Behavior ; }, abstract = {In this paper, a novel swarm optimization algorithm called the Selfish Herd Optimizer (SHO) is proposed for solving global optimization problems. SHO is based on the simulation of the widely observed selfish herd behavior manifested by individuals within a herd of animals subjected to some form of predation risk. In SHO, individuals emulate the predatory interactions between groups of prey and predators by two types of search agents: the members of a selfish herd (the prey) and a pack of hungry predators. Depending on their classification as either a prey or a predator, each individual is conducted by a set of unique evolutionary operators inspired by such prey-predator relationship. These unique traits allow SHO to improve the balance between exploration and exploitation without altering the population size. To illustrate the proficiency and robustness of the proposed method, it is compared to other well-known evolutionary optimization approaches such as Particle Swarm Optimization (PSO), Artificial Bee Colony (ABC), Firefly Algorithm (FA), Differential Evolution (DE), Genetic Algorithms (GA), Crow Search Algorithm (CSA), Dragonfly Algorithm (DA), Moth-flame Optimization Algorithm (MOA) and Sine Cosine Algorithm (SCA). The comparison examines several standard benchmark functions, commonly considered within the literature of evolutionary algorithms. The experimental results show the remarkable performance of our proposed approach against those of the other compared methods, and as such SHO is proven to be an excellent alternative to solve global optimization problems.}, }
@article {pmid28828271, year = {2017}, author = {Meijer, HJM and Awe Due, R and Sutikna, T and Saptomo, W and Jatmiko,  and Wasisto, S and Tocheri, MW and Mayr, G}, title = {Late Pleistocene songbirds of Liang Bua (Flores, Indonesia); the first fossil passerine fauna described from Wallacea.}, journal = {PeerJ}, volume = {5}, number = {}, pages = {e3676}, doi = {10.7717/peerj.3676}, pmid = {28828271}, issn = {2167-8359}, abstract = {BACKGROUND: Passerines (Aves: Passeriformes) dominate modern terrestrial bird communities yet their fossil record is limited. Liang Bua is a large cave on the Indonesian island of Flores that preserves Late Pleistocene-Holocene deposits (∼190 ka to present day). Birds are the most diverse faunal group at Liang Bua and are present throughout the stratigraphic sequence.<br><br>METHODS: We examined avian remains from the Late Pleistocene deposits of Sector XII, a 2 × 2 m area excavated to about 8.5 m depth. Although postcranial passerine remains are typically challenging to identify, we found several humeral characters particularly useful in discriminating between groups, and identified 89 skeletal elements of passerines.<br><br>RESULTS: At least eight species from eight families are represented, including the Large-billed Crow (Corvus cf. macrorhynchos), the Australasian Bushlark (Mirafra javanica), a friarbird (Philemon sp.), and the Pechora Pipit (Anthus cf. gustavi).<br><br>DISCUSSION: These remains constitute the first sample of fossil passerines described in Wallacea. Two of the taxa no longer occur on Flores today; a large sturnid (cf. Acridotheres) and a grassbird (Megalurus sp.). Palaeoecologically, the songbird assemblage suggests open grassland and tall forests, which is consistent with conditions inferred from the non-passerine fauna at the site. Corvus cf. macrorhynchos, found in the Homo floresiensis-bearing layers, was likely part of a scavenging guild that fed on carcasses of Stegodon florensis insularis alongside vultures (Trigonoceps sp.), giant storks (Leptoptilos robustus), komodo dragons (Varanus komodoensis), and probably H. floresiensis as well.}, }
@article {pmid28821812, year = {2017}, author = {Balakhonov, D and Rose, J}, title = {Crows Rival Monkeys in Cognitive Capacity.}, journal = {Scientific reports}, volume = {7}, number = {1}, pages = {8809}, doi = {10.1038/s41598-017-09400-0}, pmid = {28821812}, issn = {2045-2322}, abstract = {The present study compares the 'bandwidth of cognition' between crows and primates. Working memory is the ability to maintain and manipulate information over short periods of time - a core component of cognition. The capacity of working memory is tightly limited, in humans correlated with individual intelligence and commonly used synonymously with cognitive capacity. Crows have remarkable cognitive skills and while birds and mammals share neural principles of working memory, its capacity has not been tested in crows. Here we report the performance of two carrion crows on a working memory paradigm adapted from a recent experiment in rhesus monkeys. Capacity of crows is remarkably similar to monkeys and estimated at about four items. In both species, the visual hemifields show largely independent capacity. These results show that crows, like primates evolved a high-capacity working memory that reflects the result of convergent evolution of higher cognitive abilities in both species.}, }
@article {pmid28804468, year = {2017}, author = {Maes, E and Vanderoost, E and D'Hooge, R and De Houwer, J and Beckers, T}, title = {Individual Difference Factors in the Learning and Transfer of Patterning Discriminations.}, journal = {Frontiers in psychology}, volume = {8}, number = {}, pages = {1262}, doi = {10.3389/fpsyg.2017.01262}, pmid = {28804468}, issn = {1664-1078}, abstract = {In an associative patterning task, some people seem to focus more on learning an overarching rule, whereas others seem to focus on acquiring specific relations between the stimuli and outcomes involved. Building on earlier work, we further investigated which cognitive factors are involved in feature- vs. rule-based learning and generalization. To this end, we measured participants' tendency to generalize according to the rule of opposites after training on negative and positive patterning problems (i.e., A+/B+/AB- and C-/D-/CD+), their tendency to attend to global aspects or local details of stimuli, their systemizing disposition and their score on the Raven intelligence test. Our results suggest that while intelligence might have some influence on patterning learning and generalization, visual processing style and systemizing disposition do not. We discuss our findings in the light of previous observations on patterning.}, }
@article {pmid28777941, year = {2017}, author = {Alison, MR}, title = {Cholangiocytes: No Longer Cinderellas to the Hepatic Regenerative Response.}, journal = {Cell stem cell}, volume = {21}, number = {2}, pages = {159-160}, doi = {10.1016/j.stem.2017.07.002}, pmid = {28777941}, issn = {1875-9777}, abstract = {Biliary ductal cells proliferate from the portal areas of chronically damaged livers, but their significance to regeneration has been controversial. A recent article in Nature by Raven et al. (2017) now shows that blocking hepatocyte replication is essential for the hepatic differentiation of ductular cells after liver damage.}, }
@article {pmid28771477, year = {2017}, author = {Aguillon, SM and Fitzpatrick, JW and Bowman, R and Schoech, SJ and Clark, AG and Coop, G and Chen, N}, title = {Deconstructing isolation-by-distance: The genomic consequences of limited dispersal.}, journal = {PLoS genetics}, volume = {13}, number = {8}, pages = {e1006911}, doi = {10.1371/journal.pgen.1006911}, pmid = {28771477}, issn = {1553-7404}, support = {R01 GM108779/GM/NIGMS NIH HHS/United States ; }, mesh = {Animals ; Female ; Genetic Variation ; *Genetics, Population ; Genomics ; Genotype ; Male ; Microsatellite Repeats/*genetics ; Passeriformes/*genetics/physiology ; *Population Density ; Reproductive Isolation ; }, abstract = {Geographically limited dispersal can shape genetic population structure and result in a correlation between genetic and geographic distance, commonly called isolation-by-distance. Despite the prevalence of isolation-by-distance in nature, to date few studies have empirically demonstrated the processes that generate this pattern, largely because few populations have direct measures of individual dispersal and pedigree information. Intensive, long-term demographic studies and exhaustive genomic surveys in the Florida Scrub-Jay (Aphelocoma coerulescens) provide an excellent opportunity to investigate the influence of dispersal on genetic structure. Here, we used a panel of genome-wide SNPs and extensive pedigree information to explore the role of limited dispersal in shaping patterns of isolation-by-distance in both sexes, and at an exceedingly fine spatial scale (within ~10 km). Isolation-by-distance patterns were stronger in male-male and male-female comparisons than in female-female comparisons, consistent with observed differences in dispersal propensity between the sexes. Using the pedigree, we demonstrated how various genealogical relationships contribute to fine-scale isolation-by-distance. Simulations using field-observed distributions of male and female natal dispersal distances showed good agreement with the distribution of geographic distances between breeding individuals of different pedigree relationship classes. Furthermore, we built coalescent simulations parameterized by the observed dispersal curve, population density, and immigration rate, and showed how incorporating these extensions to Malécot's theory of isolation-by-distance allows us to accurately reconstruct observed sex-specific isolation-by-distance patterns in autosomal and Z-linked SNPs. Therefore, patterns of fine-scale isolation-by-distance in the Florida Scrub-Jay can be well understood as a result of limited dispersal over contemporary timescales.}, }
@article {pmid28767009, year = {2018}, author = {Costello, KA}, title = {A no-man's-land of sex: Reading Stephen Gordon and &quot;her&quot; critics.}, journal = {Journal of lesbian studies}, volume = {22}, number = {2}, pages = {165-184}, doi = {10.1080/10894160.2017.1342457}, pmid = {28767009}, issn = {1540-3548}, abstract = {One of the most read novels of lesbian, transgender, and queer criticism, Radclyffe Hall's novel The Well of Loneliness (1928) has given rise to numerous and contradictory interpretations of the protagonist Stephen Gordon's complex relationship to her body. Some have argued that she is a historically specific example of female masculinity, others that she is a lesbian who wishes she were more feminine, and others still that she is a prototypical transsexual character. Focusing on the exemplary essays by Jack Halberstam, Teresa de Lauretis, and Jay Prosser, I argue that the coexistence of mutually exclusive interpretations of Stephen Gordon's relationship to her femaleness suggests that the novel is, in fact, a demand to readers to unmoor identity from sex and to recognize what I call &quot;sexual indeterminacy.&quot; Lesbian, transgender, and queer theory's tendency to elide the literariness of literary objects and their reliance on critique as the primary mode of reading and argumentation have made it impossible for critics to see that the novel is explicitly about what cannot be settled.}, }
@article {pmid28762195, year = {2017}, author = {Kraft, FL and Forštová, T and Utku Urhan, A and Exnerová, A and Brodin, A}, title = {No evidence for self-recognition in a small passerine, the great tit (Parus major) judged from the mark/mirror test.}, journal = {Animal cognition}, volume = {20}, number = {6}, pages = {1049-1057}, doi = {10.1007/s10071-017-1121-7}, pmid = {28762195}, issn = {1435-9456}, mesh = {Animals ; *Behavior, Animal ; *Cognition ; Female ; Male ; Passeriformes/*physiology ; *Recognition (Psychology) ; Visual Perception ; }, abstract = {Self-recognition is a trait presumed to be associated with high levels of cognition and something previously considered to be exclusive to humans and possibly apes. The most common test of self-recognition is the mark/mirror test of whether an animal can understand that it sees its own reflection in a mirror. The usual design is that an animal is marked with a colour spot somewhere on the body where the spot can only be seen by the animal by using a mirror. Very few species have passed this test, and among birds, only magpies have been affirmatively demonstrated to pass it. In this study, we tested great tits (Parus major), small passerines, that are known for their innovative foraging skills and good problem-solving abilities, in the mirror self-recognition test. We found no indication that they have any ability of this kind and believe that they are unlikely to be capable of this type of self-recognition.}, }
@article {pmid28756236, year = {2017}, author = {Tamba, M and Caminiti, A and Prosperi, A and Desprès, P and Lelli, D and Galletti, G and Moreno, A and Paternoster, G and Santi, A and Licata, E and Lecollinet, S and Gelmini, L and Rugna, G and Procopio, A and Lavazza, A}, title = {Accuracy estimation of an indirect ELISA for the detection of West Nile Virus antibodies in wild birds using a latent class model.}, journal = {Journal of virological methods}, volume = {248}, number = {}, pages = {202-206}, doi = {10.1016/j.jviromet.2017.07.010}, pmid = {28756236}, issn = {1879-0984}, mesh = {Animals ; Animals, Wild ; Antibodies, Viral/*blood ; Antigens, Viral/immunology ; Bayes Theorem ; Bird Diseases/*diagnosis/immunology/virology ; Birds/virology ; Cross Reactions ; Culicidae/virology ; Encephalitis Viruses, Japanese/immunology ; Enzyme-Linked Immunosorbent Assay/methods/*veterinary ; Flavivirus/immunology ; Neutralization Tests/methods/*veterinary ; West Nile Fever/diagnosis/immunology/*veterinary ; West Nile virus/*immunology ; }, abstract = {West Nile virus (WNV) and Usutu virus (USUV), genus Flavivirus, are members of the Japanese encephalitis virus antigenic complex, and are maintained primarily in an enzootic cycle between mosquitoes and birds. WNV is zoonotic, and poses a threat to public health, especially in relation to blood transfusion. Serosurveillance of wild birds is suitable for early detection of WNV circulation, although concerns remain to be addressed as regards i) the type of test used, whether ELISA, virus neutralization test (VNT), plaque reduction neutralization test (PRNT), ii) the reagents (antigens, revealing antibodies), iii) the different bird species involved, and iv) potential cross-reactions with other Flaviviruses, such as USUV. The authors developed an indirect IgG ELISA with pan-avian specificity using EDIII protein as antigen and a monoclonal antibody (mAb 1A3) with broad reactivity for avian IgG. A total of 140 serum samples were collected from juvenile European magpies (Pica pica) in areas where both WNV and USUV were co-circulating. The samples were then tested using this in-house ELISA and VNT in parallel. Estimation of test accuracy was performed using different Bayesian two latent class models. At a cut-off set at an optical density percentage (OD%) of 15, the ELISA showed a posterior median of diagnostic sensitivity (DSe) of 88% (95%PCI: 73-99%) and a diagnostic specificity (DSp) of 86% (95%PCI: 68-99%). At this cut-off, ELISA and VNT (cut-off 1/10) performances were comparable: DSe=91% (95%PCI: 79-99%), and DSp=77% (95%PCI: 59-98%). With the cut-off increased to 30 OD%, the ELISA DSe dropped to 78% (95%PCI: 52-99%), and the DSp rose to 94% (95%PCI: 83-100%). In field conditions, the cut-off that yields the best accuracy for the ELISA appears to correspond to 15 OD%. In areas where other Flaviviruses are circulating, however, it might be appropriate to raise the cut-off to 30 OD% in order to achieve higher specificity and reduce the detection of seropositive birds infected by other Flaviviruses, such as USUV.}, }
@article {pmid28725378, year = {2016}, author = {Inger, R and Cox, DTC and Per, E and Norton, BA and Gaston, KJ}, title = {Ecological role of vertebrate scavengers in urban ecosystems in the UK.}, journal = {Ecology and evolution}, volume = {6}, number = {19}, pages = {7015-7023}, doi = {10.1002/ece3.2414}, pmid = {28725378}, issn = {2045-7758}, abstract = {Recent research has demonstrated how scavenging, the act of consuming dead animals, plays a key role in ecosystem structure, functioning, and stability. A growing number of studies suggest that vertebrate scavengers also provide key ecosystem services, the benefits humans gain from the natural world, particularly in the removal of carcasses from the environment. An increasing proportion of the human population is now residing in cities and towns, many of which, despite being highly altered environments, contain significant wildlife populations, and so animal carcasses. Indeed, non-predation fatalities may be higher within urban than natural environments. Despite this, the fate of carcasses in urban environments and the role vertebrate scavengers play in their removal have not been determined. In this study, we quantify the role of vertebrate scavengers in urban environments in three towns in the UK. Using experimentally deployed rat carcasses and rapid fire motion-triggered cameras, we determined which species were scavenging and how removal of carcass biomass was partitioned between them. Of the 63 experimental carcasses deployed, vertebrate scavenger activity was detected at 67%. There was a significantly greater depletion in carcass biomass in the presence (mean loss of 194 g) than absence (mean loss of 14 g) of scavengers. Scavenger activity was restricted to three species, Carrion crows Corvus corone, Eurasian magpies Pica pica, and European red foxes Vulpes vulpes. From behavioral analysis, we estimated that a maximum of 73% of the carcass biomass was removed by vertebrate scavengers. Despite having low species richness, the urban scavenger community in our urban study system removed a similar proportion of carcasses to those reported in more pristine environments. Vertebrate scavengers are providing a key urban ecosystem service in terms of carcass removal. This service is, however, often overlooked, and the species that provide it are among some of the most disliked and persecuted.}, }
@article {pmid28724689, year = {2017}, author = {Kelley, LA and Clayton, NS}, title = {California scrub-jays reduce visual cues available to potential pilferers by matching food colour to caching substrate.}, journal = {Biology letters}, volume = {13}, number = {7}, pages = {}, doi = {10.1098/rsbl.2017.0242}, pmid = {28724689}, issn = {1744-957X}, mesh = {Animals ; California ; Color ; Cues ; Feeding Behavior ; *Passeriformes ; }, abstract = {Some animals hide food to consume later; however, these caches are susceptible to theft by conspecifics and heterospecifics. Caching animals can use protective strategies to minimize sensory cues available to potential pilferers, such as caching in shaded areas and in quiet substrate. Background matching (where object patterning matches the visual background) is commonly seen in prey animals to reduce conspicuousness, and caching animals may also use this tactic to hide caches, for example, by hiding coloured food in a similar coloured substrate. We tested whether California scrub-jays (Aphelocoma californica) camouflage their food in this way by offering them caching substrates that either matched or did not match the colour of food available for caching. We also determined whether this caching behaviour was sensitive to social context by allowing the birds to cache when a conspecific potential pilferer could be both heard and seen (acoustic and visual cues present), or unseen (acoustic cues only). When caching events could be both heard and seen by a potential pilferer, birds cached randomly in matching and non-matching substrates. However, they preferentially hid food in the substrate that matched the food colour when only acoustic cues were present. This is a novel cache protection strategy that also appears to be sensitive to social context. We conclude that studies of cache protection strategies should consider the perceptual capabilities of the cacher and potential pilferers.}, }
@article {pmid28724626, year = {2017}, author = {Serrano, FJ and Chiappe, LM}, title = {Aerodynamic modelling of a Cretaceous bird reveals thermal soaring capabilities during early avian evolution.}, journal = {Journal of the Royal Society, Interface}, volume = {14}, number = {132}, pages = {}, doi = {10.1098/rsif.2017.0182}, pmid = {28724626}, issn = {1742-5662}, mesh = {Animals ; *Biological Evolution ; Birds/*anatomy &amp; histology/*physiology ; Computer Simulation ; Flight, Animal/*physiology ; Fossils ; *Models, Biological ; }, abstract = {Several flight modes are thought to have evolved during the early evolution of birds. Here, we use a combination of computational modelling and morphofunctional analyses to infer the flight properties of the raven-sized, Early Cretaceous bird Sapeornis chaoyangensis-a likely candidate to have evolved soaring capabilities. Specifically, drawing information from (i) mechanical inferences of the deltopectoral crest of the humerus, (ii) wing shape (i.e. aspect ratio), (iii) estimations of power margin (i.e. difference between power required for flight and available power from muscles), (iv) gliding behaviour (i.e. forward speed and sinking speed), and (v) palaeobiological evidence, we conclude that S. chaoyangensis was a thermal soarer with an ecology similar to that of living South American screamers. Our results indicate that as early as 125 Ma, some birds evolved the morphological and aerodynamic requirements for soaring on continental thermals, a conclusion that highlights the degree of ecological, functional and behavioural diversity that resulted from the first major evolutionary radiation of birds.}, }
@article {pmid28717324, year = {2017}, author = {Fadel, HM and Afifi, R}, title = {Investigation of avian influenza infection in wild birds in Ismailia and Damietta cities, Egypt.}, journal = {Veterinary world}, volume = {10}, number = {6}, pages = {695-701}, doi = {10.14202/vetworld.2017.695-701}, pmid = {28717324}, issn = {0972-8988}, abstract = {AIM: This study was carried out to monitor avian influenza (AI) infection in wild birds in Egypt.<br><br>MATERIALS AND METHODS: A total of 135 wild birds were examined for the presence of H5, H7, and H9 hemagglutination inhibition antibodies. Organs and swab samples of 75 birds were screened by multiplex real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) to detect AI subtypes H5, H7, and H9 matrix genes.<br><br>RESULTS: The highest seropositive result was recorded in cattle egrets (90.9%) followed by crows (88.6%), semi-captive pigeons (44.8%), and moorhens (39.1%). In cattle egrets, semi-captive pigeons and moorhens, H5 antibodies predominated. In crows, H9 antibodies predominated. Multiple infections with two or three virus subtypes were highest in crows (6/39, 15.4%) followed by cattle egrets (3/30, 10%) and moorhens' (1/9, 11.1%) positive samples. Multiplex RRT-PCR results revealed two positive samples in cattle egrets and moorhens.<br><br>CONCLUSION: The results indicated high seropositive rates against AI virus subtypes H5 and H9 in the examined wild birds. Multiple infections with more than one AI virus (AIV) subtypes were detected in some birds. This requires a collaboration of efforts to monitor AIV infection in wild birds and implement suitable early intervention measures.}, }
@article {pmid28707087, year = {2017}, author = {Kaefer, M}, title = {Jay Grosfeld, MD, FACS, FAAP, FRCS, FRCPS, FRSH (1935-2016).}, journal = {World journal of surgery}, volume = {41}, number = {9}, pages = {2185-2186}, doi = {10.1007/s00268-017-4099-z}, pmid = {28707087}, issn = {1432-2323}, }
@article {pmid28706072, year = {2017}, author = {Kabadayi, C and Osvath, M}, title = {Ravens parallel great apes in flexible planning for tool-use and bartering.}, journal = {Science (New York, N.Y.)}, volume = {357}, number = {6347}, pages = {202-204}, doi = {10.1126/science.aam8138}, pmid = {28706072}, issn = {1095-9203}, mesh = {Animals ; Biological Evolution ; *Crows ; Female ; Hominidae/*psychology ; Male ; *Tool Use Behavior ; }, abstract = {The ability to flexibly plan for events outside of the current sensory scope is at the core of being human and is crucial to our everyday lives and society. Studies on apes have shaped a belief that this ability evolved within the hominid lineage. Corvids, however, have shown evidence of planning their food hoarding, although this has been suggested to reflect a specific caching adaptation rather than domain-general planning. Here, we show that ravens plan for events unrelated to caching-tool-use and bartering-with delays of up to 17 hours, exert self-control, and consider temporal distance to future events. Their performance parallels that seen in apes and suggests that planning evolved independently in corvids, which opens new avenues for the study of cognitive evolution.}, }
@article {pmid28705691, year = {2017}, author = {Godwin, CA and Hunter, MA and Bezdek, MA and Lieberman, G and Elkin-Frankston, S and Romero, VL and Witkiewitz, K and Clark, VP and Schumacher, EH}, title = {Functional connectivity within and between intrinsic brain networks correlates with trait mind wandering.}, journal = {Neuropsychologia}, volume = {103}, number = {}, pages = {140-153}, doi = {10.1016/j.neuropsychologia.2017.07.006}, pmid = {28705691}, issn = {1873-3514}, mesh = {Adult ; Attention/*physiology ; Brain/diagnostic imaging/*physiology ; Brain Mapping ; Creativity ; Executive Function ; Female ; Humans ; Intelligence ; Magnetic Resonance Imaging ; Male ; Middle Aged ; Neural Pathways/diagnostic imaging/physiology ; Neuropsychological Tests ; Personality/*physiology ; Rest ; Surveys and Questionnaires ; Young Adult ; }, abstract = {Individual differences across a variety of cognitive processes are functionally associated with individual differences in intrinsic networks such as the default mode network (DMN). The extent to which these networks correlate or anticorrelate has been associated with performance in a variety of circumstances. Despite the established role of the DMN in mind wandering processes, little research has investigated how large-scale brain networks at rest relate to mind wandering tendencies outside the laboratory. Here we examine the extent to which the DMN, along with the dorsal attention network (DAN) and frontoparietal control network (FPCN) correlate with the tendency to mind wander in daily life. Participants completed the Mind Wandering Questionnaire and a 5-min resting state fMRI scan. In addition, participants completed measures of executive function, fluid intelligence, and creativity. We observed significant positive correlations between trait mind wandering and 1) increased DMN connectivity at rest and 2) increased connectivity between the DMN and FPCN at rest. Lastly, we found significant positive correlations between trait mind wandering and fluid intelligence (Ravens) and creativity (Remote Associates Task). We interpret these findings within the context of current theories of mind wandering and executive function and discuss the possibility that certain instances of mind wandering may not be inherently harmful. Due to the controversial nature of global signal regression (GSReg) in functional connectivity analyses, we performed our analyses with and without GSReg and contrast the results from each set of analyses.}, }
@article {pmid28698508, year = {2017}, author = {Lehnert, MS and Kramer, VR and Rawlins, JE and Verdecia, V and Daniels, JC}, title = {Jamaica's Critically Endangered Butterfly: A Review of the Biology and Conservation Status of the Homerus Swallowtail (Papilio (Pterourus) homerus Fabricius).}, journal = {Insects}, volume = {8}, number = {3}, pages = {}, doi = {10.3390/insects8030068}, pmid = {28698508}, issn = {2075-4450}, abstract = {The Homerus swallowtail, Papilio (Pterourus) homerus Fabricius, is listed as an endangered species and is endemic to the Caribbean island of Jamaica. The largest butterfly in the Western Hemisphere, P. homerus once inhabited seven of Jamaica's 14 parishes and consisted of at least three populations; however, now only two stronghold populations remain, a western population in the rugged Cockpit Country and an eastern population in the Blue and John Crow Mountains. Despite numerous studies of its life history, much about the population biology, including estimates of total numbers of individuals in each population, remains unknown. In addition, a breeding program is needed to establish an experimental population, which could be used to augment wild populations and ensure the continued survival of the species. Here, we present a review of the biology of P. homerus and recommendations for a conservation plan.}, }
@article {pmid28695387, year = {2017}, author = {Mitra, S and Karmakar, A and Mukherjee, A and Barik, A}, title = {The Role of Leaf Volatiles of Ludwigia octovalvis (Jacq.) Raven in the Attraction of Altica cyanea (Weber) (Coleoptera: Chrysomelidae).}, journal = {Journal of chemical ecology}, volume = {43}, number = {7}, pages = {679-692}, doi = {10.1007/s10886-017-0866-4}, pmid = {28695387}, issn = {1573-1561}, support = {F. No. - 43-578/2014(SR) from UGC, Govt. of India//University Grants Commission/ ; }, mesh = {Animals ; Coleoptera/*physiology ; Female ; *Herbivory ; Monoterpenes/analysis/metabolism ; Olfactometry ; Onagraceae/chemistry/*physiology ; Pest Control, Biological/methods ; Pheromones/analysis/*metabolism ; Plant Leaves/chemistry/*physiology ; Plant Weeds/chemistry/*physiology ; Terpenes/analysis/metabolism ; Volatile Organic Compounds/analysis/*metabolism ; }, abstract = {Larvae and adults of Altica cyanea (Weber) (Coleoptera: Chrysomelidae) feed on the rice-field weed Ludwigia octovalvis (Jacq.) Raven (Onagraceae), commonly known as willow primrose, which is considered a biocontrol agent of the weed. Volatile organic compounds from undamaged plants, plants after 4, 12, and 36 h of continuous feeding by A. cyanea larvae or adult females and after mechanical damaging were identified by GC-MS and GC-FID analyses. Twenty nine compounds were identified from undamaged plants. 2Z-Penten-1-ol, geraniol, and 1-tridecanol were present in all plants damaged by larvae. In contrast, feeding by adults caused the release of 2Z-penten-1-ol only after 12 and 36 h; whereas geraniol and 1-tridecanol appeared only after 36 h. Farnesyl acetone was detected after 12 and 36 h of feeding by larvae and after 36 h of feeding by adults. Farnesene was detected after 36 h of feeding by larvae and adults. Linalool was unique after 36 h of feeding by larvae. In Y-shaped glass tube olfactometer bioassays, A. cyanea females were attracted to volatiles after 36 h of feeding by larvae or adults compared to volatiles released by undamaged plants. The insects were attracted to five synthetic compounds: 3-hexanol, α-pinene, linalool oxide, geraniol, and phytol. Synthetic blends were more attractive than individual compounds. Compared to undamaged plants, volatiles released by plants, damaged by conspecific individuals, were more attractive to A. cyanea females, due to elevated emissions of 3-hexanol, α-pinene, linalool oxide, geraniol, and phytol.}, }
@article {pmid28691148, year = {2017}, author = {Bugelli, V and Papi, L and Fornaro, S and Stefanelli, F and Chericoni, S and Giusiani, M and Vanin, S and Campobasso, CP}, title = {Entomotoxicology in burnt bodies: a case of maternal filicide-suicide by fire.}, journal = {International journal of legal medicine}, volume = {131}, number = {5}, pages = {1299-1306}, doi = {10.1007/s00414-017-1628-0}, pmid = {28691148}, issn = {1437-1596}, mesh = {Adult ; Animals ; Automobiles ; Burns/*pathology ; Carbon Monoxide Poisoning ; Carboxyhemoglobin/analysis ; Child ; Child, Preschool ; Diazepam/analysis ; *Diptera ; *Feeding Behavior ; Female ; *Fires ; Gasoline ; *Homicide ; Humans ; Hypnotics and Sedatives/analysis ; Kidney/chemistry ; Larva ; Liver/chemistry ; Male ; Nordazepam/analysis ; Oxazepam/analysis ; *Postmortem Changes ; *Suicide ; }, abstract = {One of the most common methods of maternal filicide is by fire. In this case study, a 40-year-old female and her children were found completely burned in a burnt out car. All bodies showed a degree of destruction by fire consisting to a level 3 of the Crow-Glassman Scale (CGS) and early stage of insect activity. Toxicological analyses were performed on soft tissues and body fluids still available. The results were positive for diazepam and its metabolites only for children with blood concentrations consistent with therapeutic doses of benzodiazepines. Home video surveillance cameras confirmed sedation prior to death recording the mother while administering some drops of sedative drugs in a soft drink to the children just a couple of hours before setting fire to the car. Based on autopsy findings, all victims were still alive at the time of fire. The cause of death was determined as carbon monoxide poisoning and fatal thermal injuries by fire. This case study has a special focus on the entomotoxicology and the potential role of insects in death investigations of burnt bodies, supposed to be an inadequate substratum for insect colonization. It demonstrates that in burnt bodies, arthropod colonization can be quite immediate after fire is extinguished. Toxicological analyses performed on larvae actively feeding on the children's bodies were positive for diazepam and its metabolites in small amount compared with blood concentrations, whereas the larvae collected from the mother's body were totally negative. These data, according to the autopsy findings and the toxicological results from the victim's blood and tissues, supported the suspect of a non-lethal sedation prior to death, which is a common behaviour in maternal filicide.}, }
@article {pmid28689262, year = {2017}, author = {West, EH and Peery, MZ}, title = {Behavioral mechanisms leading to improved fitness in a subsidized predator.}, journal = {Oecologia}, volume = {184}, number = {4}, pages = {787-798}, doi = {10.1007/s00442-017-3898-0}, pmid = {28689262}, issn = {1432-1939}, support = {MSN150028//Save the Redwoods League (US)/ ; MSN160820//Save the Redwoods League (US)/ ; MSN164905//University of Wisconsin Madison Office of the Vice Chancellor Research and Graduate Education/ ; }, abstract = {General mechanisms underlying the distribution and fitness of synanthropic predators in human-influenced landscapes remain unclear. Under the consumer resource-matching hypothesis, synanthropes are expected to distribute themselves among habitats according to resource availability, such that densities are greater in human-subsidized habitats, but mean individual fitness is equal among habitats because of negative density dependence. However, &quot;under-matching&quot; to human food resources can occur, because dominant individuals exclude subordinates from subsidized habitats and realize relatively high fitness. We integrated physiological, behavioral, and demographic information to test resource-matching hypotheses in Steller's jays (Cyanocitta stelleri), a synanthropic nest predator, to understand how behavior and social systems can influence how synanthropes respond to food subsidies. Jays consumed more human foods at subsidized (park campground) sites than jays at unsubsidized (interior forest) sites based on stable isotope analyses. Jays that occurred at higher densities were in better body condition (based on feather growth bars and lipid analyses), and had greater reproductive output at subsidized than unsubsidized sites. Jays with breeding territories in subsidized sites maintained relatively small home ranges that overlapped with multiple conspecifics, and exhibited a social system where dominant individuals typically won contests over food. Thus, jays appeared to be under-matched to prevalent resource subsidies despite high densities and behaviors expected to lead to resource matching. Our results also indicate that local resource subsidies within protected areas can result in source habitats for synanthropes, potentially impacting sensitive species over broader spatial scales.}, }
@article {pmid28688117, year = {2018}, author = {Lim, SM and Geervliet, M and Verhagen, JH and Müskens, GJDM and Majoor, FA and Osterhaus, ADME and Martina, BEE}, title = {Serologic evidence of West Nile virus and Usutu virus infections in Eurasian coots in the Netherlands.}, journal = {Zoonoses and public health}, volume = {65}, number = {1}, pages = {96-102}, doi = {10.1111/zph.12375}, pmid = {28688117}, issn = {1863-2378}, mesh = {Animal Migration ; Animals ; Antibodies, Viral/blood ; Bird Diseases/blood/epidemiology/*virology ; Birds ; Cell Line ; Enzyme-Linked Immunosorbent Assay/methods/veterinary ; *Flavivirus ; Flavivirus Infections/epidemiology/*veterinary/virology ; Netherlands ; Population Surveillance ; *West Nile virus ; Zoonoses ; }, abstract = {West Nile virus (WNV) and Usutu virus (USUV) are arboviruses that are maintained in enzootic transmission cycles between mosquitoes and birds and are occasionally transmitted to mammals. As arboviruses are currently expanding their geographic range and emerging in often unpredictable locations, surveillance is considered an important element of preparedness. To determine whether sera collected from resident and migratory birds in the Netherlands as part of avian influenza surveillance would also represent an effective source for proactive arbovirus surveillance, a random selection of such sera was screened for WNV antibodies using a commercial ELISA. In addition, sera of jackdaws and carrion crows captured for previous experimental infection studies were added to the selection. Of the 265 screened serum samples, 27 were found to be WNV-antibody-positive, and subsequent cross-neutralization experiments using WNV and USUV confirmed that five serum samples were positive for only WNV-neutralizing antibodies and seven for only USUV. The positive birds consisted of four Eurasian coots (Fulica atra) and one carrion crow (Corvus corone) for WNV, of which the latter may suggest local presence of the virus, and only Eurasian coots for USUV. As a result, the screening of a small selection of serum samples originally collected for avian influenza surveillance demonstrated a seroprevalence of 1.6% for WNV and 2.8% for USUV, suggesting that this sustained infrastructure could serve as a useful source for future surveillance of arboviruses such as WNV and USUV in the Netherlands.}, }
@article {pmid28684773, year = {2017}, author = {O'Hara, M and Mioduszewska, B and von Bayern, A and Auersperg, A and Bugnyar, T and Wilkinson, A and Huber, L and Gajdon, GK}, title = {The temporal dependence of exploration on neotic style in birds.}, journal = {Scientific reports}, volume = {7}, number = {1}, pages = {4742}, doi = {10.1038/s41598-017-04751-0}, pmid = {28684773}, issn = {2045-2322}, abstract = {Exploration (interacting with objects to gain information) and neophobia (avoiding novelty) are considered independent traits shaped by the socio-ecology of a given species. However, in the literature it is often assumed that neophobia inhibits exploration. Here, we investigate how different approaches to novelty (fast or slow) determine the time at which exploration is likely to occur across a number of species. We presented four corvid and five parrot species with a touchscreen discrimination task in which novel stimuli were occasionally interspersed within the familiar training stimuli. We investigated the likelihood that an animal would choose novelty at different stages of its training and found evidence for a shift in the pattern of exploration, depending on neotic style. The findings suggest that faster approaching individuals explored earlier, whilst animals with long initial approach latencies showed similar amounts of exploration but did so later in training. Age rather than species might have influenced the amount of total exploration, with juveniles exploring more than adults. Neotic style varied consistently only for one species and seems to involve a strong individual component, rather than being a purely species-specific trait. This suggests that variation in behavioural phenotypes within a species may be adaptive.}, }
@article {pmid28676793, year = {2017}, author = {Gao, S and Kang, Y and Yuan, R and Ma, H and Xiang, B and Wang, Z and Dai, X and Wang, F and Xiao, J and Liao, M and Ren, T}, title = {Immune Responses of Chickens Infected with Wild Bird-Origin H5N6 Avian Influenza Virus.}, journal = {Frontiers in microbiology}, volume = {8}, number = {}, pages = {1081}, doi = {10.3389/fmicb.2017.01081}, pmid = {28676793}, issn = {1664-302X}, abstract = {Since April 2014, new infections of H5N6 avian influenza virus (AIV) in humans and domestic poultry have caused considerable economic losses in the poultry industry and posed an enormous threat to human health worldwide. In previous research using gene sequence and phylogenetic analysis, we reported that H5N6 AIV isolated in February 2015 (ZH283) in Pallas's sandgrouse was highly similar to that isolated in a human in December 2015 (A/Guangdong/ZQ874/2015), whereas a virus (i.e., SW8) isolated in oriental magpie-robin in 2014 was highly similar to that of A/chicken/Dongguan/2690/2013 (H5N6). However, the pathogenicity, transmissibility, and host immune-related response of chickens infected by those wild bird-origin H5N6 AIVs remain unknown. In response, we examined the viral distribution and mRNA expression profiles of immune-related genes in chickens infected with both viruses. Results showed that the H5N6 AIVs were highly pathogenic to chickens and caused not only systemic infection in multiple tissues, but also 100% mortality within 3-5 days post-infection. Additionally, ZH283 efficiently replicated in all tested tissues and transmitted among chickens more rapidly than SW8. Moreover, quantitative real-time polymerase chain reaction analysis showed that following infection with H5N6, AIVs immune-related genes remained active in a tissue-dependent manner, as well as that ZH283 induced mRNA expression profiles such as TLR3, TLR7, IL-6, TNF-α, IL-1β, IL-10, IL-8, and MHC-II to a greater extent than SW8 in the tested tissues of infected chickens. Altogether, our findings help to illuminate the pathogenesis and immunologic mechanisms of H5N6 AIVs in chickens.}, }
@article {pmid28666833, year = {2017}, author = {Lin, WS and Lo, JH and Yang, JH and Wang, HW and Fan, SZ and Yen, JH and Wang, PY}, title = {Ludwigia octovalvis extract improves glycemic control and memory performance in diabetic mice.}, journal = {Journal of ethnopharmacology}, volume = {207}, number = {}, pages = {211-219}, doi = {10.1016/j.jep.2017.06.044}, pmid = {28666833}, issn = {1872-7573}, mesh = {AMP-Activated Protein Kinases/metabolism ; Animals ; Blood Glucose/drug effects ; Cell Line ; Diabetes Mellitus, Experimental/*drug therapy/physiopathology ; Diet, High-Fat/adverse effects ; Glucose/metabolism ; Hep G2 Cells ; Humans ; Hypoglycemic Agents/isolation &amp; purification/*pharmacology ; Male ; Memory/drug effects ; Mice ; Mice, Inbred C57BL ; Onagraceae/*chemistry ; Plant Extracts/*pharmacology ; Streptozocin ; }, abstract = {Ludwigia octovalvis (Jacq.) P.H. Raven (Onagraceae) extracts have historically been consumed as a healthful drink for treating various conditions, including edema, nephritis, hypotension and diabetes.<br><br>AIM OF THE STUDY: We have previously shown that Ludwigia octovalvis extract (LOE) can significantly extend lifespan and improve age-related memory deficits in Drosophila melanogaster through activating AMP-activated protein kinase (AMPK). Since AMPK has become a critical target for treating diabetes, we herein investigate the anti-hyperglycemic potential of LOE.<br><br>MATERIALS AND METHODS: Differentiated C2C12 muscle cells, HepG2 hepatocellular cells, streptozotocin (STZ)-induced diabetic mice and high fat diet (HFD)-induced diabetic mice were used to investigate the anti-hyperglycemic potential of LOE. The open field test and novel object recognition test were used to evaluate spontaneous motor activity and memory performance of HFD-induced diabetic mice.<br><br>RESULTS: In differentiated C2C12 muscle cells and HepG2 hepatocellular cells, treatments with LOE and its active component (β-sitosterol) induced significant AMPK phosphorylation. LOE also enhanced uptake of a fluorescent glucose derivative (2-NBDG) and inhibited glucose production in these cells. The beneficial effects of LOE were completely abolished when an AMPK inhibitor, dorsomorphin, was added to the culture system, suggesting that LOE requires AMPK activation for its action in vitro. In streptozotocin (STZ)-induced diabetic mice, we found that both LOE and β-sitosterol induced an anti-hyperglycemic effect comparable to that of metformin, a drug that is commonly prescribed to treat diabetes. Moreover, LOE also improved glycemic control and memory performance of mice fed a HFD.<br><br>CONCLUSIONS: These results indicate that LOE is a potent anti-diabetic intervention that may have potential for future clinical applications.}, }
@article {pmid28664998, year = {2017}, author = {Termignoni-García, F and Jaramillo-Correa, JP and Chablé-Santos, J and Liu, M and Shultz, AJ and Edwards, SV and Escalante-Pliego, P}, title = {Genomic footprints of adaptation in a cooperatively breeding tropical bird across a vegetation gradient.}, journal = {Molecular ecology}, volume = {26}, number = {17}, pages = {4483-4496}, doi = {10.1111/mec.14224}, pmid = {28664998}, issn = {1365-294X}, mesh = {Adaptation, Physiological/*genetics ; Animals ; Breeding ; *Ecosystem ; Gene Flow ; Genetic Variation ; *Genetics, Population ; Genomics ; Mexico ; Passeriformes/*genetics ; Polymorphism, Single Nucleotide ; }, abstract = {Identifying the genetic basis of phenotypic variation and its relationship with the environment is key to understanding how local adaptations evolve. Such patterns are especially interesting among populations distributed across habitat gradients, where genetic structure can be driven by isolation by distance (IBD) and/or isolation by environment (IBE). Here, we used variation in ~1,600 high-quality SNPs derived from paired-end sequencing of double-digest restriction site-associated DNA (ddRAD-Seq) to test hypotheses related to IBD and IBE in the Yucatan jay (Cyanocorax yucatanicus), a tropical bird endemic to the Yucatán Peninsula. This peninsula is characterized by a precipitation and vegetation gradient-from dry to evergreen tropical forests-that is associated with morphological variation in this species. We found a moderate level of nucleotide diversity (π = .008) and little evidence for genetic differentiation among vegetation types. Analyses of neutral and putatively adaptive SNPs (identified by complementary genome-scan approaches) indicate that IBD is the most reliable explanation to account for frequency distribution of the former, while IBE has to be invoked to explain those of the later. These results suggest that selective factors acting along a vegetation gradient can promote local adaptation in the presence of gene flow in a vagile, nonmigratory and geographically restricted species. The putative candidate SNPs identified here are located within or linked to a variety of genes that represent ideal targets for future genomic surveys.}, }
@article {pmid28659699, year = {2016}, author = {Makharia, A and Nagarajan, A and Mishra, A and Peddisetty, S and Chahal, D and Singh, Y}, title = {Effect of environmental factors on intelligence quotient of children.}, journal = {Industrial psychiatry journal}, volume = {25}, number = {2}, pages = {189-194}, doi = {10.4103/ipj.ipj_52_16}, pmid = {28659699}, issn = {0972-6748}, abstract = {INTRODUCTION: A child's intelligence quotient (IQ) is determined by both genetic and environmental factors that start from the prenatal period itself. There is a lack of data on the factors which influence IQ in Indian children; therefore, we conducted a multicenter questionnaire-based study to determine the environmental factors which influence IQ in Indian children.<br><br>PARTICIPANTS AND METHODS: In this cross-sectional observational study, we recruited 1065 schoolchildren between the age of 12 and 16 years from 2 government and 13 private schools in 5 towns, 6 cities, and 2 villages across India. All the children were administered a questionnaire consisting of various environmental factors such as parents' education, occupation, income, and the physical activity of the students. IQ scores were assessed using Ravens Standard Progressive Matrices. An approximate IQ score was calculated using the score on the Ravens test. IQ scores were divided into three groups: below normal IQ (0-79), normal IQ (80-119), and high IQ (above 120). The data were analyzed using SPSS software.<br><br>RESULTS: In this study, it was observed that the environmental factors such as place of residence, physical activity, family income, parental education, and occupation of the father had an impact on the IQ of the children. Children living in cities (P = 0.001), children having physical activity more than 5 h/weeks (P = 0.001), children with parents having a postgraduate or graduate level of education (P = 0.001), children whose father having a professional job (P = 0.001), and those with a higher family income (P = 0.001) were more likely to have high IQ.<br><br>CONCLUSIONS: In the present study, we found that various environmental factors such as place of residence, physical exercise, family income, parents' occupation and education influence the IQ of a child to a great extent. Hence, a child must be provided with an optimal environment to be able to develop to his/her full genetic potential.}, }
@article {pmid28658287, year = {2017}, author = {Expósito-Granados, M and Parejo, D and Martínez, JG and Sánchez-Tójar, A and Precioso, M and Molina-Morales, M and Avilés, JM}, title = {An experimental test of host's life history traits modulation in response to cuckoo parasitism risk.}, journal = {PloS one}, volume = {12}, number = {6}, pages = {e0179206}, doi = {10.1371/journal.pone.0179206}, pmid = {28658287}, issn = {1932-6203}, mesh = {Animals ; Passeriformes/*physiology ; Symbiosis ; }, abstract = {Hosts can counteract parasites through defences based on resistance and/or tolerance. The mechanistic basis of tolerance, which involve defensive mechanisms minimizing parasite damage after a successful parasitic attack, remains poorly explored in the study of cuckoo-host interactions. Here, we experimentally explore the possibility that the risk of great spotted cuckoo Clamator glandarius parasitism may induce tolerance defences in magpie Pica pica hosts through plasticity in life-history traits. We predict that magpies exposed to auditory cues indicating high parasitism risk will more likely exhibit resistance and/or modify their life-history traits to minimize parasitism costs (i.e. tolerance) compared to magpies under low parasitism risk. We found that manipulating the perceived parasitism risk did not affect host resistance (i.e. rejection of parasitic eggs) nor host life-history traits. Unexpectedly, host's egg volume increased over the season in nests exposed to auditory cues of control non-harmful hoopoes Upupa epops. Our results do not provide support for inducible defences (either based on resistance or tolerance) in response to risk of parasitism in magpie hosts. Even so, we encourage studying plastic expression of breeding strategies in response to risk of cuckoo parasitism to achieve a better understanding of the mechanistic basis of tolerance defences.}, }
@article {pmid28653410, year = {2017}, author = {Wakefield, ED and Owen, E and Baer, J and Carroll, MJ and Daunt, F and Dodd, SG and Green, JA and Guilford, T and Mavor, RA and Miller, PI and Newell, MA and Newton, SF and Robertson, GS and Shoji, A and Soanes, LM and Votier, SC and Wanless, S and Bolton, M}, title = {Breeding density, fine-scale tracking, and large-scale modeling reveal the regional distribution of four seabird species.}, journal = {Ecological applications : a publication of the Ecological Society of America}, volume = {27}, number = {7}, pages = {2074-2091}, doi = {10.1002/eap.1591}, pmid = {28653410}, issn = {1051-0761}, abstract = {Population-level estimates of species' distributions can reveal fundamental ecological processes and facilitate conservation. However, these may be difficult to obtain for mobile species, especially colonial central-place foragers (CCPFs; e.g., bats, corvids, social insects), because it is often impractical to determine the provenance of individuals observed beyond breeding sites. Moreover, some CCPFs, especially in the marine realm (e.g., pinnipeds, turtles, and seabirds) are difficult to observe because they range tens to ten thousands of kilometers from their colonies. It is hypothesized that the distribution of CCPFs depends largely on habitat availability and intraspecific competition. Modeling these effects may therefore allow distributions to be estimated from samples of individual spatial usage. Such data can be obtained for an increasing number of species using tracking technology. However, techniques for estimating population-level distributions using the telemetry data are poorly developed. This is of concern because many marine CCPFs, such as seabirds, are threatened by anthropogenic activities. Here, we aim to estimate the distribution at sea of four seabird species, foraging from approximately 5,500 breeding sites in Britain and Ireland. To do so, we GPS-tracked a sample of 230 European Shags Phalacrocorax aristotelis, 464 Black-legged Kittiwakes Rissa tridactyla, 178 Common Murres Uria aalge, and 281 Razorbills Alca torda from 13, 20, 12, and 14 colonies, respectively. Using Poisson point process habitat use models, we show that distribution at sea is dependent on (1) density-dependent competition among sympatric conspecifics (all species) and parapatric conspecifics (Kittiwakes and Murres); (2) habitat accessibility and coastal geometry, such that birds travel further from colonies with limited access to the sea; and (3) regional habitat availability. Using these models, we predict space use by birds from unobserved colonies and thereby map the distribution at sea of each species at both the colony and regional level. Space use by all four species' British breeding populations is concentrated in the coastal waters of Scotland, highlighting the need for robust conservation measures in this area. The techniques we present are applicable to any CCPF.}, }
@article {pmid28635158, year = {2018}, author = {Widen, EM and Kahn, LG and Cirillo, P and Cohn, B and Kezios, KL and Factor-Litvak, P}, title = {Prepregnancy overweight and obesity are associated with impaired child neurodevelopment.}, journal = {Maternal &amp; child nutrition}, volume = {14}, number = {1}, pages = {}, doi = {10.1111/mcn.12481}, pmid = {28635158}, issn = {1740-8709}, support = {K99 HD086304/HD/NICHD NIH HHS/United States ; T32 DK007559/DK/NIDDK NIH HHS/United States ; T32 ES023772/ES/NIEHS NIH HHS/United States ; }, mesh = {Adult ; Body Mass Index ; California/epidemiology ; Child ; Child Development ; Cohort Studies ; Female ; *Fetal Development ; Follow-Up Studies ; Humans ; Male ; *Maternal Nutritional Physiological Phenomena ; Neurodevelopmental Disorders/epidemiology/*etiology ; *Neurogenesis ; Obesity/*physiopathology ; Overweight/*physiopathology ; Pregnancy ; Pregnancy Complications/*physiopathology ; Prevalence ; Prospective Studies ; Recognition (Psychology) ; Thinness/physiopathology ; Verbal Learning ; Weight Gain ; }, abstract = {The authors examined the relationship of prepregnancy body mass index (BMI) and gestational weight gain (GWG) with child neurodevelopment. Mother-child dyads were a subgroup (n = 2,084) of the Child Health and Development Studies from the Oakland, California, area enrolled during pregnancy from 1959 to 1966 and followed at child age 9 years. Linear regression was used to examine associations between prepregnancy BMI, GWG, and standardized Peabody Picture Vocabulary Test and Raven Progressive Matrices scores and to evaluate effect modification of GWG by prepregnancy BMI. Before pregnancy, 77% of women were normal weight, 8% were underweight, 11% were overweight, and 3% were obese. Associations between GWG and child outcomes did not vary by prepregnancy BMI, suggesting no evidence for interaction. In multivariable models, compared to normal prepregnancy BMI, prepregnancy overweight and obesity were associated with lower Peabody scores (b: -1.29; 95% CI [-2.6, -0.04] and b: -2.7; 95% CI [-5.0, -0.32], respectively). GWG was not associated with child Peabody score [b: -0.03 (95% CI: -0.13, 0.07)]. Maternal BMI and GWG were not associated with child Raven score (all P >0.05). Maternal prepregnancy overweight and obesity were associated with lower scores for verbal recognition in mid-childhood. These results contribute to evidence linking maternal BMI with child neurodevelopment. Future research should examine the role of higher prepregnancy BMI values and the pattern of pregnancy weight gain in child cognitive outcomes.}, }
@article {pmid28631321, year = {2017}, author = {}, title = {John A. Raven.}, journal = {The New phytologist}, volume = {215}, number = {2}, pages = {514-515}, doi = {10.1111/nph.14651}, pmid = {28631321}, issn = {1469-8137}, }
@article {pmid28624899, year = {2017}, author = {Fasfous, AF and Al-Joudi, HF and Puente, AE and Pérez-García, M}, title = {Neuropsychological Measures in the Arab World: A Systematic Review.}, journal = {Neuropsychology review}, volume = {27}, number = {2}, pages = {158-173}, doi = {10.1007/s11065-017-9347-3}, pmid = {28624899}, issn = {1573-6660}, mesh = {Africa, Northern ; Arab World ; Humans ; Middle East ; *Neuropsychological Tests ; *Neuropsychology/instrumentation/methods ; }, abstract = {Although Arabic is one of the most widely used languages in the world, little is known on the availability of standardized neuropsychological tests in Arabic. We review the literature published before 2016, using the keywords Arab*, cogniti*, and neuropsycholo*, as well as keywords for each Arab country. PubMed, PsycINFO, Education Source, Academic Search Complete, Education Resources Information Center, Shamaa, and Arabpsynet databases were searched, in addition to a selected number of Arabic medical and educational journals. After excluding case reports, studies conducted on Arab groups residing outside the Arab world or Israel, and studies that employed intelligence scales or cognitive screens without standardization, 384 studies were eventually reviewed. Tests with most extensive use, adaptation, validation and norming were identified. The Raven Matrices, with its variants, was the most normed cognitive test for Arab individuals (normed in 16 countries). The rate of neuropsychology publications from the Arab countries combined, per year, was less than half of that of each American journal (top 10 journals pertaining to cognition). Nonetheless, the rate in Arab countries has increased after 2010. Publications were mostly from Egypt and Saudi Arabia, but the ratio of test adaptation-to-publication was the largest in Jordan and Lebanon. Approximately half of these publications did not employ cognitive tests that were developed, translated, adapted, or standardized according to international guidelines of psychological measurement. We provide recommendations on improving clinical neuropsychology to better serve Arab patients.}, }
@article {pmid28620679, year = {2017}, author = {Hassan, MM and Hoque, MA and Debnath, NC and Yamage, M and Klaassen, M}, title = {Are Poultry or Wild Birds the Main Reservoirs for Avian Influenza in Bangladesh?.}, journal = {EcoHealth}, volume = {14}, number = {3}, pages = {490-500}, doi = {10.1007/s10393-017-1257-6}, pmid = {28620679}, issn = {1612-9210}, mesh = {Animals ; Animals, Wild/*virology ; Bangladesh/epidemiology ; Birds/*virology ; Disease Outbreaks/*veterinary ; Disease Reservoirs/*virology ; Influenza A Virus, H5N1 Subtype/*isolation &amp; purification ; Influenza in Birds/epidemiology ; Poultry/*virology ; Prevalence ; }, abstract = {Avian influenza viruses (AIV) are of great socioeconomic and health concern, notably in Southeast Asia where highly pathogenic strains, such as highly pathogenic avian influenza (HPAI) H5N1 and other H5 and H7 AIVs, continue to occur. Wild bird migrants are often implicated in the maintenance and spread of AIV. However, little systematic surveillance of wild birds has been conducted in Southeast Asia to evaluate whether the prevalence of AIV in wild birds is higher than in other parts of the world where HPAI outbreaks occur less frequently. Across Bangladesh, we randomly sampled a total of 3585 wild and domestic birds to assess the prevalence of AIV and antibodies against AIV and compared these with prevalence levels found in other endemic and non-endemic countries. Our study showed that both resident and migratory wild birds in Bangladesh do not have a particularly elevated AIV prevalence and AIV sero-prevalence compared to wild birds from regions in the world where H5N1 is not endemic and fewer AIV outbreaks in poultry occur. Like elsewhere, notably wild birds of the orders Anseriformes were identified as the main wild bird reservoir, although we found exceptionally high sero-prevalence in one representative of the order Passeriformes, the house crow (Corvus splendens), importantly living on offal from live bird markets. This finding, together with high sero- and viral prevalence levels of AIV in domestic birds, suggests that wild birds are not at the base of the perpetuation of AIV problems in the local poultry sector, but may easily become victim to AIV spill back from poultry into some species of wild birds, potentially assisting in further spread of the virus.}, }
@article {pmid28619108, year = {2017}, author = {Gomo, G and Mattisson, J and Hagen, BR and Moa, PF and Willebrand, T}, title = {Scavenging on a pulsed resource: quality matters for corvids but density for mammals.}, journal = {BMC ecology}, volume = {17}, number = {1}, pages = {22}, doi = {10.1186/s12898-017-0132-1}, pmid = {28619108}, issn = {1472-6785}, mesh = {Animals ; Animals, Wild/physiology ; Deer/*physiology ; Feeding Behavior ; Female ; Food Chain ; Male ; Norway ; Predatory Behavior ; }, abstract = {BACKGROUND: Human food subsidies can provide predictable food sources in large quantities for wildlife species worldwide. In the boreal forest of Fennoscandia, gut piles from moose (Alces alces) harvest provide a potentially important food source for a range of opportunistically scavenging predators. Increased populations of predators can negatively affect threatened or important game species. As a response to this, restrictions on field dressing of moose are under consideration in parts of Norway. However, there is a lack of research to how this resource is utilized. In this study, we used camera-trap data from 50 gut piles during 1043 monitoring days. We estimated depletion of gut piles separately for parts with high and low energy content, and used these results to scale up gut pile density in the study area. We identified scavenger species and analyzed the influences of gut pile quality and density on scavenging behavior of mammals and corvids (family Corvidae).<br><br>RESULTS: Main scavengers were corvids and red fox (Vulpes vulpes). Parts with high energy content were rapidly consumed, mainly by corvids that were present at all gut piles shortly after the remains were left at the kill site. Corvid presence declined with days since harvest, reflecting reduction in gut pile quality over time independent of gut pile density. Mammals arrived 7-8 days later at the gut piles than corvids, and their presence depended only on gut pile density with a peak at intermediate densities. The decline at high gut pile densities suggest a saturation effect, which could explain accumulation of gut pile parts with low energy content.<br><br>CONCLUSIONS: This study shows that remains from moose harvest can potentially be an important food resource for scavengers, as it was utilized to a high degree by many species. This study gives novel insight into how energy content and density of resources affect scavenging patterns among functional groups of scavengers.}, }
@article {pmid28610033, year = {2017}, author = {Hernández-Triana, LM and Brugman, VA and Prosser, SWJ and Weland, C and Nikolova, N and Thorne, L and Marco, MF and Fooks, AR and Johnson, N}, title = {Molecular approaches for blood meal analysis and species identification of mosquitoes (Insecta: Diptera: Culicidae) in rural locations in southern England, United Kingdom.}, journal = {Zootaxa}, volume = {4250}, number = {1}, pages = {67-76}, pmid = {28610033}, issn = {1175-5334}, mesh = {Animals ; Anopheles ; Cattle ; Culex ; *Culicidae ; Dogs ; England ; Female ; Humans ; Insect Vectors ; Sequence Analysis, DNA ; United Kingdom ; West Nile virus ; }, abstract = {Thirty-four species of Culicidae are present in the UK, of which 15 have been implicated as potential vectors of arthropod-borne viruses such as West Nile virus. Identification of mosquito feeding preferences is paramount to the understanding of vector-host-pathogen interactions which, in turn, would assist in the control of disease outbreaks. Results are presented on the application of DNA barcoding for vertebrate species identification in blood-fed female mosquitoes in rural locations. Blood-fed females (n = 134) were collected in southern England from rural sites and identified based on morphological criteria. Blood meals from 59 specimens (44%) were identified as feeding on eight hosts: European rabbit, cow, human, barn swallow, dog, great tit, magpie and blackbird. Analysis of the cytochrome c oxidase subunit I mtDNA barcoding region and the internal transcribed spacer 2 rDNA region of the specimens morphologically identified as Anopheles maculipennis s.l. revealed the presence of An. atroparvus and An. messeae. A similar analysis of specimens morphologically identified as Culex pipiens/Cx. torrentium showed all specimens to be Cx. pipiens (typical form). This study demonstrates the importance of using molecular techniques to support species-level identification in blood-fed mosquitoes to maximize the information obtained in studies investigating host feeding patterns.}, }
@article {pmid28589845, year = {2017}, author = {Kryukov, AP and Spiridonova, LN and Mori, S and Arkhipov, VY and Red'kin, YA and Goroshko, OA and Lobkov, EG and Haring, E}, title = {Deep Phylogeographic Breaks in Magpie Pica pica Across the Holarctic: Concordance with Bioacoustics and Phenotypes.}, journal = {Zoological science}, volume = {34}, number = {3}, pages = {185-200}, doi = {10.2108/zs160119}, pmid = {28589845}, issn = {0289-0003}, abstract = {We examined sequences of the mitochondrial control region in magpies (Pica pica) from the entire distribution range and found deep genetic splits into four major lineages: (1) group West (Europe-Siberia), (2) group East (southern Far East), (3) P. p. mauritanica (North Africa), and (4) P. p. hudsonia (North America). These lineages show a geographic pattern corresponding to known subspecies or subspecies groups. Genetic variation within the widely-distributed group West is low and neutrality tests supported a recent expansion scenario. The haplotypes from Kamchatka, representing a separated sublineage with clear affinity to the European-Siberian group, are almost identical, implying a recent bottleneck. Group East contained two subclades without clear geographic pattern, presumably due to admixing of populations that had diverged in Pleistocene refuges. The homogeneity of the Kyushu population supports historical reports of introduction of the species from Korea. In contrast, the high variation in the recently established Hokkaido population may reflect an ongoing invasion from several populations of the Far Eastern mainland. Bioacoustic data based on chatter call differentiate groups of subspecies and reflect phylogeographic patterns, i.e., mitochondrial lineages. Furthermore, we report the fast spreading of P. p. jankowskii towards the west along the upper Amur River, and a slower shifting of P. p. leucoptera in the opposite direction thus yielding a new contact zone. Overall, our data support a scenario of divergence in geographic isolation, but the ongoing expansion of distribution ranges may lead to major changes in phylogeographic patterns.}, }
@article {pmid28570966, year = {2017}, author = {O'Donnell, LA and Axelson, DA and Kowatch, RA and Schneck, CD and Sugar, CA and Miklowitz, DJ}, title = {Enhancing quality of life among adolescents with bipolar disorder: A randomized trial of two psychosocial interventions.}, journal = {Journal of affective disorders}, volume = {219}, number = {}, pages = {201-208}, doi = {10.1016/j.jad.2017.04.039}, pmid = {28570966}, issn = {1573-2517}, support = {R01 MH073871/MH/NIMH NIH HHS/United States ; R01 MH093676/MH/NIMH NIH HHS/United States ; R21 MH097007/MH/NIMH NIH HHS/United States ; }, mesh = {Adolescent ; Antipsychotic Agents/therapeutic use ; Bipolar Disorder/psychology/*therapy ; Combined Modality Therapy ; Communication ; Family Relations ; Family Therapy/*methods ; Female ; Humans ; Male ; Patient Education as Topic/*methods ; Quality of Life/*psychology ; Treatment Outcome ; }, abstract = {BACKGROUND: Adolescents with bipolar disorder (BD) report lower quality of life (QoL) than adolescents with other psychiatric disorders. This study compared the efficacy of family-focused therapy for adolescents (FFT-A) plus pharmacotherapy to brief psychoeducation (enhanced care, or EC) plus pharmacotherapy on self-rated QoL in adolescents with BD over 2 years.<br><br>METHODS: Participants were 141 adolescents (mean age: 15.6±1.4yr) with BD I or II who had a mood episode in the previous 3 months. Adolescents and parents were randomly assigned to (1) FFT-A, given in 21 sessions in 9 months of psychoeducation, communication enhancement training, and problem-solving skills training, or (2) EC, given in 3 family psychoeducation sessions. Study psychiatrists provided patient participants with protocol-based pharmacotherapy for the duration of the study. QoL was assessed with The KINDLRQuestionnaire (Ravens-Sieberer and Bullinger, 1998) during active treatment (baseline to 9 months) and during a post-treatment follow-up (9-24 months).<br><br>RESULTS: The two treatment groups did not differ in overall QoL scores over 24 months. However, adolescents in FFT-A had greater improvements in quality of family relationships and physical well-being than participants in EC. For quality of friendships, the trajectory during active treatment favored EC, whereas the trajectory during post-treatment favored FFT-A.<br><br>LIMITATIONS: We were unable to standardize medication use or adherence over time. Quality of life was based on self-report rather than on observable functioning.<br><br>CONCLUSIONS: A short course of family psychoeducation and skills training may enhance relational functioning and health in adolescents with BD. The effects of different psychosocial interventions on peer relationships deserves further study.}, }
@article {pmid28560573, year = {2017}, author = {Chen, X and Wen, T and Hu, J and Liu, T and Esch, GW and Liang, Y and Li, H and Huang, S}, title = {Sarcocystis dehongensis n. sp. (Apicomplexa: Sarcocystidae) from water buffalo (Bubalus bubalis) in China.}, journal = {Parasitology research}, volume = {116}, number = {8}, pages = {2145-2150}, doi = {10.1007/s00436-017-5515-x}, pmid = {28560573}, issn = {1432-1955}, mesh = {Animals ; Buffaloes/*parasitology ; China ; DNA, Mitochondrial/chemistry ; DNA, Ribosomal/chemical synthesis/genetics ; Microscopy, Electron, Transmission/veterinary ; Phylogeny ; RNA, Ribosomal, 18S/genetics ; Sarcocystis/*classification/genetics/isolation &amp; purification/ultrastructure ; Sarcocystosis/parasitology/*veterinary ; }, abstract = {Water buffalo (Bubalus bubalis) is the intermediate host for at least four species of Sarcocystis: S. fusiformis, S. buffalonis, S. levinei, and S. sinensis/S. dubeyi. Here, a new species, Sarcocystis dehongensis, is reported in 51 of 756 (6.7%) water buffaloes in China. By light microscopy, the cysts of S. dehongensis were macroscopic, up to 18.5 mm long and 95 μm in diameter; 4.9-11.9 μm villous protrusions extended beyond the sarcocyst wall. Using transmission electron microscopy, the sarcocyst wall had lancet- or leaf-like protrusions in longitudinal section, but the cross section showed that the protrusions appeared as mushroom-like in shape with a core of tightly packed microtubules, similar to &quot;type 24.&quot; BLAST searches revealed that S. dehongensis shared the most similarities with the 18S rDNA sequence of S. hardangeri (92.4%) and mitochondrial cox1 gene sequence of S. ovalis (81.0%), whereas no sequences in GenBank were found to be significantly similar to the ITS-1 region of S. dehongensis. A phylogenetic analysis based on 18S rDNA and mitochondrial cox1 gene sequences suggested that S. dehongensis was closely related to Sarcocystis species from cervids that employ corvids as definitive hosts.}, }
@article {pmid28557688, year = {2017}, author = {Veit, L and Pidpruzhnykova, G and Nieder, A}, title = {Learning Recruits Neurons Representing Previously Established Associations in the Corvid Endbrain.}, journal = {Journal of cognitive neuroscience}, volume = {29}, number = {10}, pages = {1712-1724}, doi = {10.1162/jocn_a_01152}, pmid = {28557688}, issn = {1530-8898}, mesh = {Action Potentials ; Analysis of Variance ; Animals ; Association Learning/*physiology ; Attention/physiology ; Crows/*physiology ; Electrodes, Implanted ; Feedback, Psychological/physiology ; Neuronal Plasticity/*physiology ; Neurons/*physiology ; Neuropsychological Tests ; Telencephalon/*physiology ; Visual Perception/physiology ; }, abstract = {Crows quickly learn arbitrary associations. As a neuronal correlate of this behavior, single neurons in the corvid endbrain area nidopallium caudolaterale (NCL) change their response properties during association learning. In crows performing a delayed association task that required them to map both familiar and novel sample pictures to the same two choice pictures, NCL neurons established a common, prospective code for associations. Here, we report that neuronal tuning changes during learning were not distributed equally in the recorded population of NCL neurons. Instead, such learning-related changes relied almost exclusively on neurons which were already encoding familiar associations. Only in such neurons did behavioral improvements during learning of novel associations coincide with increasing selectivity over the learning process. The size and direction of selectivity for familiar and newly learned associations were highly correlated. These increases in selectivity for novel associations occurred only late in the delay period. Moreover, NCL neurons discriminated correct from erroneous trial outcome based on feedback signals at the end of the trial, particularly in newly learned associations. Our results indicate that task-relevant changes during association learning are not distributed within the population of corvid NCL neurons but rather are restricted to a specific group of association-selective neurons. Such association neurons in the multimodal cognitive integration area NCL likely play an important role during highly flexible behavior in corvids.}, }
@article {pmid28539482, year = {2017}, author = {KleinHeerenbrink, M and Johansson, LC and Hedenström, A}, title = {Multi-cored vortices support function of slotted wing tips of birds in gliding and flapping flight.}, journal = {Journal of the Royal Society, Interface}, volume = {14}, number = {130}, pages = {}, doi = {10.1098/rsif.2017.0099}, pmid = {28539482}, issn = {1742-5662}, mesh = {*Air Movements ; Animals ; Biomechanical Phenomena ; Crows/*anatomy &amp; histology/*physiology ; Flight, Animal/*physiology ; Wings, Animal/*anatomy &amp; histology/physiology ; }, abstract = {Slotted wing tips of birds are commonly considered an adaptation to improve soaring performance, despite their presence in species that neither soar nor glide. We used particle image velocimetry to measure the airflow around the slotted wing tip of a jackdaw (Corvus monedula) as well as in its wake during unrestrained flight in a wind tunnel. The separated primary feathers produce individual wakes, confirming a multi-slotted function, in both gliding and flapping flight. The resulting multi-cored wingtip vortex represents a spreading of vorticity, which has previously been suggested as indicative of increased aerodynamic efficiency. Considering benefits of the slotted wing tips that are specific to flapping flight combined with the wide phylogenetic occurrence of this configuration, we propose the hypothesis that slotted wings evolved initially to improve performance in powered flight.}, }
@article {pmid28535928, year = {2017}, author = {Luef, EM and Ter Maat, A and Pika, S}, title = {Vocal similarity in long-distance and short-distance vocalizations in raven pairs (Corvus corax) in captivity.}, journal = {Behavioural processes}, volume = {142}, number = {}, pages = {1-7}, doi = {10.1016/j.beproc.2017.05.013}, pmid = {28535928}, issn = {1872-8308}, mesh = {Acoustics ; Animals ; Communication ; Crows/*physiology ; Female ; Male ; *Pair Bond ; Vocalization, Animal/*physiology ; }, abstract = {Vocal interactions in many birds are characterized by imitation or the matching of vocalizations whereby one individual makes its vocalizations more similar to those of a conspecific. This behaviour is aided by vocal learning, which allows birds to change the vocalizations already in their repertoires, or to add new ones. The majority of studies on vocal similarity have been focussing on the songs of birds rather than their calls, with evidence for vocal similarity in calls being rather scarce. Here, we investigated whether ravens make their calls acoustically similar to one another by analysing the extent to which short- and long-distance calls of their vocal repertoires exhibited vocal similarity. Our results showed that long-distance calls, but not short-distance calls, are highly similar between pair partners. This effect may be explained by the different functions underlying short- and long-distance communication in ravens, with vocal similarity possibly being scaffolded by specific social matrices such as pair-bonds and/or strong social relationships.}, }
@article {pmid28534028, year = {2017}, author = {Embleton, ND and Berrington, JE and Dorling, J and Ewer, AK and Juszczak, E and Kirby, JA and Lamb, CA and Lanyon, CV and McGuire, W and Probert, CS and Rushton, SP and Shirley, MD and Stewart, CJ and Cummings, SP}, title = {Mechanisms Affecting the Gut of Preterm Infants in Enteral Feeding Trials.}, journal = {Frontiers in nutrition}, volume = {4}, number = {}, pages = {14}, doi = {10.3389/fnut.2017.00014}, pmid = {28534028}, issn = {2296-861X}, abstract = {Large randomized controlled trials (RCTs) in preterm infants offer unique opportunities for mechanistic evaluation of the risk factors leading to serious diseases, as well as the actions of interventions designed to prevent them. Necrotizing enterocolitis (NEC) a serious inflammatory gut condition and late-onset sepsis (LOS) are common feeding and nutrition-related problems that may cause death or serious long-term morbidity and are key outcomes in two current UK National Institutes for Health Research (NIHR) trials. Speed of increasing milk feeds trial (SIFT) randomized preterm infants to different rates of increases in milk feeds with a primary outcome of survival without disability at 2 years corrected age. Enteral lactoferrin in neonates (ELFIN) randomizes infants to supplemental enteral lactoferrin or placebo with a primary outcome of LOS. This is a protocol for the mechanisms affecting the gut of preterm infants in enteral feeding trials (MAGPIE) study and is funded by the UK NIHR Efficacy and Mechanistic Evaluation programme. MAGPIE will recruit ~480 preterm infants who were enrolled in SIFT or ELFIN. Participation in MAGPIE does not change the main trial protocols and uses non-invasive sampling of stool and urine, along with any residual resected gut tissue if infants required surgery. Trial interventions may involve effects on gut microbes, metabolites (e.g., short-chain fatty acids), and aspects of host immune function. Current hypotheses suggest that NEC and/or LOS are due to a dysregulated immune system in the context of gut dysbiosis, but mechanisms have not been systematically studied within large RCTs. Microbiomic analysis will use next-generation sequencing, and metabolites will be assessed by mass spectrometry to detect volatile organic and other compounds produced by microbes or the host. We will explore differences between disease cases and controls, as well as exploring the actions of trial interventions. Impacts of this research are multiple: translation of knowledge of mechanisms promoting gut health may explain outcomes or suggest alternate strategies to improve health. Results may identify new non-invasive diagnostic or monitoring techniques, preventative or treatment strategies for NEC or LOS, or provide data useful for risk stratification in future studies. Mechanistic evaluation might be especially informative where there are not clear effects on the primary outcome (ISRCTN 12554594).}, }
@article {pmid28527091, year = {2017}, author = {Viticchi, G and Falsetti, L and Bartolini, M and Buratti, L and Pistelli, L and Provinciali, L and Silvestrini, M}, title = {Raven coloured progressive matrices in migraine without aura patients.}, journal = {Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology}, volume = {38}, number = {Suppl 1}, pages = {177-179}, doi = {10.1007/s10072-017-2898-5}, pmid = {28527091}, issn = {1590-3478}, mesh = {Adult ; Cognitive Dysfunction/diagnosis/psychology ; Executive Function/physiology ; Female ; Frontal Lobe/pathology/physiology ; Humans ; Male ; Middle Aged ; Migraine without Aura/*diagnosis/*psychology ; *Neuropsychological Tests ; }, abstract = {Conflicting results emerged from studies investigating cognitive performances in migraine patients. Based on clinical and neuroradiological aspects, the possible involvement of executive functions has been especially taken into consideration. The aim of this study was to evaluate, in a population of subjects affected by migraine without aura (MwoA), frontal lobe cognitive functions. We enrolled all the consecutive patients affected by MwoA referred to our headache centre for a first evaluation. Each patient underwent a neuropsychological evaluation including Raven coloured progressive matrices (CPM). We collected variables as age, education, years of migraine, frequency of attacks and CPM scores. Relationship between continuous variables was explored with multiple regression lines, selecting the best-fitting trendline for each relationship. We obtained a final sample of 36 subjects (females: 62.5%; mean age: 42.25 ± 10.21 years). Patients had mean length of migraine history of 12.25 ± 11.00 years and a mean frequency of attacks of 8.06 ± 7.15 per month. Linear regression underlines a progressive decrease of CPM score with the increase of the migraine history's length (R 2 = 0.8871; p < 0.001), and the frequency of migraine attacks (R 2 = 0.3122; p < 0.05). Our findings suggest that pathological CPM scores can be associated with the severity of migraine. These data seem to confirm the hypothesis of an impairment of executive functions in MwoA. Different hypotheses to explain cognitive impairment in migraine have been postulated including the impact of the typical white matter lesions and a long history of drug abuse. The possible relevant clinical consequence of a full comprehension of this particular aspect related to migraine deserves further attention and consideration.}, }
@article {pmid28512148, year = {2017}, author = {}, title = {Erratum for the Research Article: &quot;Reactive oxygen species induce virus-independent MAVS oligomerization in systemic lupus erythematosus&quot; by I. A. Buskiewicz, T. Montgomery, E. C. Yasewicz, S. A. Huber, M. P. Murphy, R. C. Hartley, R. Kelly, M. K. Crow, A. Perl, R. C. Budd, A. Koenig.}, journal = {Science signaling}, volume = {10}, number = {479}, pages = {}, doi = {10.1126/scisignal.aan5765}, pmid = {28512148}, issn = {1937-9145}, }
@article {pmid28510577, year = {2017}, author = {Baragli, P and Demuru, E and Scopa, C and Palagi, E}, title = {Are horses capable of mirror self-recognition? A pilot study.}, journal = {PloS one}, volume = {12}, number = {5}, pages = {e0176717}, doi = {10.1371/journal.pone.0176717}, pmid = {28510577}, issn = {1932-6203}, mesh = {Animals ; *Behavior, Animal ; Horses ; Pilot Projects ; *Recognition (Psychology) ; *Visual Perception ; }, abstract = {Mirror Self-Recognition (MSR) unveils complex cognitive, social and emotional skills and it has been found only in humans and few other species, such as great apes, dolphins, elephants and magpies. In this pilot study, we tested if horses show the capacity of MSR. Four subjects living socially under naturalistic conditions were selected for the experiment. We adopted the classical mark test, which consists in placing a coloured mark on an out-of-view body part, visible only through mirror inspection. If the animal considers the image as its own, it will use its reflection to detect the mark and will try to explore it. We enhanced the classical paradigm by introducing a double-check control. Only in the presence of the reflecting surface, animals performed tactile and olfactory exploration of the mirror and looked behind it. These behaviors suggest that subjects were trying to associate multiple sensory cues (visual, tactile and olfactory) to the image in the mirror. The lack of correspondence between the collected stimuli in front of the mirror and the response to the colored mark lead us to affirm that horses are able to perceive that the reflected image is incongruent when compared with the memorized information of a real horse. However, without replication of data, the self-directed behavior towards the colored marks showed by our horses cannot be sufficient per se to affirm that horses are capable of self-recognition.}, }
@article {pmid28499162, year = {2017}, author = {Jaam, M and Ibrahim, MIM and Kheir, N and Awaisu, A}, title = {Factors associated with medication adherence among patients with diabetes in the Middle East and North Africa region: A systematic mixed studies review.}, journal = {Diabetes research and clinical practice}, volume = {129}, number = {}, pages = {1-15}, doi = {10.1016/j.diabres.2017.04.015}, pmid = {28499162}, issn = {1872-8227}, mesh = {Africa, Northern ; Diabetes Mellitus/*drug therapy/psychology ; Drug Therapy, Combination/psychology ; Humans ; Hypoglycemic Agents/pharmacology/*therapeutic use ; Medication Adherence/*psychology ; Middle East ; Treatment Outcome ; }, abstract = {Multiple systematic reviews were conducted investigating factors associated with medication adherence worldwide. However, investigations from the Middle East and North Africa (MENA) region were largely underrepresented in those reviews. Therefore, the objective of this systematic review is to identify the factors influencing medication adherence among patients with diabetes in the MENA region. A systematic literature search was conducted through Cochrane Library, EBSCO, EMBASE, Google Scholar, ISI Web of Science, PubMed, ScienceDirect, SCOPUS, and ProQuest. Studies were included if they determined factors associated with medication adherence among patients with diabetes within the MENA region. Quality was assessed using Crow Critical Appraisal Tool. Thirty primary studies from 10 MENA countries were included. The factors associated with medication adherence were categorized into demographics-related; disease- and medication-related; perception, attitude and psychological feelings-related; and societal-related factors. Positively associated factors included knowledge about the disease and medications, regular follow-up visits, and patients' positive beliefs about effectiveness and motivations about medications, while negatively associated factors included forgetfulness, side effects, and polypharmacy. Factors associated with medication adherence among patients with diabetes in the MENA region are highly diverse. The identified factors can serve as potential targets for culturally-relevant interventions to improve medication adherence and overall health outcomes.}, }
@article {pmid28499128, year = {2017}, author = {Zarrintab, M and Mirzaei, R}, title = {Stress induced by heavy metals on breeding of magpie (Pica pica) from central Iran.}, journal = {Ecotoxicology and environmental safety}, volume = {143}, number = {}, pages = {28-37}, doi = {10.1016/j.ecoenv.2017.04.047}, pmid = {28499128}, issn = {1090-2414}, mesh = {Animals ; Clutch Size/drug effects ; Ecosystem ; Egg Shell/chemistry ; Environmental Monitoring/*methods ; Environmental Pollutants/analysis/*toxicity ; Feathers/chemistry ; Iran ; Metals, Heavy/analysis/*toxicity ; Ovum/chemistry ; Passeriformes/*metabolism/physiology ; Pica ; Random Allocation ; Reproduction/*drug effects ; Stress, Physiological/*drug effects ; }, abstract = {The aim of this study was to address the impacts of some heavy metals (Cd, Pb, Zn, Ni and Cu) contamination on laying behavior, egg quality and breeding performance of Pica pica in north of Isfahan Province, Iran. During the breeding season of 2013, magpie's egg content and eggshell as well as nestling excrements and feathers were collected and total concentrations of heavy metals were measured by ICP-OES. Except for Zn in nestling feathers, the significantly higher concentrations of heavy metals were observed in nestling excrements than other samples. Also, comparison of heavy metals concentrations in egg content and eggshell showed that egg content had significantly higher concentrations of Zn and Pb, instead eggshell had significantly higher amount of Cu and Cd. Except for Cu, all heavy metals concentrations in eggshell had a negative relationship with morphological characters; and also concentration of Cu in egg content showed a significantly negative correlation with egg weight and volume. The most of heavy metals in nestling feathers and excrements had strongly positive correlations with each other. Also all heavy metals levels in eggshell and egg content had significantly positive correlations (except for Cu). Unhatched eggs had significantly lower weight but also greater levels of Zn, Cd, and Pb, than randomly collected eggs. No significant differences were observed for morphometric measurements of eggs between different sites, however, a decreased gradient was observed in egg volume toward the brick kiln site. Samples collected in brick kiln site accumulated higher concentrations of heavy metals than other sites. Although numbers of clutch size in brick kiln site were significantly higher than other sites, however, other breeding variable were lower than other sites. It can be suggested that ecosystem contamination may be caused to decrease the reproduction rate of Pica pica in brick kiln, probably by laying more poor quality eggs per clutch and nestling mortality.}, }
@article {pmid28494226, year = {2017}, author = {Whalley, CL and Cutting, N and Beck, SR}, title = {The effect of prior experience on children's tool innovation.}, journal = {Journal of experimental child psychology}, volume = {161}, number = {}, pages = {81-94}, doi = {10.1016/j.jecp.2017.03.009}, pmid = {28494226}, issn = {1096-0457}, mesh = {Child ; Child Development ; Child, Preschool ; *Cognition ; Female ; Humans ; Male ; *Problem Solving ; }, abstract = {Spontaneous tool innovation to solve physical problems is difficult for young children. In three studies, we explored the effect of prior experience with tools on tool innovation in children aged 4-7years (N=299). We also gave children an experience more consistent with that experienced by corvids in similar studies to enable fairer cross-species comparisons. Children who had the opportunity to use a premade target tool in the task context during a warm-up phase were significantly more likely to innovate a tool to solve the problem on the test trial compared with children who had no such warm-up experience. Older children benefited from either using or merely seeing a premade target tool prior to a test trial requiring innovation. Younger children were helped by using a premade target tool. Seeing the tool helped younger children in some conditions. We conclude that spontaneous innovation of tools to solve physical problems is difficult for children. However, children from 4years of age can innovate the means to solve the problem when they have had experience with the solution (visual or haptic exploration). Directions for future research are discussed.}, }
@article {pmid28480002, year = {2017}, author = {Whelan, S and Strickland, D and Morand-Ferron, J and Norris, DR}, title = {Reduced reproductive performance associated with warmer ambient temperatures during incubation in a winter-breeding, food-storing passerine.}, journal = {Ecology and evolution}, volume = {7}, number = {9}, pages = {3029-3036}, doi = {10.1002/ece3.2864}, pmid = {28480002}, issn = {2045-7758}, abstract = {Timing of reproduction can influence individual fitness whereby early breeders tend to have higher reproductive success than late breeders. However, the fitness consequences of timing of breeding may also be influenced by environmental conditions after the commencement of breeding. We tested whether ambient temperatures during the incubation and early nestling periods modulated the effect of laying date on brood size and dominant juvenile survival in gray jays (Perisoreus canadensis), a sedentary boreal species whose late winter nesting depends, in part, on caches of perishable food. Previous evidence has suggested that warmer temperatures degrade the quality of these food hoards, and we asked whether warmer ambient temperatures during the incubation and early nestling periods would be associated with smaller brood sizes and lower summer survival of dominant juveniles. We used 38 years of data from a range-edge population of gray jays in Algonquin Provincial Park, Ontario, where the population has declined over 50% since the study began. Consistent with the &quot;hoard-rot&quot; hypothesis, we found that cold temperatures during incubation were associated with larger brood sizes in later breeding attempts, but temperatures had little effect on brood size for females breeding early in the season. This is the first evidence that laying date and temperature during incubation interactively influence brood size in any bird species. We did not find evidence that ambient temperatures during the incubation period or early part of the nestling period influenced summer survival of dominant juveniles. Our findings provide evidence that warming temperatures are associated with some aspects of reduced reproductive performance in a species that is reliant on cold temperatures to store perishable food caches, some of which are later consumed during the reproductive period.}, }
@article {pmid28479980, year = {2017}, author = {Clayton, N and Wilkins, C}, title = {Memory, mental time travel and The Moustachio Quartet.}, journal = {Interface focus}, volume = {7}, number = {3}, pages = {20160112}, doi = {10.1098/rsfs.2016.0112}, pmid = {28479980}, issn = {2042-8898}, abstract = {Mental time travel allows us to revisit our memories and imagine future scenarios, and this is why memories are not only about the past, but they are also prospective. These episodic memories are not a fixed store of what happened, however, they are reassessed each time they are revisited and depend on the sequence in which events unfold. In this paper, we shall explore the complex relationships between memory and human experience, including through a series of novels 'The Moustachio Quartet' that can be read in any order. To do so, we shall integrate evidences from science and the arts to explore the subjective nature of memory and mental time travel, and argue that it has evolved primarily for prospection as opposed to retrospection. Furthermore, we shall question the notion that mental time travel is a uniquely human construct, and argue that some of the best evidence for the evolution of mental time travel comes from our distantly related cousins, the corvids, that cache food for the future and rely on long-lasting and highly accurate memories of what, where and when they stored their stashes of food.}, }
@article {pmid28472919, year = {2017}, author = {Sun, L and Zhu, Y and Mahmood, ASMA and Tudor, CO and Ren, J and Vijay-Shanker, K and Chen, J and Schmidt, CJ}, title = {WebGIVI: a web-based gene enrichment analysis and visualization tool.}, journal = {BMC bioinformatics}, volume = {18}, number = {1}, pages = {237}, doi = {10.1186/s12859-017-1664-2}, pmid = {28472919}, issn = {1471-2105}, mesh = {Data Mining/*methods ; *Genes ; Genomics/*methods ; Internet ; *Software ; }, abstract = {BACKGROUND: A major challenge of high throughput transcriptome studies is presenting the data to researchers in an interpretable format. In many cases, the outputs of such studies are gene lists which are then examined for enriched biological concepts. One approach to help the researcher interpret large gene datasets is to associate genes and informative terms (iTerm) that are obtained from the biomedical literature using the eGIFT text-mining system. However, examining large lists of iTerm and gene pairs is a daunting task.<br><br>RESULTS: We have developed WebGIVI, an interactive web-based visualization tool (http://raven.anr.udel.edu/webgivi/) to explore gene:iTerm pairs. WebGIVI was built via Cytoscape and Data Driven Document JavaScript libraries and can be used to relate genes to iTerms and then visualize gene and iTerm pairs. WebGIVI can accept a gene list that is used to retrieve the gene symbols and corresponding iTerm list. This list can be submitted to visualize the gene iTerm pairs using two distinct methods: a Concept Map or a Cytoscape Network Map. In addition, WebGIVI also supports uploading and visualization of any two-column tab separated data.<br><br>CONCLUSIONS: WebGIVI provides an interactive and integrated network graph of gene and iTerms that allows filtering, sorting, and grouping, which can aid biologists in developing hypothesis based on the input gene lists. In addition, WebGIVI can visualize hundreds of nodes and generate a high-resolution image that is important for most of research publications. The source code can be freely downloaded at https://github.com/sunliang3361/WebGIVI . The WebGIVI tutorial is available at http://raven.anr.udel.edu/webgivi/tutorial.php .}, }
@article {pmid28468913, year = {2017}, author = {Boonekamp, JJ and Bauch, C and Mulder, E and Verhulst, S}, title = {Does oxidative stress shorten telomeres?.}, journal = {Biology letters}, volume = {13}, number = {5}, pages = {}, doi = {10.1098/rsbl.2017.0164}, pmid = {28468913}, issn = {1744-957X}, mesh = {Animals ; Biomarkers ; *Oxidative Stress ; Telomere ; Telomere Shortening ; }, abstract = {Oxidative stress shortens telomeres in cell culture, but whether oxidative stress explains variation in telomere shortening in vivo at physiological oxidative stress levels is not well known. We therefore tested for correlations between six oxidative stress markers and telomere attrition in nestling birds (jackdaws Corvus monedula) that show a high rate of telomere attrition in early life. Telomere attrition was measured between ages 5 and 30 days, and was highly variable (average telomere loss: 323 bp, CV = 45%). Oxidative stress markers were measured in blood at age 20 days and included markers of oxidative damage (TBARS, dROMs and GSSG) and markers of antioxidant protection (GSH, redox state, uric acid). Variation in telomere attrition was not significantly related to these oxidative stress markers (|r| ≤ 0.08, n = 87). This finding raises the question whether oxidative stress accelerates telomere attrition in vivo The accumulation of telomere attrition over time depends both on the number of cell divisions and on the number of base pairs lost per DNA replication and, based on our findings, we suggest that in a growing animal cell proliferation, dynamics may be more important for explaining variation in telomere attrition than oxidative stress.}, }
@article {pmid28447768, year = {2017}, author = {Iwata, M and Teshima, M and Seki, T and Yoshioka, S and Takeoka, Y}, title = {Bio-Inspired Bright Structurally Colored Colloidal Amorphous Array Enhanced by Controlling Thickness and Black Background.}, journal = {Advanced materials (Deerfield Beach, Fla.)}, volume = {29}, number = {26}, pages = {}, doi = {10.1002/adma.201605050}, pmid = {28447768}, issn = {1521-4095}, abstract = {Inspired by Steller's jay, which displays angle-independent structural colors, angle-independent structurally colored materials are created, which are composed of amorphous arrays of submicrometer-sized fine spherical silica colloidal particles. When the colloidal amorphous arrays are thick, they do not appear colorful but almost white. However, the saturation of the structural color can be increased by (i) appropriately controlling the thickness of the array and (ii) placing the black background substrate. This is similar in the case of the blue feather of Steller's jay. Based on the knowledge gained through the biomimicry of structural colored materials, colloidal amorphous arrays on the surface of a black particle as the core particle are also prepared as colorful photonic pigments. Moreover, a structural color on-off system is successfully built by controlling the background brightness of the colloidal amorphous arrays.}, }
@article {pmid28422953, year = {2017}, author = {Soler, M and de Neve, L and Roldán, M and Pérez-Contreras, T and Soler, JJ}, title = {Great spotted cuckoo nestlings have no antipredatory effect on magpie or carrion crow host nests in southern Spain.}, journal = {PloS one}, volume = {12}, number = {4}, pages = {e0173080}, doi = {10.1371/journal.pone.0173080}, pmid = {28422953}, issn = {1932-6203}, mesh = {Animals ; Animals, Newborn ; Crows/parasitology/*physiology ; Nesting Behavior/*physiology ; Passeriformes/*physiology ; Predatory Behavior/*physiology ; Spain ; Symbiosis/physiology ; }, abstract = {Host defences against cuckoo parasitism and cuckoo trickeries to overcome them are a classic example of antagonistic coevolution. Recently it has been reported that this relationship may turn to be mutualistic in the case of the carrion crow (Corvus corone) and its brood parasite, the great spotted cuckoo (Clamator glandarius), given that experimentally and naturally parasitized nests were depredated at a lower rate than non-parasitized nests. This result was interpreted as a consequence of the antipredatory properties of a fetid cloacal secretion produced by cuckoo nestlings, which presumably deters predators from parasitized host nests. This potential defensive mechanism would therefore explain the detected higher fledgling success of parasitized nests during breeding seasons with high predation risk. Here, in a different study population, we explored the expected benefits in terms of reduced nest predation in naturally and experimentally parasitized nests of two different host species, carrion crows and magpies (Pica pica). During the incubation phase non-parasitized nests were depredated more frequently than parasitized nests. However, during the nestling phase, parasitized nests were not depredated at a lower rate than non-parasitized nests, neither in magpie nor in carrion crow nests, and experimental translocation of great spotted cuckoo hatchlings did not reveal causal effects between parasitism state and predation rate of host nests. Therefore, our results do not fit expectations and, thus, do not support the fascinating possibility that great spotted cuckoo nestlings could have an antipredatory effect for host nestlings, at least in our study area. We also discuss different possibilities that may conciliate these with previous results, but also several alternative explanations, including the lack of generalizability of the previously documented mutualistic association.}, }
@article {pmid28417984, year = {2017}, author = {Mullard, A}, title = {An audience with Jay Bradner.}, journal = {Nature reviews. Drug discovery}, volume = {16}, number = {5}, pages = {367}, doi = {10.1038/nrd.2017.71}, pmid = {28417984}, issn = {1474-1784}, }
@article {pmid28415177, year = {2017}, author = {Espinosa, G and Rodríguez, R and Gil, JM and Suzuki-Vidal, F and Lebedev, SV and Ciardi, A and Rubiano, JG and Martel, P}, title = {Influence of atomic kinetics in the simulation of plasma microscopic properties and thermal instabilities for radiative bow shock experiments.}, journal = {Physical review. E}, volume = {95}, number = {3-1}, pages = {033201}, doi = {10.1103/PhysRevE.95.033201}, pmid = {28415177}, issn = {2470-0053}, abstract = {Numerical simulations of laboratory astrophysics experiments on plasma flows require plasma microscopic properties that are obtained by means of an atomic kinetic model. This fact implies a careful choice of the most suitable model for the experiment under analysis. Otherwise, the calculations could lead to inaccurate results and inappropriate conclusions. First, a study of the validity of the local thermodynamic equilibrium in the calculation of the average ionization, mean radiative properties, and cooling times of argon plasmas in a range of plasma conditions of interest in laboratory astrophysics experiments on radiative shocks is performed in this work. In the second part, we have made an analysis of the influence of the atomic kinetic model used to calculate plasma microscopic properties of experiments carried out on magpie on radiative bow shocks propagating in argon. The models considered were developed assuming both local and nonlocal thermodynamic equilibrium and, for the latter situation, we have considered in the kinetic model different effects such as external radiation field and plasma mixture. The microscopic properties studied were the average ionization, the charge state distributions, the monochromatic opacities and emissivities, the Planck mean opacity, and the radiative power loss. The microscopic study was made as a postprocess of a radiative-hydrodynamic simulation of the experiment. We have also performed a theoretical analysis of the influence of these atomic kinetic models in the criteria for the onset possibility of thermal instabilities due to radiative cooling in those experiments in which small structures were experimentally observed in the bow shock that could be due to this kind of instability.}, }
@article {pmid28412529, year = {2017}, author = {Manrique, HM and Molina, AC and Posada, S and Colell, M}, title = {Vertical string-pulling in green jays (Cyanocorax yncas).}, journal = {Behavioural processes}, volume = {140}, number = {}, pages = {74-80}, doi = {10.1016/j.beproc.2017.04.004}, pmid = {28412529}, issn = {1872-8308}, mesh = {Animals ; Choice Behavior ; Cognition/*physiology ; Conditioning, Operant ; Discrimination Learning ; Female ; Male ; Passeriformes/*physiology ; *Problem Solving ; Psychomotor Performance/physiology ; Reinforcement (Psychology) ; }, abstract = {The cognition of green jays (Cyanocorax yncas), a non Corvus corvid species, was investigated by using the string-pulling paradigm. Five adult green jays performed a vertical string-pulling task in which they had to retrieve a worm attached to the end of a vertical hanging string while sitting on their perch. In the first experiment, three of the subjects managed to retrieve the worm by pulling on the string with their beaks and stepping on the resulting loop, and thereafter repeating this sequence until the worm was accessible. When subjects were given a choice between two strings in subsequent experiments 2-4, they chose at random between the string connected to the worm and the one connected to a slice of a wooden dowel. In experiment 5, subjects that had failed the previous discrimination series were able, nevertheless, to solve a more stringent vertical string array in which they had to pull up the whole length of the string without any visual access to the worm at the end. We discuss green jays' performance in comparison with other corvid species in which cognition has been more extensively investigated.}, }
@article {pmid28407723, year = {2018}, author = {Huang, Z and Ruan, R}, title = {DNA barcodes and insights into the phylogenetic relationships of Corvidae (Aves: Passeriformes).}, journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis}, volume = {29}, number = {4}, pages = {529-534}, doi = {10.1080/24701394.2017.1315569}, pmid = {28407723}, issn = {2470-1408}, abstract = {DNA barcoding has become a promising tool for species identification and phylogeny in a wide range of animal taxa using mitochondrial cytochrome c oxidase subunit I (COI). The Corvidae (Aves: Passeriformes) is a species rich and morphologically diverse family. In the present study, we analyzed the COI barcodes of 39 species from 12 genera of Corvidae. COI gene was also used to examine phylogenetic relationships of Corvidae. Every species possessed a barcode distinct from that of other species. Kimura two-parameter distances were calculated between species barcodes. The average genetic distance between the species was 22 times higher compared to the average genetic distance within species. Maximum likelihood method was used to construct a phylogenetic tree. All the species could be discriminated by their distinct clades in the phylogenetic tree. COI gene data provided good evidence for the monophyly of the Corvidae. Members of Cyanopica and Pyrrhocorax were the first to split from the Corvidae lineage. Analysis of COI genes supported the others genera fell into two clades. DNA barcoding is an effective molecular tool for Corvidae species identification and phylogenetic inference.}, }
@article {pmid28386435, year = {2017}, author = {Matsui, H and Izawa, EI}, title = {Flexible motor adjustment of pecking with an artificially extended bill in crows but not in pigeons.}, journal = {Royal Society open science}, volume = {4}, number = {2}, pages = {160796}, doi = {10.1098/rsos.160796}, pmid = {28386435}, issn = {2054-5703}, abstract = {The dextrous foraging skills of primates, including humans, are underpinned by flexible vision-guided control of the arms/hands and even tools as body-part extensions. This capacity involves a visuomotor conversion process that transfers the locations of the hands/arms and a target in retinal coordinates into body coordinates to generate a reaching/grasping movement and to correct online. Similar capacities have evolved in birds, such as tool use in corvids and finches, which represents the flexible motor control of extended body parts. However, the flexibility of avian head-reaching and bill-grasping with body-part extensions remains poorly understood. This study comparatively investigated the flexibility of pecking with an artificially extended bill in crows and pigeons. Pecking performance and kinematics were examined when the bill extension was attached, and after its removal. The bill extension deteriorated pecking in pigeons in both performance and kinematics over 10 days. After the bill removal, pigeons started bill-grasping earlier, indicating motor adaptation to the bill extension. Contrastingly, pecking in crows was deteriorated transiently with the bill extension, but was recovered by adjusting pecking at closer distances, suggesting a quick adjustment to the bill extension. These results indicate flexible visuomotor control to extended body parts in crows but not in pigeons.}, }
@article {pmid28379045, year = {2017}, author = {Davie, C and Clark, AB}, title = {Self-Rehabilitation of a Captive American Crow at Binghamton Zoo.}, journal = {Journal of applied animal welfare science : JAAWS}, volume = {20}, number = {3}, pages = {273-279}, doi = {10.1080/10888705.2017.1307747}, pmid = {28379045}, issn = {1532-7604}, mesh = {Animals ; Animals, Zoo ; *Crows ; Female ; Flight, Animal/*physiology ; United States ; }, abstract = {The behavioral transition from an entirely unflighted-to-flighted, female yearling American crow (Corvus brachyrhynchos) in captivity in a specially designed exhibit was documented at the Binghamton Zoo at Ross Park in Binghamton, NY. Upon arrival, the focal crow had no complete primary feathers or retrices and had been in captivity since fledging. She apparently had never flown successfully and was using her legs and an abnormal body orientation to cushion her landing on the ground. In a social and physical environment with 3 flying companion crows and staggered perches, she developed and appeared to &quot;practice&quot; routines that ultimately resulted in her recovering normal body posture and flight ability. The crow's practice routine was recorded during daily observations using an ethogram of social and locomotor behaviors. Both enclosure design and the social environment may have provided an ideal setting for the self-motivation of practice and this recovery. Attention to the potential for such practice could facilitate rehabilitation in individuals for whom rehabilitation was not thought possible.}, }
@article {pmid28364366, year = {2017}, author = {Uomini, N and Hunt, G}, title = {A new tool-using bird to crow about.}, journal = {Learning &amp; behavior}, volume = {45}, number = {3}, pages = {205-206}, doi = {10.3758/s13420-017-0262-5}, pmid = {28364366}, issn = {1543-4508}, mesh = {Animals ; Cognition ; *Crows ; *Tool Use Behavior ; }, abstract = {The Hawaiian crow has been revealed as a skilled tool user, confirmed by testing the last members of this endangered species that survive in captivity. The finding suggests its behavior is tantalizingly similar to that of the famous tool-using New Caledonian crow and has implications for the evolution of tool use and intelligence in birds.}, }
@article {pmid28360231, year = {2017}, author = {Weissensteiner, MH and Pang, AWC and Bunikis, I and Höijer, I and Vinnere-Petterson, O and Suh, A and Wolf, JBW}, title = {Combination of short-read, long-read, and optical mapping assemblies reveals large-scale tandem repeat arrays with population genetic implications.}, journal = {Genome research}, volume = {27}, number = {5}, pages = {697-708}, doi = {10.1101/gr.215095.116}, pmid = {28360231}, issn = {1549-5469}, mesh = {Animals ; Chromatin/genetics/metabolism ; Contig Mapping/methods/*standards ; Crows/genetics ; *Genome ; Homologous Recombination ; Sequence Analysis, DNA/methods/standards ; *Tandem Repeat Sequences ; }, abstract = {Accurate and contiguous genome assembly is key to a comprehensive understanding of the processes shaping genomic diversity and evolution. Yet, it is frequently constrained by constitutive heterochromatin, usually characterized by highly repetitive DNA. As a key feature of genome architecture associated with centromeric and subtelomeric regions, it locally influences meiotic recombination. In this study, we assess the impact of large tandem repeat arrays on the recombination rate landscape in an avian speciation model, the Eurasian crow. We assembled two high-quality genome references using single-molecule real-time sequencing (long-read assembly [LR]) and single-molecule optical maps (optical map assembly [OM]). A three-way comparison including the published short-read assembly (SR) constructed for the same individual allowed assessing assembly properties and pinpointing misassemblies. By combining information from all three assemblies, we characterized 36 previously unidentified large repetitive regions in the proximity of sequence assembly breakpoints, the majority of which contained complex arrays of a 14-kb satellite repeat or its 1.2-kb subunit. Using whole-genome population resequencing data, we estimated the population-scaled recombination rate (ρ) and found it to be significantly reduced in these regions. These findings are consistent with an effect of low recombination in regions adjacent to centromeric or subtelomeric heterochromatin and add to our understanding of the processes generating widespread heterogeneity in genetic diversity and differentiation along the genome. By combining three different technologies, our results highlight the importance of adding a layer of information on genome structure that is inaccessible to each approach independently.}, }
@article {pmid28357814, year = {2017}, author = {Dresow, MW}, title = {Before hierarchy: the rise and fall of Stephen Jay Gould's first macroevolutionary synthesis.}, journal = {History and philosophy of the life sciences}, volume = {39}, number = {2}, pages = {6}, doi = {10.1007/s40656-017-0133-6}, pmid = {28357814}, issn = {0391-9714}, abstract = {Few of Stephen Jay Gould's accomplishments in evolutionary biology have received more attention than his hierarchical theory of evolution, which postulates a causal discontinuity between micro- and macroevolutionary events. But Gould's hierarchical theory was his second attempt to supply a theoretical framework for macroevolutionary studies-and one he did not inaugurate until the mid-1970s. In this paper, I examine Gould's first attempt: a proposed fusion of theoretical morphology, multivariate biometry and the experimental study of adaptation in fossils. This early &quot;macroevolutionary synthesis&quot; was predicated on the notion that parallelism and convergence dominate the history of higher taxa, and moreover, that they can be explained in terms of adaptation leading to mechanical improvement. In this paper, I explore the origins and contents of Gould's first macroevolutionary synthesis, as well as the reasons for its downfall. In addition, I consider how various developments during the mid-1970s led Gould to identify hierarchy and constraint as the leading themes of macroevolutionary studies-and adaptation as a macroevolutionary red herring.}, }
@article {pmid28356589, year = {2017}, author = {}, title = {Jay Bradner.}, journal = {Nature reviews. Drug discovery}, volume = {16}, number = {4}, pages = {232-233}, doi = {10.1038/nrd.2017.50}, pmid = {28356589}, issn = {1474-1784}, mesh = {Drug Delivery Systems/*trends ; Drug Discovery/methods/*trends ; Drug Industry/methods/*trends ; Hematology/methods/trends ; Humans ; }, }
@article {pmid28355292, year = {2017}, author = {Majkić, A and Evans, S and Stepanchuk, V and Tsvelykh, A and d'Errico, F}, title = {A decorated raven bone from the Zaskalnaya VI (Kolosovskaya) Neanderthal site, Crimea.}, journal = {PloS one}, volume = {12}, number = {3}, pages = {e0173435}, doi = {10.1371/journal.pone.0173435}, pmid = {28355292}, issn = {1932-6203}, mesh = {Animals ; Archaeology/methods ; Bone and Bones/*anatomy &amp; histology ; Crows/anatomy &amp; histology ; *Fossils ; History, Ancient ; Humans ; Microscopy ; Multivariate Analysis ; Neanderthals/*psychology ; Paleontology/methods ; Russia ; }, abstract = {We analyze a radius bone fragment of a raven (Corvus corax) from Zaskalnaya VI rock shelter, Crimea. The object bears seven notches and comes from an archaeological level attributed to a Micoquian industry dated to between 38 and 43 cal kyr BP. Our study aims to examine the degree of regularity and intentionality of this set of notches through their technological and morphometric analysis, complemented by comparative experimental work. Microscopic analysis of the notches indicate that they were produced by the to-and-fro movement of a lithic cutting edge and that two notches were added to fill in the gap left between previously cut notches, probably to increase the visual consistency of the pattern. Multivariate analysis of morphometric data recorded on the archaeological notches and sets of notches cut by nine modern experimenters on radii of domestic turkeys shows that the variations recorded on the Zaskalnaya set are comparable to experimental sets made with the aim of producing similar, parallel, equidistant notches. Identification of the Weber Fraction, the constant that accounts for error in human perception, for equidistant notches cut on bone rods and its application to the Zaskalnaya set of notches and thirty-six sets of notches incised on seventeen Upper Palaeolithic bone objects from seven sites indicate that the Zaskalnaya set falls within the range of variation of regularly spaced experimental and Upper Palaeolithic sets of notches. This suggests that even if the production of the notches may have had a utilitarian reason the notches were made with the goal of producing a visually consistent pattern. This object represents the first instance of a bird bone from a Neanderthal site bearing modifications that cannot be explained as the result of butchery activities and for which a symbolic argument can be built on direct rather than circumstantial evidence.}, }
@article {pmid28350846, year = {2017}, author = {Szymańska-Czerwińska, M and Mitura, A and Niemczuk, K and Zaręba, K and Jodełko, A and Pluta, A and Scharf, S and Vitek, B and Aaziz, R and Vorimore, F and Laroucau, K and Schnee, C}, title = {Dissemination and genetic diversity of chlamydial agents in Polish wildfowl: Isolation and molecular characterisation of avian Chlamydia abortus strains.}, journal = {PloS one}, volume = {12}, number = {3}, pages = {e0174599}, doi = {10.1371/journal.pone.0174599}, pmid = {28350846}, issn = {1932-6203}, mesh = {Animals ; Animals, Wild/*microbiology ; Bacterial Outer Membrane Proteins/genetics ; Bird Diseases/epidemiology/*microbiology/transmission ; Birds/*microbiology ; Chlamydia/classification/*genetics/isolation &amp; purification ; Chlamydia Infections/epidemiology/*microbiology/transmission ; DNA, Ribosomal Spacer/genetics ; *Genetic Variation ; Genotype ; Geography ; Phylogeny ; Poland/epidemiology ; Prevalence ; RNA, Ribosomal, 16S/genetics ; RNA, Ribosomal, 23S/genetics ; Sequence Analysis, DNA/methods ; Species Specificity ; }, abstract = {Wild birds are considered as a reservoir for avian chlamydiosis posing a potential infectious threat to domestic poultry and humans. Analysis of 894 cloacal or fecal swabs from free-living birds in Poland revealed an overall Chlamydiaceae prevalence of 14.8% (n = 132) with the highest prevalence noted in Anatidae (19.7%) and Corvidae (13.4%). Further testing conducted with species-specific real-time PCR showed that 65 samples (49.2%) were positive for C. psittaci whereas only one was positive for C. avium. To classify the non-identified chlamydial agents and to genotype the C. psittaci and C. avium-positive samples, specimens were subjected to ompA-PCR and sequencing (n = 83). The ompA-based NJ dendrogram revealed that only 23 out of 83 sequences were assigned to C. psittaci, in particular to four clades representing the previously described C. psittaci genotypes B, C, Mat116 and 1V. Whereas the 59 remaining sequences were assigned to two new clades named G1 and G2, each one including sequences recently obtained from chlamydiae detected in Swedish wetland birds. G1 (18 samples from Anatidae and Rallidae) grouped closely together with genotype 1V and in relative proximity to several C. abortus isolates, and G2 (41 samples from Anatidae and Corvidae) grouped closely to C. psittaci strains of the classical ABE cluster, Matt116 and M56. Finally, deep molecular analysis of four representative isolates of genotypes 1V, G1 and G2 based on 16S rRNA, IGS and partial 23S rRNA sequences as well as MLST clearly classify these isolates within the C. abortus species. Consequently, we propose an expansion of the C. abortus species to include not only the classical isolates of mammalian origin, but also avian isolates so far referred to as atypical C. psittaci or C. psittaci/C. abortus intermediates.}, }
@article {pmid28343746, year = {2018}, author = {Freeto, T and Mitchell, SJ and Bogie, KM}, title = {Preliminary development of an advanced modular pressure relief cushion: Testing and user evaluation.}, journal = {Journal of tissue viability}, volume = {27}, number = {1}, pages = {2-9}, doi = {10.1016/j.jtv.2017.03.001}, pmid = {28343746}, issn = {0965-206X}, abstract = {STUDY AIM: Effective pressure relief cushions are identified as a core assistive technology need by the World Health Organization Global Cooperation on Assistive Technology. High quality affordable wheelchair cushions could provide effective pressure relief for many individuals with limited access to advanced assistive technology.<br><br>MATERIALS: Value driven engineering (VdE) principles were employed to develop a prototype modular cushion. Low cost dynamically responsive gel balls were arranged in a close packed array and seated in bilayer foam for containment and support. Two modular cushions, one with high compliance balls and one with moderate compliance balls were compared with High Profile and Low Profile Roho® and Jay® Medical 2 cushions.<br><br>METHODS: ISO 16480-2 biomechanical standardized tests were applied to assess cushion performance. A preliminary materials cost analysis was carried out. A prototype modular cushion was evaluated by 12 participants who reported satisfaction using a questionnaire based on the Quebec User Evaluation of Satisfaction with Assistive Technology (QUEST 2.0) instrument.<br><br>RESULTS: Overall the modular cushions performed better than, or on par with, the most widely prescribed commercially available cushions under ISO 16480-2 testing. Users rated the modular cushion highly for overall appearance, size and dimensions, comfort, safety, stability, ease of adjustment and general ease of use. Cost-analysis indicated that every modular cushion component a could be replaced several times and still maintain cost-efficacy over the complete cushion lifecycle.<br><br>CONCLUSION: A VdE modular cushion has the potential provide effective pressure relief for many users at a low lifetime cost.}, }
@article {pmid28336913, year = {2017}, author = {Loretto, MC and Schuster, R and Itty, C and Marchand, P and Genero, F and Bugnyar, T}, title = {Fission-fusion dynamics over large distances in raven non-breeders.}, journal = {Scientific reports}, volume = {7}, number = {1}, pages = {380}, doi = {10.1038/s41598-017-00404-4}, pmid = {28336913}, issn = {2045-2322}, abstract = {The influence of fission-fusion dynamics, i.e., temporal variation in group size and composition, on social complexity has been studied in large-brained mammals that rely on social bonds. Little is known about birds, even though some species like ravens have recently received attention for their socio-cognitive skills and use of social bonds. While raven breeders defend territories year-round, non-breeders roam through large areas and form groups at food sources or night roosts. We here examined the fission-fusion patterns of non-breeding ravens over years, investigating whether birds meet repeatedly either at the same or at different locations. We combined four large datasets: presence-absence observations from two study sites (Austria, Italy) and GPS-tracking of ravens across two study areas (Austria, France). As expected, we found a highly dynamic system in which individuals with long phases of temporary settlement had a high probability of meeting others. Although GPS-tagged ravens spread out over thousands of square kilometres, we found repeated associations between almost half of the possible combinations at different locations. Such a system makes repeated interactions between individuals at different sites possible and likely. High fission-fusion dynamics may thus not hinder but shape the social complexity of ravens and, possibly, other long-term bonded birds.}, }
@article {pmid28334859, year = {2017}, author = {Iloh, KK and Emodi, IJ and Ibeziako, NS and Ikefuna, AN and Ubesie, AC and Iloh, ON and Ilechukwu, GC and Ayuk, AC}, title = {Neurocognitive Function of School-aged HIV-infected Children in Enugu, Nigeria.}, journal = {Journal of tropical pediatrics}, volume = {}, number = {}, pages = {}, doi = {10.1093/tropej/fmx006}, pmid = {28334859}, issn = {1465-3664}, abstract = {Background: Evidence has shown neurocognitive problems often exist among human immunodeficiency virus (HIV)-infected children. There are limited data for children in Nigeria.<br><br>Methods: This was a cross-sectional study of 100 school-aged perinatally HIV-infected children seen in the paediatric HIV clinic and age/sex-matched controls from the general paediatric clinic. Neuro-cognitive functioning was assessed using the Raven's progressive matrices (RPM) that has been adapted for the Nigerian population.<br><br>Results: The mean RPM score of subjects was 22.97 ± 11.35 compared with 32.93 ± 15.71 among controls (p < 0.001). Twenty-two percent of subjects in the HIV-infected group vs. 56% of controls were in the above-average intelligence group on the RPM. Thirty-four percent had average scores, while 22% were in the below-average scoring range. Neuro-cognitive functioning of the subjects was significantly affected by immunologic staging and socio-economic status.<br><br>Conclusions: Neurocognitive functioning of the HIV-infected children was significantly lower than those of their un-infected counterparts. Neurodevelopmental evaluation should be part of standard care in HIV-infected children in Nigerian setting.}, }
@article {pmid28327578, year = {2017}, author = {Langin, KM and Sillett, TS and Funk, WC and Morrison, SA and Ghalambor, CK}, title = {Partial support for the central-marginal hypothesis within a population: reduced genetic diversity but not increased differentiation at the range edge of an island endemic bird.}, journal = {Heredity}, volume = {119}, number = {1}, pages = {8-15}, doi = {10.1038/hdy.2017.10}, pmid = {28327578}, issn = {1365-2540}, mesh = {Animal Distribution ; Animals ; California ; Evolution, Molecular ; Gene Flow ; Genetic Drift ; *Genetic Variation ; *Genetics, Population ; Genotype ; Islands ; Microsatellite Repeats ; Passeriformes/*genetics ; Population Density ; Spatial Analysis ; }, abstract = {Large-scale population comparisons have contributed to our understanding of the evolution of geographic range limits and species boundaries, as well as the conservation value of populations at range margins. The central-marginal hypothesis (CMH) predicts a decline in genetic diversity and an increase in genetic differentiation toward the periphery of species' ranges due to spatial variation in genetic drift and gene flow. Empirical studies on a diverse array of taxa have demonstrated support for the CMH. However, nearly all such studies come from widely distributed species, and have not considered if the same processes can be scaled down to single populations. Here, we test the CMH on a species composed of a single population: the Island Scrub-Jay (Aphelocoma insularis), endemic to a 250 km2 island. We examined microsatellite data from a quarter of the total population and found that homozygosity increased toward the island's periphery. However, peripheral portions of the island did not exhibit higher genetic differentiation. Simulations revealed that highly localized dispersal and small total population size, but not spatial variation in population density, were critical for generating fine-scale variation in homozygosity. Collectively, these results demonstrate that microevolutionary processes driving spatial variation in genetic diversity among populations can also be important for generating spatial variation in genetic diversity within populations.}, }
@article {pmid28324206, year = {2017}, author = {Kobayashi, A and Miura, S and Kozaki, A}, title = {INDETERMINATE DOMAIN PROTEIN binding sequences in the 5'-untranslated region and promoter of the SCARECROW gene play crucial and distinct roles in regulating SCARECROW expression in roots and leaves.}, journal = {Plant molecular biology}, volume = {94}, number = {1-2}, pages = {1-13}, doi = {10.1007/s11103-016-0578-0}, pmid = {28324206}, issn = {1573-5028}, mesh = {Arabidopsis/cytology/genetics/*metabolism ; Arabidopsis Proteins/genetics/*metabolism ; Carrier Proteins/genetics/*metabolism ; Cells, Cultured ; Gene Expression Regulation, Plant/physiology ; Mutation ; Plant Leaves/*metabolism ; Plant Roots/*metabolism ; Promoter Regions, Genetic ; Protein Binding ; Transcription Factors/genetics/*metabolism ; }, abstract = {SCARECROW (SCR) and SHORT-ROOT (SHR), which belong to the GRAS transcription factor family, are key regulators of root and leaf growth and development. Despite the importance of SCR expression for proper plant development, the mechanism of SCR regulation has not been clarified. A previous study showed that an INDETERMINATE DOMAIN transcription factor, JACKDAW (JKD), is essential for the expression of SCR in combination with SCR and SHR. In this study, we characterized possible binding sequences of INDETERMINATE DOMAIN PROTEIN in the 1.5 kb upstream region of SCR. Mutation in a binding sequence 340 bp upstream of the ATG increased transcriptional activation by JKD in transient assays using Arabidopsis cultured cells. However, the activity was not enhanced by SCR/SHR. Histochemical analysis of promoter activity in transgenic Arabidopsis plants carrying a fusion of the promoter and the β-glucronidase reporter gene showed that mutation of the -340 bp sequence eliminated most of the promoter activity, indicating that this sequence was indispensable for SCR expression. Promoter deletion of downstream sequences from -280 bp lost the enhanced activity by SCR/SHR in transient assays and activity in root tips and the bundle sheath (BS) in plants. Conversely, mutation at -480 bp did not significantly influence transcriptional activity in transient assays. However, most of SCR expression was lost except for the root tip in plants. The sequences around -1 kb appeared to regulate SCR expression negatively in plants. Together, these INDETERMINATE DOMAIN PROTEIN binding sequences have crucial and distinct functions in regulating SCR expression.}, }
@article {pmid28323477, year = {2017}, author = {Adler, JL}, title = {&quot;The Service I Rendered Was Just as True&quot;: African American Soldiers and Veterans as Activist Patients.}, journal = {American journal of public health}, volume = {107}, number = {5}, pages = {675-683}, doi = {10.2105/AJPH.2017.303688}, pmid = {28323477}, issn = {1541-0048}, mesh = {African Americans/*history ; Health Policy/history ; History, 20th Century ; Hospitals, Military/*history ; Humans ; Male ; Military Personnel/*history ; Patient Advocacy/*history ; Prejudice/*history ; United States ; Veterans/*history ; World War I ; }, abstract = {In this article, I examine how African American soldiers and veterans experienced and shaped federally sponsored health care during and after World War I. Building on studies of the struggles of Black leaders and health care providers to win professional and public health advancement in the 1920s and 1930s, and of advocates to mobilize for health care rights in the mid-20th century, I focus primarily on the experiences and activism of patients in the interwar years. Private and government correspondence, congressional testimony, and reports from Black newspapers reveal that African American soldiers and veterans communicated directly with policymakers and bureaucrats regarding unequal treatment, assuming roles as &quot;policy actors&quot; who viewed health and medical care as &quot;politics by other means.&quot; In the process, they drew attention to the paradoxes inherent in expanding government entitlements in the era of Jim Crow, and helped shape a veterans' health system that emerged in the 1920s and remained in place for the following century. They also laid the groundwork for the system's precedent-setting desegregation, referred to by advocates of the time as &quot;a shining example to the rest of the country.&quot;}, }
@article {pmid28314903, year = {2017}, author = {Fucci, N and Campobasso, CP and Mastrogiuseppe, L and Puccinelli, C and Marcheggiani, S and Mancini, L and Marino, L and Pascali, VL}, title = {Diatoms in drowning cases in forensic veterinary context: a preliminary study.}, journal = {International journal of legal medicine}, volume = {131}, number = {6}, pages = {1573-1580}, doi = {10.1007/s00414-017-1565-y}, pmid = {28314903}, issn = {1437-1596}, mesh = {Animals ; Birds ; Bone Marrow/pathology ; Brain/pathology ; Deer ; Diatoms/*isolation &amp; purification ; Drowning/*veterinary ; Forensic Pathology/*methods ; Hydrogen Peroxide ; Kidney/pathology ; Liver/pathology ; Lung/pathology ; Myocardium/pathology ; Otters ; Spleen/pathology ; }, abstract = {In this preliminary study, a digestive method used in forensic context to extract diatoms has been applied in organs taken from ten wildlife animals belonging three species of mammals (a deer, a roe and five otters) and one species of birds (two magpies). Only four carcasses were recovered from aquatic environments (bath trough for animals, bathtub irrigation, river) and only in three cases out of ten that the cause of death was ruled out as drowning. In seven cases, the death was due to other causes: gunshot injuries for one otter, blunt trauma for a magpie, and traumatic injuries followed by motor vehicle collision in other four otters and a roe. Post-mortem examination was performed in all carcasses. The diatom test protocol was performed according to the Italian guidelines for analysis of benthic diatoms for ecological status assessment of inland waters. Five grams of lung, liver, and kidney was taken from all the animal carcasses. In some cases, additional tissue samples were also available among which brain, heart, spleen, and bone marrow. In all four cases found in water, the drowning medium was also available. Hydrogen peroxide (H2O2) digestion was performed, and identification of 21 genera of diatoms was obtained. The method proved to be suitable for the identification of diatoms in the organs of the animals drowned supporting the final diagnosis of drowning. Only in otters, all died for causes other than drowning, diatoms did not prove to be suitable for the diagnosis of drowning since their presence in the internal organs was mainly related to their main diet based on fishmeal. The authors believe that this first trial is very promising, and the results suggest that diatom test can be easily applied in forensic veterinary context.}, }
@article {pmid28303393, year = {2017}, author = {Castro, J and Molina-Morales, M and Leverkus, AB and Martínez-Baroja, L and Pérez-Camacho, L and Villar-Salvador, P and Rebollo, S and Rey-Benayas, JM}, title = {Effective nut dispersal by magpies (Pica pica L.) in a Mediterranean agroecosystem.}, journal = {Oecologia}, volume = {184}, number = {1}, pages = {183-192}, doi = {10.1007/s00442-017-3848-x}, pmid = {28303393}, issn = {1432-1939}, mesh = {Animals ; Feeding Behavior ; *Nuts ; *Pica ; Rodentia ; Seed Dispersal ; Seeds ; }, abstract = {Scatter-hoarding animals such as corvids play a crucial role in the dispersal of nut-producing tree species. This interaction is well known for some corvids, but remains elusive for other species such as the magpie (Pica pica), an abundant corvid in agroecosystems and open landscapes of the Palearctic region. In addition, the establishment of the individual dispersed seeds-a prerequisite for determining seed-dispersal effectiveness-has never before been documented for the interaction between corvids and nut-producing trees. We analyzed walnut dispersal by magpies in an agroecosystem in southern Spain. We used several complementary approaches, including video recording nut removal from feeders, measuring dispersal distance using radio tracking (with radio transmitters placed inside nuts), and monitoring the fate of dispersed nuts to the time of seedling emergence. Magpies were shown to be highly active nut dispersers. The dispersal distance averaged 39.6 ± 4.5 m and ranged from 4.1 to 158.5 m. Some 90% of the removed walnuts were cached later, and most of these (98%) were buried in the soil or hidden under plant material. By the time of seedling emergence, ca. 33% of nuts remained at the caching location. Finally, 12% of the cached nuts germinated and 4% yielded an emerged seedling, facilitating the transition to the next regeneration stage. The results demonstrate for the first time that magpies can be an effective scatter-hoarding disperser of a nut-producing tree species, suggesting that this bird species may play a key role in the regeneration and expansion of broadleaf forests in Eurasia.}, }
@article {pmid28285083, year = {2017}, author = {Boucher, SC}, title = {Gould on species, metaphysics and macroevolution: A critical appraisal.}, journal = {Studies in history and philosophy of biological and biomedical sciences}, volume = {62}, number = {}, pages = {25-34}, doi = {10.1016/j.shpsc.2017.02.004}, pmid = {28285083}, issn = {1879-2499}, mesh = {*Biological Evolution ; History, 20th Century ; History, 21st Century ; Humans ; *Metaphysics ; Paleontology ; Philosophy ; United States ; }, abstract = {Stephen Jay Gould's views on the ontology of species were an important plank of his revisionist program in evolutionary theory. In this paper I cast a critical eye over those views. I focus on three central aspects of Gould's views on species: the relation between the Darwinian and the metaphysical notions of individuality, the relation between the ontology of species and macroevolution, and the issue of contextualism and conventionalism about the metaphysics of species.}, }
@article {pmid28276133, year = {2017}, author = {Jamborova, I and Dolejska, M and Zurek, L and Townsend, AK and Clark, AB and Ellis, JC and Papousek, I and Cizek, A and Literak, I}, title = {Plasmid-mediated resistance to cephalosporins and quinolones in Escherichia coli from American crows in the USA.}, journal = {Environmental microbiology}, volume = {19}, number = {5}, pages = {2025-2036}, doi = {10.1111/1462-2920.13722}, pmid = {28276133}, issn = {1462-2920}, mesh = {Animals ; Anti-Bacterial Agents ; Bacterial Proteins/*genetics ; Bird Diseases/microbiology ; Cefotaxime/*pharmacology ; Ciprofloxacin/*pharmacology ; Crows/*microbiology ; Electrophoresis, Gel, Pulsed-Field ; Escherichia coli/*drug effects/*genetics ; Escherichia coli Infections ; Escherichia coli Proteins/*genetics ; Humans ; Microbial Sensitivity Tests ; Multilocus Sequence Typing ; Plasmids/genetics ; United States ; beta-Lactamases/*genetics ; }, abstract = {American crow (Corvus brachyrhynchos) faeces were tested for Escherichia coli with plasmid-mediated quinolone resistance (PMQR), extended-spectrum beta-lactamases (ESBL) and AmpC beta-lactamases. A total of 590 faecal samples were collected at four roosting sites in the USA and cultivated on selective media. Pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST) were performed to assess clonality. Transferability of resistance genes was studied using conjugation and transformation bioassays. In total, 78 (13%, n = 590) cefotaxime-resistant isolates were obtained, of which 66 and 12 displayed AmpC and ESBL phenotypes, respectively. Fifty-four AmpC-producing isolates carried blaCMY-2 . Isolates producing ESBLs contained genes blaCTX-M-27 (5 isolates), blaCTX-M-15 (4), blaCTX-M-14 (2) and blaCTX-M-1 (1). Ninety isolates (15%, n = 590) with reduced susceptibility to ciprofloxacin were obtained, among which 14 harboured PMQR genes aac(6')-Ib-cr (4 isolates), qnrB19 (3), qnrS1 (2), qnrA1 (2), qnrB2 (1), qnrB6 (1) and qnrD3 (1). High genetic diversity was revealed by PFGE and MLST. Epidemiologically important E. coli clones (e.g., ST131, ST405) were identified. Plasmids carrying blaCMY-2 were assigned predominantly to IncA/C (8 plasmids), IncI1/ST23 (5) and IncI1/ST12 (3). The study demonstrates a widespread occurrence of E. coli with ESBL, AmpC and PMQR genes associated with clinically important multidrug-resistant clones and epidemic plasmids, in American crows.}, }
@article {pmid28275208, year = {2017}, author = {Fox, JW and Gutiérrez, JM}, title = {Understanding the Snake Venom Metalloproteinases: An Interview with Jay Fox and José María Gutiérrez.}, journal = {Toxins}, volume = {9}, number = {1}, pages = {}, doi = {10.3390/toxins9010033}, pmid = {28275208}, issn = {2072-6651}, mesh = {*Biomedical Research/history ; Career Choice ; History, 20th Century ; History, 21st Century ; Humans ; Metalloproteases/history/*metabolism ; Reptilian Proteins/history/*metabolism ; Snake Bites/*enzymology/history ; Snake Venoms/*enzymology/history ; }, abstract = {Jay W. Fox and José María Gutiérrez recently finished editing a Special Issue on the topic &quot;Snake Venom Metalloproteinases&quot; in Toxins. The Special Issue covers a wide range of topics, including the molecular evolution and structure of snake venom metalloproteinases (SVMPs), the mechanisms involved in the generation of diversity of SVMPs, the mechanism of action of SVMPs, and their role in the pathophysiology of envenomings, with implications for improving the therapy of envenomings. In this interview, we discussed with Jay W. Fox and José María Gutiérrez their research on the SVMPs and their perspectives on the future trends and challenges for studying snake venoms.}, }
@article {pmid28263620, year = {2017}, author = {Marhounová, L and Frynta, D and Fuchs, R and Landová, E}, title = {Object permanence in the food-storing coal tit (Periparus ater) and the non-storing great tit (Parus major): Is the mental representation required?.}, journal = {Journal of comparative psychology (Washington, D.C. : 1983)}, volume = {131}, number = {2}, pages = {115-127}, doi = {10.1037/com0000061}, pmid = {28263620}, issn = {1939-2087}, mesh = {Animals ; Coal ; Cognition/*physiology ; Feeding Behavior/*physiology ; *Food ; Passeriformes/*physiology ; Species Specificity ; }, abstract = {Object permanence is a cognitive ability that enables animals to mentally represent the continuous existence of temporarily hidden objects. Generally, it develops gradually through six qualitative stages, the evolution of which may be connected with some specific ecological and behavioral factors. In birds, the advanced object permanence skills were reported in several storing species of the Corvidae family. In order to test the association between food-storing and achieved performance within the stages, we compared food-storing coal tits (Periparus ater) and nonstoring great tits (Parus major) using an adapted version of Uzgiris &amp; Hunt's Scale 1 tasks. The coal tits significantly outperformed the great tits in searching for completely hidden objects. Most of the great tits could not solve the task when the object disappeared completely. However, the upper limit for both species is likely to be Stage 4. The coal tits could solve problems with simply hidden objects, but they used alternative strategies rather than mental representation when searching for completely hidden objects, especially if choosing between two locations. Our results also suggest that neophobia did not affect the overall performance in the object permanence tasks. (PsycINFO Database Record}, }
@article {pmid28261449, year = {2017}, author = {Meyrier, E and Jenni, L and Bötsch, Y and Strebel, S and Erne, B and Tablado, Z}, title = {Happy to breed in the city? Urban food resources limit reproductive output in Western Jackdaws.}, journal = {Ecology and evolution}, volume = {7}, number = {5}, pages = {1363-1374}, doi = {10.1002/ece3.2733}, pmid = {28261449}, issn = {2045-7758}, abstract = {Urban areas expand worldwide, transforming landscapes and creating new challenging habitats. Some bird species, mainly omnivorous feeding on human waste and cavity nesters, commonly breed in these habitats and are, therefore, regarded as urban-adapted. Although urban areas may provide new nesting sites and abundant human waste, the low breeding success found in some of these species suggests that the poor protein content in human waste might limit breeding parameters. We investigated whether the breeding success of a cavity nester and omnivorous species commonly breeding in urban areas, the Western Jackdaw (Corvus monedula), depended on the availability of good-quality non-urban food. We approached the objective by combining a literature review and experiments in the field. With the literature review, we compared jackdaw populations in different habitats across Europe and found that clutch size and number of fledglings per pair decreased with distance to non-urban foraging grounds, even after controlling for the effect of colony size, latitude, and climate. In two experiments, we tested whether the breeding success of urban pairs could be increased by supplementing high-quality food, first only during egg formation and second also until chick fledging. Food supplementation during egg formation led to larger eggs and higher hatching success than in urban control nests, but this did not result in higher chick survival. However, when food supplementation was prolonged until fledging in the second experiment, we observed a significant increase of nestling survival. These findings highlight that research and management actions should not only focus on species displaced by urbanization, but also on &quot;urban-adapted&quot; species, as they might be suffering from a mismatch between availability of nesting sites in buildings and adequate non-urban food resources. In these cases, nest sites should be provided in or close to adequate food resources.}, }
@article {pmid28260371, year = {2017}, author = {Olšovská, J and Matoulková, D and Dušek, M and Felsberg, J and Jelínková, M and Čejka, P and Štěrba, K}, title = {Analysis of 100-Year-Old Beer Originated from the Czech Republic.}, journal = {Journal of agricultural and food chemistry}, volume = {65}, number = {16}, pages = {3341-3350}, doi = {10.1021/acs.jafc.6b05706}, pmid = {28260371}, issn = {1520-5118}, mesh = {Acids/analysis ; Beer/*analysis/microbiology ; Czech Republic ; Dekkera/genetics/isolation &amp; purification/metabolism ; Fatty Acids/analysis ; Fermentation ; Flavoring Agents/analysis ; Food Handling ; Humans ; Time Factors ; }, abstract = {Three bottles of different beers were found in 2015 during a reconstruction of the brewery of the Raven Trading s.r.o. company in Záhlinice, Czech Republic. Thanks to good storage conditions, it was possible to analyze their original characteristics. All three bottles contained most probably lager type beer. One beer had sulfuric and fecal off-flavors; it was bright with the original extract of 10.3° Plato. The second beer, with an original extract of 7.6° Plato, was dark and very acidic, resembling Lambic. DNA analysis proved the presence of Dekkera bruxellensis, which corresponded to its chemical profile (total acidity, FAN, ethyl acetate, total esters). The third beer contained traces of carbon dioxide bubbles, was light brown and slightly bitter, with an original extract 10.4° Plato. Because it obviously underwent a natural aging process, sweetness, honey, and fruity off-flavors were detected and transformation products of iso-α-acids were found.}, }
@article {pmid28255565, year = {2017}, author = {Stone, AV and Mannava, S and Patel, A and Marquez-Lara, A and Freehill, MT}, title = {Defining the Long-Toss: A Professional Baseball Epidemiological Study.}, journal = {Orthopaedic journal of sports medicine}, volume = {5}, number = {2}, pages = {2325967116686773}, doi = {10.1177/2325967116686773}, pmid = {28255565}, issn = {2325-9671}, abstract = {BACKGROUND: Despite widespread use of long-toss throwing in baseball as a component of arm conditioning, interval throwing programs, and rehabilitation, long-toss distance and throwing mechanics remain controversial.<br><br>PURPOSE: To ascertain the perceived definition of long-toss throwing through a survey of professional pitchers, pitching coaches (PCs), and certified athletic trainers (ATCs) associated with Major League Baseball.<br><br>STUDY DESIGN: Descriptive epidemiology study.<br><br>METHODS: Pitchers, PCs, and ATCs associated with 5 Major League Baseball organizations completed an anonymous survey that collected demographic data, personal use of long-toss throwing, and their perception of the distance and throwing mechanics that comprised long-toss.<br><br>RESULTS: A total of 321 surveys were completed by 271 pitchers, 19 PCs, and 31 ATCs. For all respondents, the mean distance considered as long-toss was 175 ft (95% CI, 170-181 ft). Respondents categorized the throwing mechanics of long-toss, with 36% reporting throwing &quot;on a line&quot; and 70% reporting long-toss as &quot;not on a line.&quot; Of those throwing &quot;on a line,&quot; 28% reported using crow-hop footwork while 60% used crow-hop footwork when throwing &quot;not on a line.&quot; Interpretation of long-toss distance significantly varied by position: pitchers, 177 ft (95% CI, 171-183 ft); PCs, 177 ft (95% CI, 155-200 ft); and ATCs, 157 ft (95% CI, 144-169 ft) (P = .048). When asked when long-toss throwing is used, pitchers reported using it more frequently in preseason (P = .007), during the season (P = .015), and in the off-season (P = .002) compared with that by ATCs. Functional goals for long-toss throwing demonstrated that pitchers and PCs use long-toss for shoulder stretching more frequently than ATCs (P < .001 and P = .026, respectively). ATCs used long-toss more than pitchers for interval throwing programs (P < .001).<br><br>CONCLUSION: The definition varies for long-toss throwing distance and throwing mechanics. Pitchers and PCs believe that long-toss comprised longer distances than ATCs and employed long-toss differently for strength conditioning, training, stretching, and rehabilitation. This discrepancy highlights a potential lost opportunity for protecting the shoulder. While long-toss is an important tool, a more scientific definition is warranted to better elucidate its role in enhancing throwing performance and rehabilitation.}, }
@article {pmid28241283, year = {2017}, author = {Neumann, S and Salm, S and Rietz, C and Stenneken, P}, title = {The German Focus on the Outcomes of Communication Under Six (FOCUS-G): Reliability and Validity of a Novel Assessment of Communicative Participation.}, journal = {Journal of speech, language, and hearing research : JSLHR}, volume = {60}, number = {3}, pages = {675-681}, doi = {10.1044/2016_JSLHR-L-15-0219}, pmid = {28241283}, issn = {1558-9102}, mesh = {Child Behavior/psychology ; Child, Preschool ; *Communication ; Female ; Humans ; Language Development Disorders/*diagnosis ; Male ; Psychometrics ; Reproducibility of Results ; }, abstract = {Purpose: Our purpose was to explore the validity and reliability of the German Focus on the Outcomes of Communication Under Six (FOCUS-G; Thomas-Stonell, Oddson, Robertson, &amp; Rosenbaum, 2010, 2012), which is an authorized adaptation of the Focus on the Outcomes of Communication Under Six (Thomas-Stonell et al., 2010) tool, which measures communicative participation in preschool children.<br><br>Method: Parents of typically developing children (TDC) and of children with speech impairment (CSI) completed the FOCUS-G and the Questionnaire for Measuring Health-Related Quality of Life in Children (KiddyKINDL; Ravens-Sieberer &amp; Bullinger, 2000). To determine test-retest reliability, the FOCUS-G was readministered to a subsample of parents 1 week later.<br><br>Results: The FOCUS-G had high values for internal consistency (α = .959, Ω = .941), test-retest reliability (intraclass correlation coefficient = .974), and split-half reliability (r = .832). Total scores on the FOCUS-G and KiddyKINDL demonstrated significant associations. FOCUS-G total scores and subdomain scores for both samples showed significant correlations, indicating good construct validity. The discriminatory ability of the FOCUS-G was indicated by significantly higher mean scores for TDC (M = 6.03, SD = 0.65) than CSI (M = 5.47, SD = 1.02).<br><br>Conclusion: The overall good psychometric properties of this novel assessment of communicative participation support its use by speech-language pathologists for clinical and research purposes with German-speaking children.}, }
@article {pmid28239221, year = {2017}, author = {Munteanu, AM and Stocker, M and Stöwe, M and Massen, JJ and Bugnyar, T}, title = {Behavioural and Hormonal Stress Responses to Social Separation in Ravens, Corvus corax.}, journal = {Ethology : formerly Zeitschrift fur Tierpsychologie}, volume = {123}, number = {2}, pages = {123-135}, doi = {10.1111/eth.12580}, pmid = {28239221}, issn = {0179-1613}, abstract = {Social life is profitable, but it facilitates conflicts over resources and creates interdependence between individuals. Separating highly social animals triggers intense reactions aimed at re-establishing lost connections. Less is known, however, about behavioural and physiological responses to separation in socially facultative species, where individuals temporarily form groups and may subsequently leave them. Non-breeding common ravens (Corvus corax) gather in large numbers at feeding and roosting sites, but otherwise spend time seemingly solitary or in small subgroups. We here studied how ravens cope with being socially isolated, and investigated the life characteristics that might explain potential individual differences. For this, we individually separated captive subadult ravens (n = 25) and housed them in physical and visual isolation from their group members across 4 d. During the separation period, we collected behavioural data and measured the amount of immunoreactive corticosterone metabolites from bird droppings to assess the ravens' physiological stress response. We found behavioural indicators of stress at the start of the separation, when ravens showed higher levels of tension than of comfort - a pattern that reversed at the end of the separation. Furthermore, we found that the upbringing of ravens affected their behaviour during separation. Hand-raised birds produced more vocalisations in the beginning of the separation, and were less active at the end, while the reverse pattern occurred with parent-raised ravens. Contrary to our predictions, we did not find differences in hormonal responses between the beginning and end of the separation period or any link between hormonal responses and behaviours. Ravens' behavioural responses to social separation stress seem to be dependent on their arousal states, although possible links with hormonal reactions remain unclear. Our results show that behavioural reactions are not always linked with hormonal responses to stress, and further emphasise the importance of investigating effects of early-life experiences.}, }
@article {pmid28233773, year = {2017}, author = {Davidson, G and Miller, R and Loissel, E and Cheke, LG and Clayton, NS}, title = {Erratum: The development of support intuitions and object causality in juvenile Eurasian jays (Garrulus glandarius).}, journal = {Scientific reports}, volume = {7}, number = {}, pages = {42936}, doi = {10.1038/srep42936}, pmid = {28233773}, issn = {2045-2322}, }
@article {pmid28222237, year = {2017}, author = {Morinha, F and Dávila, JA and Bastos, E and Cabral, JA and Frías, Ó and González, JL and Travassos, P and Carvalho, D and Milá, B and Blanco, G}, title = {Extreme genetic structure in a social bird species despite high dispersal capacity.}, journal = {Molecular ecology}, volume = {26}, number = {10}, pages = {2812-2825}, doi = {10.1111/mec.14069}, pmid = {28222237}, issn = {1365-294X}, mesh = {Animals ; Behavior, Animal ; Gene Flow ; Genetic Drift ; *Genetic Variation ; *Genetics, Population ; Microsatellite Repeats ; Passeriformes/*genetics ; *Social Behavior ; Spain ; }, abstract = {Social barriers have been shown to reduce gene flow and contribute to genetic structure among populations in species with high cognitive capacity and complex societies, such as cetaceans, apes and humans. In birds, high dispersal capacity is thought to prevent population divergence unless major geographical or habitat barriers induce isolation patterns by dispersal, colonization or adaptation limitation. We report that Iberian populations of the red-billed chough, a social, gregarious corvid with high dispersal capacity, show a striking degree of genetic structure composed of at least 15 distinct genetic units. Monitoring of marked individuals over 30 years revealed that long-distance movements over hundreds of kilometres are common, yet recruitment into breeding populations is infrequent and highly philopatric. Genetic differentiation is weakly related to geographical distance, and habitat types used are overall qualitatively similar among regions and regularly shared by individuals of different populations, so that genetic structure is unlikely to be due solely to isolation by distance or isolation by adaptation. Moreover, most population nuclei showed relatively high levels of genetic diversity, suggesting a limited role for genetic drift in significantly differentiating populations. We propose that social mechanisms may underlie this unprecedented level of genetic structure in birds through a pattern of isolation by social barriers not yet described, which may have driven this remarkable population divergence in the absence of geographical and environmental barriers.}, }
@article {pmid28220657, year = {2017}, author = {Thomas-Bachli, AL and Pearl, DL and Berke, O and Parmley, EJ and Barker, IK}, title = {A geographic study of West Nile virus in humans, dead corvids and mosquitoes in Ontario using spatial scan statistics with a survival time application.}, journal = {Zoonoses and public health}, volume = {64}, number = {7}, pages = {e81-e89}, doi = {10.1111/zph.12350}, pmid = {28220657}, issn = {1863-2378}, mesh = {Animals ; Bird Diseases ; Crows/*virology ; Culicidae/*virology ; Epidemiological Monitoring ; Geographic Mapping ; Humans ; Ontario/epidemiology ; West Nile Fever/*epidemiology/virology ; West Nile virus/*isolation &amp; purification ; }, abstract = {Surveillance of West Nile virus (WNv) in Ontario has included passive reporting of human cases and testing of trapped mosquitoes and dead birds found by the public. The dead bird surveillance programme was limited to testing within a public health unit (PHU) until a small number of birds test positive. These dead corvid and mosquito surveillance programmes have not been compared for their ability to provide early warning in geographic areas where human cases occur each year. Spatial scan statistics were applied to time-to-event survival data based on first cases of WNv in found dead corvids, mosquitoes and humans. Clusters identified using raw data were compared to clusters based on model-adjusted survival times to evaluate whether geographic and sociodemographic factors influenced their distribution. Statistically significant (p < .05) space-time clusters of PHUs with faster time to detection were found using each surveillance data stream. During 2002-2004, the corvid surveillance programme outperformed the mosquito programme in terms of time to WNv detection, while the clusters of first-positive mosquito pools were more spatially similar to first human cases. In 2006, a cluster of first-positive dead corvids was located in northern PHUs and preceded a cluster of early human cases that was identified after controlling for the influence of geographic region and sociodemographic profile.}, }
@article {pmid28214810, year = {2016}, author = {Пятакова, ГВ and Лебедева, ЕИ and Потявина, ВВ and Церфус, ДН}, title = {[Age specific and individual psychological factors of post--traumatic stress (PTS) development of children with after-effects of physical damages indicating medical rehabilitation].}, journal = {Wiadomosci lekarskie (Warsaw, Poland : 1960)}, volume = {69}, number = {6}, pages = {750-757}, pmid = {28214810}, issn = {0043-5147}, mesh = {Adolescent ; Age Factors ; Child ; Female ; Humans ; Male ; Parents ; Stress Disorders, Post-Traumatic/*etiology ; Surveys and Questionnaires ; Wounds and Injuries/complications/*psychology ; }, abstract = {INTRODUCTION: children and teenagers having received hard physical damages face a difficult life situation which includes events accompanied by feeling of intensive fear and helplessness. Every child's individual psychological features play an important role in coping with negative psychological after-effects of his/her physical trauma.<br><br>AIM: learning PTS manifestations among children and teenagers with hard physical damages indicating medical rehabilitation.<br><br>MATERIALS AND METHODS: patients of the traumatological department of children's surgery clinic took part in the research: 31 preadolescent children and their parents, 45 teengaers and their parents. Physical damages were received by children clinic's patients in accidents and out of negligence. A survey containing clinical and historical method elements, medical documents; semi-structured interviews for identification of signs of children's post-traumatic stress, a survey for parents for identification of children's traumatic experience, colour matrices and J. Raven black-and-white matrices, S. Rosenzweig frustration tolerance methods (children's and adult version) were used as certain research methods.<br><br>RESULTS: it was shown that intellectual productivity showings and stable ways of emotional reaction can act as individual psychological factos of PTS development. Age specifics of embeddedness of intellectual features and stable ways of emotional reaction to PTS symptoms development among children and teenagers with hard physical damages.<br><br>CONCLUSIONS: the received results can be used as a base for developing specific approaches for psychological support of children and teenagers having the experience of physical damage and difficult medical rehabilitation.}, }
@article {pmid28211915, year = {2017}, author = {Hirano, Y and Nakagawa, M and Suyama, T and Murase, K and Shirakawa, M and Takayama, S and Sun, TP and Hakoshima, T}, title = {Structure of the SHR-SCR heterodimer bound to the BIRD/IDD transcriptional factor JKD.}, journal = {Nature plants}, volume = {3}, number = {}, pages = {17010}, doi = {10.1038/nplants.2017.10}, pmid = {28211915}, issn = {2055-0278}, support = {R01 GM100051/GM/NIGMS NIH HHS/United States ; }, mesh = {Arabidopsis/*genetics/metabolism ; Arabidopsis Proteins/chemistry/*genetics/metabolism ; Carrier Proteins/chemistry/*genetics/metabolism ; Transcription Factors/chemistry/*genetics/metabolism ; }, abstract = {The plant-specific GAI, RGA and SCR (GRAS) family proteins play critical roles in plant development and signalling. Two GRAS proteins, SHORT-ROOT (SHR) and SCARECROW (SCR), cooperatively direct asymmetric cell division and the patterning of root cell types by transcriptional control in conjunction with BIRD/INDETERMINATE DOMAIN (IDD) transcription factors, although precise details of these specific interactions and actions remain unknown. Here, we present the crystal structures of the SHR-SCR binary and JACKDAW (JKD)/IDD10-SHR-SCR ternary complexes. Each GRAS domain comprises one α/β core subdomain with an α-helical cap that mediates heterodimerization by forming an intermolecular helix bundle. The α/β core subdomain of SHR forms the BIRD binding groove, which specifically recognizes the zinc fingers of JKD. We identified a conserved SHR-binding motif in 13 BIRD/IDD transcription factors. Our results establish a structural basis for GRAS-GRAS and GRAS-BIRD interactions and provide valuable clues towards our understanding of these regulators, which are involved in plant-specific signalling networks.}, }
@article {pmid28202815, year = {2017}, author = {Dutoit, L and Vijay, N and Mugal, CF and Bossu, CM and Burri, R and Wolf, J and Ellegren, H}, title = {Covariation in levels of nucleotide diversity in homologous regions of the avian genome long after completion of lineage sorting.}, journal = {Proceedings. Biological sciences}, volume = {284}, number = {1849}, pages = {}, doi = {10.1098/rspb.2016.2756}, pmid = {28202815}, issn = {1471-2954}, mesh = {Animals ; Crows/*genetics ; Evolution, Molecular ; *Genome ; Karyotype ; Nucleotides/*genetics ; Recombination, Genetic ; Songbirds/*genetics ; Synteny ; }, abstract = {Closely related species may show similar levels of genetic diversity in homologous regions of the genome owing to shared ancestral variation still segregating in the extant species. However, after completion of lineage sorting, such covariation is not necessarily expected. On the other hand, if the processes that govern genetic diversity are conserved, diversity may potentially covary even among distantly related species. We mapped regions of conserved synteny between the genomes of two divergent bird species-collared flycatcher and hooded crow-and identified more than 600 Mb of homologous regions (66% of the genome). From analyses of whole-genome resequencing data in large population samples of both species we found nucleotide diversity in 200 kb windows to be well correlated (Spearman's ρ = 0.407). The correlation remained highly similar after excluding coding sequences. To explain this covariation, we suggest that a stable avian karyotype and a conserved landscape of recombination rate variation render the diversity-reducing effects of linked selection similar in divergent bird lineages. Principal component regression analysis of several potential explanatory variables driving heterogeneity in flycatcher diversity levels revealed the strongest effects from recombination rate variation and density of coding sequence targets for selection, consistent with linked selection. It is also possible that a stable karyotype is associated with a conserved genomic mutation environment contributing to covariation in diversity levels between lineages. Our observations imply that genetic diversity is to some extent predictable.}, }
@article {pmid28199765, year = {2017}, author = {Perec-Matysiak, A and Wesołowska, M and Leśniańska, K and Buńkowska-Gawlik, K and Hildebrand, J and Kicia, M}, title = {Survey for Zoonotic Microsporidian Pathogens in Wild Living Urban Rooks (Corvus frugilegus).}, journal = {The Journal of eukaryotic microbiology}, volume = {64}, number = {5}, pages = {721-724}, doi = {10.1111/jeu.12402}, pmid = {28199765}, issn = {1550-7408}, mesh = {Animals ; Crows/*microbiology ; DNA, Fungal/genetics ; DNA, Ribosomal/*genetics ; Feces/microbiology ; Genotype ; Microsporidia/*classification/genetics ; Phylogeny ; Poland ; Polymerase Chain Reaction ; }, abstract = {Microsporidia are opportunistic pathogens in nature infecting all animal phyla. There is a potential risk of microsporidian spores transmission from urban rooks inhabiting some metropolitan cities to people through casual interactions. The aim of this study was to identify microsporidia species in the droppings of rooks in Wroclaw, Poland. A total of 15 collective sets of droppings were examined using nested-PCR method. Amplification of ITS rRNA gene revealed the presence of Enterocytozoon bieneusi D, Peru 6, and Encephalitozoon hellem 1A genotypes. This study indicates that excreta of urban rooks can be an important source of human infection with these pathogens.}, }
@article {pmid28192043, year = {2017}, author = {West, E and Hofmeister, E and Peery, MZ}, title = {Serosurvey for West Nile Virus Antibodies in Steller's Jays (Cyanocitta stelleri) Captured in Coastal California, USA.}, journal = {Journal of wildlife diseases}, volume = {53}, number = {3}, pages = {582-585}, doi = {10.7589/2016-06-139}, pmid = {28192043}, issn = {1943-3700}, mesh = {Animals ; Bird Diseases ; Birds/*virology ; California ; Canada ; Mexico ; New York ; West Nile Fever/*veterinary ; West Nile virus/*isolation &amp; purification ; }, abstract = {West Nile virus (WNV) was first detected in New York in 1999 and, during its expansion across the continental US, southern Canada, and Mexico, members of the Corvidae (ravens, crows, magpies, and jays) were frequently infected and highly susceptible to the virus. As part of a behavioral study of Steller's Jays (Cyanocitta stelleri) conducted from 2011-14 in the coastal California counties of San Mateo and Santa Cruz, 380 Steller's Jays were captured and tested for antibodies to WNV. Using the wild bird immunoglobulin G enzyme linked immunoassay, we failed to detect antibodies to WNV, indicating either that there was no previous exposure to the virus or that exposed birds had died.}, }
@article {pmid28189590, year = {2017}, author = {Small, TW and Bebus, SE and Bridge, ES and Elderbrock, EK and Ferguson, SM and Jones, BC and Schoech, SJ}, title = {Stress-responsiveness influences baseline glucocorticoid levels: Revisiting the under 3min sampling rule.}, journal = {General and comparative endocrinology}, volume = {247}, number = {}, pages = {152-165}, doi = {10.1016/j.ygcen.2017.01.028}, pmid = {28189590}, issn = {1095-6840}, mesh = {Animals ; Corticosterone/blood ; Female ; Glucocorticoids/*pharmacology ; Linear Models ; Male ; *Models, Biological ; Passeriformes/blood/*physiology ; Phenotype ; Statistics, Nonparametric ; Stress, Physiological/*drug effects/physiology ; }, abstract = {Plasma glucocorticoid (CORT) levels collected within 3min of capture are commonly believed to reflect pre-stressor, baseline CORT levels. Differences in these &quot;baseline&quot; values are often interpreted as reflecting differences in health, or the amount of social and environmental stress recently experienced by an individual. When interpreting &quot;baseline&quot; values it is generally assumed that any effect of capture-and-handling during the initial sampling period is small enough and consistent enough among individuals to not obscure pre-capture differences in CORT levels. However, plasma CORT increases in less than 3min post-capture in many free-living, endothermic species in which timing has been assessed. In addition, the rate of CORT secretion and the maximum level attained (i.e., the degree of stress-responsiveness) during a severe stressor often differs among individuals of the same species. In Florida scrub-jays (Aphelocoma coerulescens), an individual's stress-responsiveness during a 30min post-capture stressor is correlated with CORT levels in samples collected within 1.5min of capture, suggesting there is an intrinsic connection between stress-responsiveness and pre-capture CORT levels. Although differences in stress-responsiveness accounted for just 11% of the variance in these samples, on average, higher stress-responsive jays (top third of individuals) had baseline values twice that of lower stress-responsive jays (bottom third). Further, plasma CORT levels begin to increase around 2min post-capture in this species, but the rate of increase between 2 and 3min differs markedly with CORT increasing more rapidly in jays with higher stress-responsiveness. Together, these data indicate that baseline CORT values can be influenced by an individual's stress response phenotype and the differences due to stress-responsiveness can be exaggerated during sample collection. In some cases, the effects of differences in stress-responsiveness and the increase in CORT during sample collection could obscure, or supersede, differences in pre-capture plasma CORT levels that are caused by extrinsic factors.}, }
@article {pmid28163873, year = {2017}, author = {KleinHeerenbrink, M and Hedenström, A}, title = {Wake analysis of drag components in gliding flight of a jackdaw (Corvus monedula) during moult.}, journal = {Interface focus}, volume = {7}, number = {1}, pages = {20160081}, doi = {10.1098/rsfs.2016.0081}, pmid = {28163873}, issn = {2042-8898}, abstract = {To maintain the quality of the feathers, birds regularly undergo moult. It is widely accepted that moult affects flight performance, but the specific aerodynamic consequences have received relatively little attention. Here we measured the components of aerodynamic drag from the wake behind a gliding jackdaw (Corvus monedula) at different stages of its natural wing moult. We found that span efficiency was reduced (lift induced drag increased) and the wing profile drag coefficient was increased. Both effects best correlated with the corresponding reduction in spanwise camber. The negative effects are partially mitigated by adjustments of wing posture to minimize gaps in the wing, and by weight loss to reduce wing loading. By studying the aerodynamic consequences of moult, we can refine our understanding of the emergence of various moulting strategies found among birds.}, }
@article {pmid28151701, year = {2017}, author = {Wright, AA and Magnotti, JF and Katz, JS and Leonard, K and Vernouillet, A and Kelly, DM}, title = {Corvids Outperform Pigeons and Primates in Learning a Basic Concept.}, journal = {Psychological science}, volume = {28}, number = {4}, pages = {437-444}, doi = {10.1177/0956797616685871}, pmid = {28151701}, issn = {1467-9280}, mesh = {Animals ; Behavior, Animal/*physiology ; Concept Formation/*physiology ; Female ; Male ; Passeriformes/*physiology ; Species Specificity ; }, abstract = {Corvids (birds of the family Corvidae) display intelligent behavior previously ascribed only to primates, but such feats are not directly comparable across species. To make direct species comparisons, we used a same/different task in the laboratory to assess abstract-concept learning in black-billed magpies (Pica hudsonia). Concept learning was tested with novel pictures after training. Concept learning improved with training-set size, and test accuracy eventually matched training accuracy-full concept learning-with a 128-picture set; this magpie performance was equivalent to that of Clark's nutcrackers (a species of corvid) and monkeys (rhesus, capuchin) and better than that of pigeons. Even with an initial 8-item picture set, both corvid species showed partial concept learning, outperforming both monkeys and pigeons. Similar corvid performance refutes the hypothesis that nutcrackers' prolific cache-location memory accounts for their superior concept learning, because magpies rely less on caching. That corvids with &quot;primitive&quot; neural architectures evolved to equal primates in full concept learning and even to outperform them on the initial 8-item picture test is a testament to the shared (convergent) survival importance of abstract-concept learning.}, }
@article {pmid28145581, year = {2017}, author = {Laiolo, P}, title = {Phenotypic similarity in sympatric crow species: Evidence of social convergence?.}, journal = {Evolution; international journal of organic evolution}, volume = {71}, number = {4}, pages = {1051-1060}, doi = {10.1111/evo.13195}, pmid = {28145581}, issn = {1558-5646}, mesh = {*Animal Communication ; Animals ; *Biological Evolution ; Crows/*anatomy &amp; histology/*physiology ; Phenotype ; Phylogeny ; Social Behavior ; *Sympatry ; }, abstract = {Crows, rooks, and ravens (Corvus spp.) display marked morphological and voice similarities that have been hypothesized to stem from competitive interactions, as a case of nonaposematic mimicry. Here, I test predictions of the mimicry hypothesis at the macrovolutionary scale, examining whether species morphological and acoustic traits covary with those of coexisting congeners, and whether phenotypic similarity has facilitated the coexistence of related species after secondary contact. Body size and the temporal patterns of the commonest call display high levels of similarity among sympatric species, even after controlling for the effect of shared climate and habitat, and phylogenetic constraints in the production of variation. When sister species differed in these acoustic and morphological traits, their transition to secondary sympatry was delayed relative to those with more similar traits. No similarity was found in the sexual call of crows, suggesting that convergence occurs only when function does not favour maintenance of species-specific traits. Crow similarities in morphological and acoustic features may therefore be associated with coevolving interactions with congeners, in line with a broad array of studies documenting convergence among species that interact aggressively or forage communally.}, }
@article {pmid29693817, year = {2017}, author = {Washio, Y and Frederick, J and Archibald, A and Bertram, N and Crowe, JA}, title = {Community-I nitiated Pilot Program &quot;My Baby's Breath&quot; to Reduce Prenatal Alcohol Use.}, journal = {Delaware medical journal}, volume = {89}, number = {2}, pages = {46-51}, pmid = {29693817}, issn = {0011-7781}, mesh = {Alcohol Drinking/*prevention &amp; control ; Community Health Services ; Female ; Fetal Alcohol Spectrum Disorders/*prevention &amp; control ; *Health Education ; Humans ; Pilot Projects ; *Pregnancy ; Pregnancy Complications/*prevention &amp; control ; United States ; }, abstract = {Prenatal alcohol use puts mothers and their children at risk for complications during pregnancy, birth, and the neonatal periods. This paper describes a currently implemented community-based pilot program to reduce drinking among pregnant mothers. The program has worked in collaboration with case managers from Crow Wing County Social Services. Participants were required to provide daily breath samples with monetary incentives on alcohol-negative sample submissions. The program has treated four pregnant mothers so far, with an average of 94 percent compliance rate and no alcohol-positive breath samples. Future planned adjustments include using a remotely reloadlable debit card to reinforce daily sample submission, switching to completely random monitoring schedules to avoid falsenegative results, and expanding the program service in other counties. The community-based program using mobile technology has promise to increase opportunities to reinforce healthy lifestyle during pregnancy.}, }
@article {pmid28135017, year = {2017}, author = {Griesser, M and Wagner, GF and Drobniak, SM and Ekman, J}, title = {Reproductive trade-offs in a long-lived bird species: condition-dependent reproductive allocation maintains female survival and offspring quality.}, journal = {Journal of evolutionary biology}, volume = {30}, number = {4}, pages = {782-795}, doi = {10.1111/jeb.13046}, pmid = {28135017}, issn = {1420-9101}, mesh = {Animals ; Breeding ; *Clutch Size ; Female ; *Passeriformes ; Predatory Behavior ; *Reproduction ; }, abstract = {Life history theory is an essential framework to understand the evolution of reproductive allocation. It predicts that individuals of long-lived species favour their own survival over current reproduction, leading individuals to refrain from reproducing under harsh conditions. Here we test this prediction in a long-lived bird species, the Siberian jay Perisoreus infaustus. Long-term data revealed that females rarely refrain from breeding, but lay smaller clutches in unfavourable years. Neither offspring body size, female survival nor offspring survival until the next year was influenced by annual condition, habitat quality, clutch size, female age or female phenotype. Given that many nests failed due to nest predation, the variance in the number of fledglings was higher than the variance in the number of eggs and female survival. An experimental challenge with a novel pathogen before egg laying largely replicated these patterns in two consecutive years with contrasting conditions. Challenged females refrained from breeding only in the unfavourable year, but no downstream effects were found in either year. Taken together, these findings demonstrate that condition-dependent reproductive allocation may serve to maintain female survival and offspring quality, supporting patterns found in long-lived mammals. We discuss avenues to develop life history theory concerning strategies to offset reproductive costs.}, }
@article {pmid28132659, year = {2017}, author = {Mitra, S and Sarkar, N and Barik, A}, title = {Long-chain alkanes and fatty acids from Ludwigia octovalvis weed leaf surface waxes as short-range attractant and ovipositional stimulant to Altica cyanea (Weber) (Coleoptera: Chrysomelidae).}, journal = {Bulletin of entomological research}, volume = {107}, number = {3}, pages = {391-400}, doi = {10.1017/S0007485316001012}, pmid = {28132659}, issn = {1475-2670}, mesh = {Alkanes/*pharmacology ; Animals ; *Chemotaxis ; Coleoptera/*physiology ; Fatty Acids/*pharmacology ; Female ; Olfactometry ; Onagraceae/*chemistry ; Oviposition/*drug effects ; Plant Extracts/pharmacology ; Plant Leaves/chemistry ; Weed Control ; }, abstract = {The importance of leaf surface wax compounds from the rice-field weed Ludwigia octovalvis (Jacq.) Raven (Onagraceae) was determined in the flea beetle Altica cyanea (Weber) (Coleoptera: Chrysomelidae). Extraction, thin layer chromatography and GC-MS and GC-FID analyses of surface waxes of young, mature and senescent leaves revealed 20, 19 and 19 n-alkanes between n-C15 and n-C35, respectively; whereas 14, 14 and 12 free fatty acids between C12:0 and C22:0 fatty acids were identified in young, mature and senescent leaves, respectively. Tricosane was predominant n-alkane in young and mature leaves, whilst eicosane predominated in senescent leaves. Heneicosanoic acid, palmitic acid and docosanoic acid were the most abundant free fatty acids in young, mature and senescent leaves, respectively. A. cyanea females showed attraction to 0.25 mature leaf equivalent surface waxes compared with young or senescent leaves in a short glass Y-tube olfactometer bioassay. The insects were attracted to a synthetic blend of 0.90, 1.86, 1.83, 1.95, 0.50 and 0.18 µg ml-1 petroleum ether of hexadecane, octadecane, eicosane, tricosane, palmitic acid and alpha-linolenic acid, respectively, comparable with the proportions as present in 0.25 mature leaf equivalent surface waxes. A. cyanea also laid eggs on a filter paper moistened with 0.25 mature leaf equivalent surface waxes or a synthetic blend of 0.90, 1.86, 1.83, 1.95, 0.50 and 0.18 µg ml-1 petroleum ether of hexadecane, octadecane, eicosane, tricosane, palmitic acid and alpha-linolenic acid, respectively. This finding could provide a basis for monitoring of the potential biocontrol agent in the field.}, }
@article {pmid28130669, year = {2017}, author = {Mutafchiev, Y and Mariaux, J and Georgiev, BB}, title = {Description of Acuaria europaea n. sp. (Spirurida: Acuariidae) from Dendrocopos syriacus (Hemprich &amp; Ehrenberg) and Oriolus oriolus (L.) (Aves) in Europe, with results of re-examination of related European species of Acuaria Bremser, 1811.}, journal = {Systematic parasitology}, volume = {94}, number = {2}, pages = {201-214}, doi = {10.1007/s11230-016-9695-z}, pmid = {28130669}, issn = {1573-5192}, mesh = {Animals ; Europe ; Female ; Male ; Passeriformes/*parasitology ; Species Specificity ; Spirurida/anatomy &amp; histology/*classification ; }, abstract = {Acuaria europaea n. sp. is described from one Dendrocopos syriacus (Hemprich &amp; Ehrenberg) (Piciformes: Picidae) (type-host) and three Oriolus oriolus (L.) (Passeriformes: Oriolidae) in Bulgaria (type-locality) and France. The new species is characterised by cordons extending slightly beyond the level of the anterior end of the glandular oesophagus, left spicule 297 µm long, right spicule 155 µm long, protruding vulvar region and strongly ventrally curved female tail. The male (holotype) and the female (allotype) of A. parorioli Chabaud &amp; Petter, 1961 from O. oriolus are regarded as not being conspecific based on the differing morphology of their cordons; the female is identified as A. europaea n. sp. The type-material of Acuaria attenuata (Rudolphi, 1819) is redescribed. The species is characterised by a small and delicate body, cordons extending beyond the oesophago-intestinal junction and similar spicules in size and shape, 140 µm long. The only type-material of Acuaria anthuris (Rudolphi, 1819) available for examination consists of a male and a female (syntypes) from O. oriolus. The two specimens differ from one another by the relative lengths of their cordons and we consider them as belonging to two species. However, both type-specimens differ in their much shorter cordons from the species of Acuaria parasitising Corvidae. The present study reveals that the original description of A. anthuris has been based on heterogeneous material.}, }
@article {pmid28123676, year = {2016}, author = {Yang, Z and Li, X and Liao, H and Hu, L and Zhang, Z and Zhao, B and Huang, X and Bao, Z}, title = {Physical mapping of immune-related genes in Yesso scallop (Patinopecten yessoensis) using fluorescent in situ hybridization.}, journal = {Comparative cytogenetics}, volume = {10}, number = {4}, pages = {529-541}, doi = {10.3897/CompCytogen.v10i4.10047}, pmid = {28123676}, issn = {1993-0771}, abstract = {The innate immune system plays a pivotal role in defending invasion of microorganisms for scallops. Previous studies on immune-related genes in the Yesso scallop, Patinopecten yessoensis (Jay, 1857) have mainly focused on characterization and expression pattern in response to bacterial challenge, no research has been carried out on the cytogenetic level yet. In the present study, eight fosmid clones containing the sequences of key immune-related genes (PyNFkB, PyTRAF2, PyTRAF4, PyTRAF7, PyMyd88-1, PyMyd88-3, PyMKK-7 and PyTNFR) were isolated and seven of them were successfully mapped on chromosomes of Patinopecten yessoensis utilizing fluorescence in situ hybridization. Wherein, PyMyd88-1, PyMyd88-3 and PyMKK-7 located on the same chromosome pair with adjacent positions and the other genes were mapped on four non-homologous chromosome pairs, showing a similar distribution to another five model species. The isolation and mapping of such genes of the Yesso scallop will lay a foundation for studies such as assignment of interested genes to chromosomes, construction cytogenetic maps and so on.}, }
@article {pmid28120800, year = {2016}, author = {Horn, L and Scheer, C and Bugnyar, T and Massen, JJ}, title = {Proactive prosociality in a cooperatively breeding corvid, the azure-winged magpie (Cyanopica cyana).}, journal = {Biology letters}, volume = {12}, number = {10}, pages = {}, doi = {10.1098/rsbl.2016.0649}, pmid = {28120800}, issn = {1744-957X}, mesh = {Animals ; Behavior, Animal ; Cooperative Behavior ; Motivation ; Passeriformes/*physiology ; *Social Behavior ; }, abstract = {One of the contemporary hypotheses concerning the evolution of human altruism is the cooperative breeding hypothesis (CBH) which has recently been tested in non-human primates. Using a similar paradigm, we investigated prosociality in a cooperatively breeding corvid, the azure-winged magpie. We found that the magpies delivered food to their group members at high rates, and unlike other corvids, they did so without any cues provided by others. In two control conditions, the magpies stopped participating over time, indicating that they learned to discriminate prosocial tests from controls. Azure-winged magpies are thus the first birds that experimentally show proactive prosociality. Our findings are in line with the CBH; however, additional corvid species need to be tested in this promising paradigm.}, }
@article {pmid28118584, year = {2017}, author = {Ostojić, L and Legg, EW and Brecht, KF and Lange, F and Deininger, C and Mendl, M and Clayton, NS}, title = {Current desires of conspecific observers affect cache-protection strategies in California scrub-jays and Eurasian jays.}, journal = {Current biology : CB}, volume = {27}, number = {2}, pages = {R51-R53}, doi = {10.1016/j.cub.2016.11.020}, pmid = {28118584}, issn = {1879-0445}, mesh = {Animals ; *Feeding Behavior ; Mental Recall ; *Motivation ; Passeriformes/classification/*physiology ; *Social Behavior ; }, abstract = {Many corvid species accurately remember the locations where they have seen others cache food, allowing them to pilfer these caches efficiently once the cachers have left the scene [1]. To protect their caches, corvids employ a suite of different cache-protection strategies that limit the observers' visual or acoustic access to the cache site [2,3]. In cases where an observer's sensory access cannot be reduced it has been suggested that cachers might be able to minimise the risk of pilfering if they avoid caching food the observer is most motivated to pilfer [4]. In the wild, corvids have been reported to pilfer others' caches as soon as possible after the caching event [5], such that the cacher might benefit from adjusting its caching behaviour according to the observer's current desire. In the current study, observers pilfered according to their current desire: they preferentially pilfered food that they were not sated on. Cachers adjusted their caching behaviour accordingly: they protected their caches by selectively caching food that observers were not motivated to pilfer. The same cache-protection behaviour was found when cachers could not see on which food the observers were sated. Thus, the cachers' ability to respond to the observer's desire might have been driven by the observer's behaviour at the time of caching.}, }
@article {pmid28107074, year = {2016}, author = {Hassanpour, H and Dehkordi, HA and Khosravi, M and Soltani, S and Nasiri, L}, title = {Analysis of the Normal Electrocardiogram in Wild Rooks (Corvus frugilegus).}, journal = {Journal of avian medicine and surgery}, volume = {30}, number = {4}, pages = {329-334}, doi = {10.1647/2015-079}, pmid = {28107074}, issn = {1082-6742}, mesh = {Animals ; Animals, Wild/*physiology ; Electrocardiography/*veterinary ; Female ; Male ; Songbirds/*physiology ; }, abstract = {To describe the normal electrocardiographic (ECG) patterns and values in unanesthetized rooks (Corvus frugilegus), standard bipolar (I, II, and III) and augmented unipolar limb (aVR, aVL, and aVF) lead ECGs were recorded from 10 clinically healthy wild rooks. Wave forms were analyzed in all leads at 50 mm/s and at 10 mm = 1 mV to determine PR, QRS, ST, and QT durations; the net QRS complex; and P and T amplitudes. The polarity of each waveform was tabulated in all leads. The mean electrical axis (MEA) for the frontal plane was counted by using leads II and III. The mean heart rate was 340 ± 18 beats/min. The P wave was mainly positive in the most leads. The dominant pattern of waveforms of the QRS complexes was QS in leads II, III, and aVF, whereas in leads aVR and aVL, the patterns were rS and R, respectively. The T wave was positive in leads II, III, aVF, and aVL and negative in lead aVR. The mean of the heart MEA was -93 ± 2.2. Interpretation of the ECG values and patterns in rooks may facilitate a better realization of ECG changes of abnormalities in this species.}, }
@article {pmid28099075, year = {2017}, author = {Ziegler, L and Palau-Ribes, FM and Schmidt, L and Lierz, M}, title = {OCCURRENCE AND RELEVANCE OF MYCOPLASMA STURNI IN FREE-RANGING CORVIDS IN GERMANY.}, journal = {Journal of wildlife diseases}, volume = {53}, number = {2}, pages = {228-234}, doi = {10.7589/2015-12-350}, pmid = {28099075}, issn = {1943-3700}, mesh = {Animals ; *Bird Diseases ; Birds/*virology ; Germany ; Mycoplasma/*isolation &amp; purification ; Mycoplasma Infections ; Polymerase Chain Reaction ; }, abstract = {Several Mycoplasma spp. are well-known pathogens in poultry. In birds of prey, White Storks (Ciconia ciconia), and some waterfowl (Anatidae, Pelecanidae) species, mycoplasmas occur commonly and seem to be apathogenic or commensal and most likely belong to the physiologic microbial flora of the respiratory tract. In other bird species, such as Common Nightingales (Luscinia megarhynchos) and tits (Paridae), Mycoplasma spp. are absent in healthy birds. In corvids, the prevalence and role of Mycoplasma spp. in disease remains unclear. In previous studies, Mycoplasma sturni was detected in diseased corvids; however, those studies included only a limited sample size or preselected individuals. We collected tracheal swabs of 97 free-ranging Corvidae, including 68 randomly selected individuals from hunting bags and 29 birds that had been admitted to a veterinary clinic. Tracheal swabs were examined for Mycoplasma spp. using culture and genus-specific PCR. If Mycoplasma spp. were detected, the species were identified by sequencing the 16S ribosomal (r) RNA gene and 16-23S rRNA intergenic transcribed spacer region. Five of 68 (7%) of the hunted birds and nine of 29 (31%) of the birds admitted to the veterinary clinic were PCR positive. In 13 of 14 PCR-positive samples, mycoplasmas were cultured and M. sturni was the only mycoplasmal species identified. None of the positive corvids from the hunting bags had clinical signs, whereas five of nine birds admitted to the veterinary clinic showed apathy, lameness, injuries, or fractures, which may not be associated with mycoplasmal infections. These data support the notion that M. sturni is the Mycoplasma sp. most frequently found in corvids, though its prevalence and ability to cause disease may involve interaction with other aspects of bird health.}, }
@article {pmid28093026, year = {2017}, author = {Salter, PS and Kelley, NJ and Molina, LE and Thai, LT}, title = {Out of sight, out of mind: racial retrieval cues increase the accessibility of social justice concepts.}, journal = {Memory (Hove, England)}, volume = {25}, number = {8}, pages = {1139-1147}, doi = {10.1080/09658211.2016.1274037}, pmid = {28093026}, issn = {1464-0686}, mesh = {Adolescent ; Attention/*physiology ; Cues ; Eye Movements/physiology ; Female ; Humans ; Male ; Mental Recall/*physiology ; Photic Stimulation ; Racism/*psychology ; *Social Justice ; Visual Perception/physiology ; Young Adult ; }, abstract = {Photographs provide critical retrieval cues for personal remembering, but few studies have considered this phenomenon at the collective level. In this research, we examined the psychological consequences of visual attention to the presence (or absence) of racially charged retrieval cues within American racial segregation photographs. We hypothesised that attention to racial retrieval cues embedded in historical photographs would increase social justice concept accessibility. In Study 1, we recorded gaze patterns with an eye-tracker among participants viewing images that contained racial retrieval cues or were digitally manipulated to remove them. In Study 2, we manipulated participants' gaze behaviour by either directing visual attention toward racial retrieval cues, away from racial retrieval cues, or directing attention within photographs where racial retrieval cues were missing. Across Studies 1 and 2, visual attention to racial retrieval cues in photographs documenting historical segregation predicted social justice concept accessibility.}, }
@article {pmid28053306, year = {2017}, author = {Davidson, G and Miller, R and Loissel, E and Cheke, LG and Clayton, NS}, title = {The development of support intuitions and object causality in juvenile Eurasian jays (Garrulus glandarius).}, journal = {Scientific reports}, volume = {7}, number = {}, pages = {40062}, doi = {10.1038/srep40062}, pmid = {28053306}, issn = {2045-2322}, abstract = {Knowledge about the causal relationship between objects has been studied extensively in human infants, and more recently in adult animals using differential looking time experiments. How knowledge about object support develops in non-human animals has yet to be explored. Here, we studied the ontogeny of support relations in Eurasian jays (Garrulus glandarius), a bird species known for its sophisticated cognitive abilities. Using an expectancy violation paradigm, we measured looking time responses to possible and impossible video and image stimuli. We also controlled for experience with different support types to determine whether the emergence of support intuitions is dependent upon specific interactions with objects, or if reasoning develops independently. At age 9 months, birds looked more at a tool moving a piece of cheese that was not in contact than one that was in direct contact. By the age of 6 months, birds that had not experienced string as a support to hold up objects looked more at impossible images with string hanging from below (unsupported), rather than above (supported). The development of support intuitions may be independent of direct experience with specific support, or knowledge gained from interactions with other objects may be generalised across contexts.}, }
@article {pmid28045891, year = {2017}, author = {Hofmeister, EK and Lund, M and Shearn-Bochsler, V and Balakrishnan, CN}, title = {Susceptibility and Antibody Response of the Laboratory Model Zebra Finch (Taeniopygia guttata) to West Nile Virus.}, journal = {PloS one}, volume = {12}, number = {1}, pages = {e0167876}, doi = {10.1371/journal.pone.0167876}, pmid = {28045891}, issn = {1932-6203}, mesh = {Animals ; Antibodies, Viral/blood ; *Antibody Formation ; Australia ; Bird Diseases/*immunology/virology ; Disease Models, Animal ; Disease Susceptibility ; Finches/*virology ; Indonesia ; Male ; Regression Analysis ; Species Specificity ; Viremia/*immunology ; West Nile Fever/*immunology ; West Nile virus/immunology ; }, abstract = {Since the introduction of West Nile virus (WNV) into North America in 1999 a number of passerine bird species have been found to play a role in the amplification of the virus. Arbovirus surveillance, observational studies and experimental studies have implicated passerine birds (songbirds, e.g., crows, American robins, house sparrows, and house finches) as significant reservoirs of WNV in North America, yet we lack a tractable passerine animal model for controlled studies of the virus. The zebra finch (Taeniopygia guttata) serves as a model system across a diversity of fields, and here we develop the zebra finch a songbird model for WNV. Like many natural hosts of WNV, we found that zebra finches developed sufficient viremia to serve as a competent host, yet in general resisted mortality from infection. In the Australian zebra finch (AZF) T. g. castanotis, we detected WNV in the majority of sampled tissues by 4 days post injection (dpi). However, WNV was not detected in tissues of sacrificed birds at 14 dpi, shortly after the development of detectable anti-WNV antibodies in the majority of birds indicating successful viral clearance. We compared susceptibility between the two zebra finch subspecies AZF and Timor zebra finch (TZF) T. g. guttata. Compared to AZF, WNV RNA was detected in a larger proportion of challenged TZF and molecular detection of virus in the serum of TZF was significantly higher than in AZF. Given the observed moderate host competence and disease susceptibility, we suggest that zebra finches are appropriate as models for the study of WNV and although underutilized in this respect, may be ideal models for the study of the many diseases carried and transmitted by songbirds.}, }
@article {pmid28035889, year = {2017}, author = {Griesser, M and Suzuki, TN}, title = {Naive Juveniles Are More Likely to Become Breeders after Witnessing Predator Mobbing.}, journal = {The American naturalist}, volume = {189}, number = {1}, pages = {58-66}, doi = {10.1086/689477}, pmid = {28035889}, issn = {1537-5323}, mesh = {Animals ; *Biological Evolution ; Genetic Fitness ; *Passeriformes ; Predatory Behavior ; *Reproduction ; }, abstract = {Responding appropriately during the first predatory attack in life is often critical for survival. In many social species, naive juveniles acquire this skill from conspecifics, but its fitness consequences remain virtually unknown. Here we experimentally demonstrate how naive juvenile Siberian jays (Perisoreus infaustus) derive a long-term fitness benefit from witnessing knowledgeable adults mobbing their principal predator, the goshawk (Accipiter gentilis). Siberian jays live in family groups of two to six individuals that also can include unrelated nonbreeders. Field observations showed that Siberian jays encounter predators only rarely, and, indeed, naive juveniles do not respond to predator models when on their own but do when observing other individuals mobbing them. Predator exposure experiments demonstrated that naive juveniles had a substantially higher first-winter survival after observing knowledgeable group members mobbing a goshawk model, increasing their likelihood of acquiring a breeding position later in life. Previous research showed that naive individuals may learn from others how to respond to predators, care for offspring, or choose mates, generally assuming that social learning has long-term fitness consequences without empirical evidence. Our results demonstrate a long-term fitness benefit of vertical social learning for naive individuals in the wild, emphasizing its evolutionary importance in animals, including humans.}, }
@article {pmid27988896, year = {2017}, author = {Krieger, N and Jahn, JL and Waterman, PD}, title = {Jim Crow and estrogen-receptor-negative breast cancer: US-born black and white non-Hispanic women, 1992-2012.}, journal = {Cancer causes &amp; control : CCC}, volume = {28}, number = {1}, pages = {49-59}, doi = {10.1007/s10552-016-0834-2}, pmid = {27988896}, issn = {1573-7225}, mesh = {Adult ; African Continental Ancestry Group ; Aged ; Aged, 80 and over ; Breast Neoplasms/metabolism/*pathology ; European Continental Ancestry Group ; Female ; Humans ; Middle Aged ; Prognosis ; *Racism ; Receptors, Estrogen/*metabolism ; Risk Factors ; SEER Program ; Socioeconomic Factors ; United States ; }, abstract = {PURPOSE: It is unknown whether Jim Crow-i.e., legal racial discrimination practiced by 21 US states and the District of Columbia and outlawed by the US Civil Rights Act in 1964-affects US cancer outcomes. We hypothesized that Jim Crow birthplace would be associated with higher risk of estrogen-receptor-negative (ER-) breast tumors among US black, but not white, women and also a higher black versus white risk for ER- tumors.<br><br>METHODS: We analyzed data from the SEER 13 registry group (excluding Alaska) for 47,157 US-born black non-Hispanic and 348,514 US-born white non-Hispanic women, aged 25-84 inclusive, diagnosed with primary invasive breast cancer between 1 January 1992 and 31 December 2012.<br><br>RESULTS: Jim Crow birthplace was associated with increased odds of ER- breast cancer only among the black, not white women, with the effect strongest for women born before 1965. Among black women, the odds ratio (OR) for an ER- tumor, comparing women born in a Jim Crow versus not Jim Crow state, equaled 1.09 (95% confidence interval [CI] 1.06, 1.13), on par with the OR comparing women in the worst versus best census tract socioeconomic quintiles (1.15; 95% CI 1.07, 1.23). The black versus white OR for ER- was higher among women born in Jim Crow versus non-Jim Crow states (1.41 [95% CI 1.13, 1.46] vs. 1.27 [95% CI 1.24, 1.31]).<br><br>CONCLUSIONS: The unique Jim Crow effect for US black women for breast cancer ER status underscores why analysis of racial/ethnic inequities must be historically contextualized.}, }
@article {pmid27979010, year = {2016}, author = {Gillum, RF and Dodd, KD}, title = {Soul Mates: Religion, Sex, Love, and Marriage among African Americans and Latinos.}, journal = {Journal of the National Medical Association}, volume = {108}, number = {4}, pages = {244-245}, doi = {10.1016/j.jnma.2016.08.007}, pmid = {27979010}, issn = {0027-9684}, abstract = {INTRODUCTION: This book review analyzes the complex and profound impact active religious participation has on relationships and family outcomes among African Americans and Latinos. In Soul Mates, Wilcox and Wolfinger discuss the legacy of slavery and Jim Crow laws and the resulting devastating effects on African American and Latino families despite their high religious involvement. The authors make the case that many African American men are unlikely candidates for marriage or stable relationships due to trends of family instability driven by the declining income-power of working-class men as well as entry of more women into the labor force, government penalties for low-income couples, revolt against traditional values, increased access to birth control and abortion, and the persistence of discrimination and incarceration of minority men.<br><br>METHODS: The authors examine data from six national surveys as well as additional data from interviews, focus groups, ethnographic field work, and an extensive literature review.<br><br>RESULTS: Wilcox and Wolfinger find evidence that when African American couples actively participate in Christian churches, the men are more likely to adhere to a &quot;code of decency&quot; which decreases street behaviors, such as binge drinking, having multiple sex partners, and having multi-partner fertility, which are known to inhibit family stability.<br><br>CONCLUSIONS: This book will be helpful for health providers who would like to better understand and serve their African American and Latino patients. The findings suggest that health care providers can promote a healthy emotional environment for families by encouraging minority men to renew or maintain church involvement.}, }
@article {pmid27973610, year = {2016}, author = {Neilands, PD and Jelbert, SA and Breen, AJ and Schiestl, M and Taylor, AH}, title = {How Insightful Is 'Insight'? New Caledonian Crows Do Not Attend to Object Weight during Spontaneous Stone Dropping.}, journal = {PloS one}, volume = {11}, number = {12}, pages = {e0167419}, doi = {10.1371/journal.pone.0167419}, pmid = {27973610}, issn = {1932-6203}, mesh = {Animals ; Crows/*physiology ; Tool Use Behavior/physiology ; }, abstract = {It is highly difficult to pinpoint what is going through an animal's mind when it appears to solve a problem by 'insight'. Here, we searched for an information processing error during the emergence of seemingly insightful stone dropping in New Caledonian crows. We presented these birds with the platform apparatus, where a heavy object needs to be dropped down a tube and onto a platform in order to trigger the release of food. Our results show New Caledonian crows exhibit a weight inattention error: they do not attend to the weight of an object when innovating stone dropping. This suggests that these crows do not use an understanding of force when solving the platform task in a seemingly insightful manner. Our findings showcase the power of the signature-testing approach, where experiments search for information processing biases, errors and limits, in order to make strong inferences about the functioning of animal minds.}, }
@article {pmid27936242, year = {2016}, author = {Miller, R and Jelbert, SA and Taylor, AH and Cheke, LG and Gray, RD and Loissel, E and Clayton, NS}, title = {Performance in Object-Choice Aesop's Fable Tasks Are Influenced by Object Biases in New Caledonian Crows but not in Human Children.}, journal = {PloS one}, volume = {11}, number = {12}, pages = {e0168056}, doi = {10.1371/journal.pone.0168056}, pmid = {27936242}, issn = {1932-6203}, mesh = {Animals ; Child ; Child, Preschool ; *Choice Behavior ; Crows/*physiology ; Humans ; }, abstract = {The ability to reason about causality underlies key aspects of human cognition, but the extent to which non-humans understand causality is still largely unknown. The Aesop's Fable paradigm, where objects are inserted into water-filled tubes to obtain out-of-reach rewards, has been used to test casual reasoning in birds and children. However, success on these tasks may be influenced by other factors, specifically, object preferences present prior to testing or arising during pre-test stone-dropping training. Here, we assessed this 'object-bias' hypothesis by giving New Caledonian crows and 5-10 year old children two object-choice Aesop's Fable experiments: sinking vs. floating objects, and solid vs. hollow objects. Before each test, we assessed subjects' object preferences and/or trained them to prefer the alternative object. Both crows and children showed pre-test object preferences, suggesting that birds in previous Aesop's Fable studies may also have had initial preferences for objects that proved to be functional on test. After training to prefer the non-functional object, crows, but not children, performed more poorly on these two object-choice Aesop's Fable tasks than subjects in previous studies. Crows dropped the non-functional objects into the tube on their first trials, indicating that, unlike many children, they do not appear to have an a priori understanding of water displacement. Alternatively, issues with inhibition could explain their performance. The crows did, however, learn to solve the tasks over time. We tested crows further to determine whether their eventual success was based on learning about the functional properties of the objects, or associating dropping the functional object with reward. Crows inserted significantly more rewarded, non-functional objects than non-rewarded, functional objects. These findings suggest that the ability of New Caledonian crows to produce performances rivaling those of young children on object-choice Aesop's Fable tasks is partly due to pre-existing object preferences.}, }
@article {pmid27928244, year = {2016}, author = {Zarrabipoor, H and Tehrani-Doost, M and Shahrivar, Z}, title = {Theory of Mind in Adolescents with Bipolar Disorder in Euthymic Phase: ‎Using the Strange Stories Test.}, journal = {Iranian journal of psychiatry}, volume = {11}, number = {3}, pages = {133-139}, pmid = {27928244}, issn = {1735-4587}, abstract = {Objective: This study evaluated the theory of mind (ToM) in adolescents diagnosed with bipolar disorder ‎‎(BD) during their euthymic period compared to a typically developing (TD) group.‎ Method: The BD group consisted of thirty 11-18 year old inpatients in euthymic phase. The TD ‎group included 30 age, gender, and IQ matched volunteer students. To assess the diagnosis and ‎comorbid disorders, we performed the semi-structured interview of the Kiddie Schedule for Affective Disorders ‎and Schizophrenia-Present and Lifetime Version (K-SADS-PL) for the BD adolescents. To ‎evaluate the severity of attention deficit hyperactivity disorder (ADHD) and mania, Conner's ‎Parent Rating Scale-Revised version (CPRS-R), and Young Mania Rating Scale (YMRS) were ‎used, respectively. Ravens Progressive Matrices was conducted to evaluate intellectual ability in ‎the both groups. Happe Strange Stories test was performed to assess ToM in the participants. Data were ‎analyzed using the independent t-test, analysis of covariance, and Pearson Correlation analysis.‎ Results: The two groups did not show any differences in comprehending the stories; however, the BD ‎group's mentalizing scores were significantly weaker than the TD group (p<0.05).‎‎ Conclusion: The ToM impairments in adolescents with BD may be explained as a trait marker which may lead ‎to continuation of social problems even during remission‏.‏.}, }
@article {pmid27922802, year = {2017}, author = {Sándor, AD and Kalmár, Z and Matei, I and Ionică, AM and Mărcuţan, ID}, title = {Urban Breeding Corvids as Disseminators of Ticks and Emerging Tick-Borne Pathogens.}, journal = {Vector borne and zoonotic diseases (Larchmont, N.Y.)}, volume = {17}, number = {2}, pages = {152-154}, doi = {10.1089/vbz.2016.2054}, pmid = {27922802}, issn = {1557-7759}, mesh = {Animal Distribution ; Animals ; Bird Diseases/epidemiology/*parasitology ; Cities ; *Crows ; Humans ; Tick Infestations/parasitology/*veterinary ; Tick-Borne Diseases/transmission/*veterinary ; Ticks/*microbiology ; Zoonoses ; }, abstract = {Crows (Corvidae) are common city dwellers worldwide and are increasingly important subjects of epidemiology studies. Although their importance as hosts and transmitters of a number of zoonotic parasites and pathogens is well known, there are no studies on their importance as tick hosts. After mosquitoes, ticks are the most important vectors of zoonotic pathogens, especially for those causing emerging zoonotic diseases. Pathogenic bacteria, especially Borrelia spp., Rickettsia spp., and Anaplasma spp., vectored by ticks, are the cause for most vector-borne diseases in Europe. Here we report on ticks and tick-borne pathogens harbored by urban breeding crows. A total of 36 birds (33.33%, n = 108) hosted ticks, with 91 individual ticks belonging to 6 species (Haemaphysalis concinna, Haemaphysalis parva, Haemaphysalis punctata, Hyalomma marginatum, Ixodes arboricola, and Ixodes ricinus). Rickettsia spp. DNA was found in 6.6% of ticks and 1.9% of bird tissues, whereas Anaplasma phagocytophilum was found in 5.9% of ticks and 0.9% of birds. Two rickettsial genospecies were located, Rickettsia helvetica and Rickettsia monacensis. This is the first study to determine such a diverse tick spectrum feeding on urban corvids, while highlighting their importance as tick hosts and raising concerns about their potential risk to human health.}, }
@article {pmid27920957, year = {2016}, author = {Miller, R and Logan, CJ and Lister, K and Clayton, NS}, title = {Eurasian jays do not copy the choices of conspecifics, but they do show evidence of stimulus enhancement.}, journal = {PeerJ}, volume = {4}, number = {}, pages = {e2746}, doi = {10.7717/peerj.2746}, pmid = {27920957}, issn = {2167-8359}, abstract = {Corvids (birds in the crow family) are hypothesised to have a general cognitive tool-kit because they show a wide range of transferrable skills across social, physical and temporal tasks, despite differences in socioecology. However, it is unknown whether relatively asocial corvids differ from social corvids in their use of social information in the context of copying the choices of others, because only one such test has been conducted in a relatively asocial corvid. We investigated whether relatively asocial Eurasian jays (Garrulus glandarius) use social information (i.e., information made available by others). Previous studies have indicated that jays attend to social context in their caching and mate provisioning behaviour; however, it is unknown whether jays copy the choices of others. We tested the jays in two different tasks varying in difficulty, where social corvid species have demonstrated social information use in both tasks. Firstly, an object-dropping task was conducted requiring objects to be dropped down a tube to release a food reward from a collapsible platform, which corvids can learn through explicit training. Only one rook and one New Caledonian crow have learned the task using social information from a demonstrator. Secondly, we tested the birds on a simple colour discrimination task, which should be easy to solve, because it has been shown that corvids can make colour discriminations. Using the same colour discrimination task in a previous study, all common ravens and carrion crows copied the demonstrator. After observing a conspecific demonstrator, none of the jays solved the object-dropping task, though all jays were subsequently able to learn to solve the task in a non-social situation through explicit training, and jays chose the demonstrated colour at chance levels. Our results suggest that social and relatively asocial corvids differ in social information use, indicating that relatively asocial species may have secondarily lost this ability due to lack of selection pressure from an asocial environment.}, }
@article {pmid27893249, year = {2016}, author = {Ujma, PP and Sándor, P and Szakadát, S and Gombos, F and Bódizs, R}, title = {Sleep spindles and intelligence in early childhood-developmental and trait-dependent aspects.}, journal = {Developmental psychology}, volume = {52}, number = {12}, pages = {2118-2129}, doi = {10.1037/dev0000233}, pmid = {27893249}, issn = {1939-0599}, mesh = {Age Factors ; Brain Mapping ; Child ; *Child Development ; Child, Preschool ; Electroencephalography ; Female ; Humans ; *Individuality ; Intelligence/*physiology ; Intelligence Tests ; Male ; Polysomnography ; *Sex Characteristics ; Sleep/*physiology ; Spectrum Analysis ; }, abstract = {Sleep spindles act as a powerful marker of individual differences in cognitive ability. Sleep spindle parameters correlate with both age-related changes in cognitive abilities and with the age-independent concept of IQ. While some studies have specifically demonstrated the relationship between sleep spindles and intelligence in young children, our previous work in older subjects revealed sex differences in the sleep spindle correlates of IQ, which was never investigated in small children before. We investigated the relationship between age, Raven Colored Progressive Matrices (CPM) scores and sleep spindles in 28 young children (age 4-8 years, 15 girls). We specifically investigated sex differences in the psychometric correlates of sleep spindles. We also aimed to separate the correlates of sleep spindles that are because of age-related maturation from other effects that reflect an age-independent relationship between sleep spindles and general intelligence. Our results revealed a modest positive correlation between fast spindle amplitude and age. Raven CPM scores positively correlated with both slow and fast spindle amplitude, but this effect remained a tendency in males and vanished after correcting for the effects of age. Age-corrected correlations between Raven CPM scores and both slow and fast spindle amplitude were only significant in females. Overall, our results show that in male children sleep spindles are a maturational marker, but in female children they indicate trait-like intelligence, in line with previous studies in adolescent and adult subjects. Thalamocortical white matter connectivity may be the underlying mechanism behind both higher spindle amplitude and higher intelligence in female, but not male subjects. (PsycINFO Database Record}, }
@article {pmid27890937, year = {2016}, author = {Greggor, AL and Jolles, JW and Thornton, A and Clayton, NS}, title = {Seasonal changes in neophobia and its consistency in rooks: the effect of novelty type and dominance position.}, journal = {Animal behaviour}, volume = {121}, number = {}, pages = {11-20}, doi = {10.1016/j.anbehav.2016.08.010}, pmid = {27890937}, issn = {0003-3472}, support = {BB/H021817/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, abstract = {Neophobia, or the fear of novelty, may offer benefits to animals by limiting their exposure to unknown danger, but can also impose costs by preventing the exploration of potential resources. The costs and benefits of neophobia may vary throughout the year if predation pressure, resource distribution or conspecific competition changes seasonally. Despite such variation, neophobia levels are often assumed to be temporally and individually stable. Whether or not neophobia expression changes seasonally and fluctuates equally for all individuals is crucial to understanding the drivers, consequences and plasticity of novelty avoidance. We investigated seasonal differences and individual consistency in the motivation and novelty responses of a captive group of rooks, Corvus frugilegus, a seasonally breeding, colonial species of corvid that is known for being neophobic. We tested the group around novel objects and novel people to determine whether responses generalized across novelty types, and considered whether differences in dominance could influence the social risk of approaching unknown stimuli. We found that the group's level of object neophobia was stable year-round, but individuals were not consistent between seasons, despite being consistent within seasons. In contrast, the group's avoidance of novel people decreased during the breeding season, and individuals were consistent year-round. Additionally, although subordinate birds were more likely to challenge dominants during the breeding season, this social risk taking did not translate to greater novelty approach. Since seasonal variation and individual consistency varied differently towards each novelty type, responses towards novel objects and people seem to be governed by different mechanisms. Such a degree of fluctuation has consequences for other individually consistent behaviours often measured within the nonhuman personality literature.}, }
@article {pmid27888998, year = {2016}, author = {Romero, R and Nygaard, I}, title = {Jay D. Iams, MD, AJOG Editor.}, journal = {American journal of obstetrics and gynecology}, volume = {215}, number = {6}, pages = {679-681}, doi = {10.1016/j.ajog.2016.09.101}, pmid = {27888998}, issn = {1097-6868}, support = {Z99 HD999999/NULL/Intramural NIH HHS/United States ; }, mesh = {Editorial Policies ; *Gynecology/history ; History, 20th Century ; History, 21st Century ; *Obstetrics/history ; Pediatrics/history ; Perinatology/history ; *Periodicals as Topic/history ; Premature Birth/prevention &amp; control ; United States ; }, }
@article {pmid27884400, year = {2016}, author = {Sheldon, M}, title = {Stephen Jay Gould and the Value of Neutrality of Science During the Cold War.}, journal = {Endeavour}, volume = {40}, number = {4}, pages = {248-255}, doi = {10.1016/j.endeavour.2016.10.003}, pmid = {27884400}, issn = {1873-1929}, abstract = {Stephen Jay Gould was a paleontologist and scientific celebrity at the close of the twentieth century, most famous for his popular writings on evolution and his role in the American creationist controversies of that era. In the early 1980s, Gould was drawn into the &quot;nuclear winter&quot; episode through his friendship with Carl Sagan, an astronomer and popular science celebrity. Sagan helped develop the theory of nuclear winter and subsequently used the theory as evidence to petition the United States government to scale back its nuclear armament. The theory of nuclear winter claimed that even a small nuclear exchange could result in a atmospheric blackening akin to the extinction event of the late Cretaceous. Gould was not a climate scientist but he testified before the U.S. House of Representatives as an expert on historical extinction events. Gould's insistence on the value-neutrality of nuclear winter reveals much about the moral politics of science in late Cold War America. Coming at the heels of leftist scientific activism of the 1980s, the nuclear winter episode demonstrates how value-neutrality emerged the salient feature of scientific involvement in American politics in this period.}, }
@article {pmid27881787, year = {2016}, author = {Ditz, HM and Nieder, A}, title = {Sensory and Working Memory Representations of Small and Large Numerosities in the Crow Endbrain.}, journal = {The Journal of neuroscience : the official journal of the Society for Neuroscience}, volume = {36}, number = {47}, pages = {12044-12052}, doi = {10.1523/JNEUROSCI.1521-16.2016}, pmid = {27881787}, issn = {1529-2401}, mesh = {Animals ; Cognition/*physiology ; Crows/*physiology ; Female ; Male ; Mathematical Concepts ; Memory, Short-Term/*physiology ; Nerve Net/*physiology ; Telencephalon/*physiology ; Visual Perception/*physiology ; }, abstract = {Neurons in the avian nidopallium caudolaterale (NCL), an endbrain structure that originated independently from the mammalian neocortex, process visual numerosities. To clarify the code for number in this anatomically distinct endbrain area in birds, neuronal responses to a broad range of numerosities were analyzed. We recorded single-neuron activity from the NCL of crows performing a delayed match-to-sample task with visual numerosities as discriminanda. The responses of >20% of randomly selected neurons were modulated significantly by numerosities ranging from one to 30 items. Numerosity-selective neurons showed bell-shaped tuning curves with one of the presented numerosities as preferred numerosity regardless of the physical appearance of the items. The resulting labeled-line code exhibited logarithmic compression obeying the Weber-Fechner law for magnitudes. Comparable proportions of selective neurons were found, not only during stimulus presentation, but also in the delay phase, indicating a dominant role of the NCL in numerical working memory. Both during sensory encoding and memorization of numerosities in working memory, NCL activity predicted the crows' number discrimination performance. These neuronal data reveal striking similarities across vertebrate taxa in their code for number despite convergently evolved and anatomically distinct endbrain structures.<br><br>SIGNIFICANCE STATEMENT: Birds are known for their capabilities to process numerical quantity. However, birds lack a six-layered neocortex that enables primates with numerical competence. We aimed to decipher the neuronal code for numerical quantity in the independently and distinctly evolved endbrain of birds. We recorded the activity of neurons in an endbrain association area termed nidopallium caudolaterale (NCL) from crows that assessed and briefly memorized numerosities from one to 30 dots. We report a neuronal code for sensory representation and working memory of numerosities in the crow NCL exhibiting several characteristics that are surprisingly similar to the ones found in primates. Our data suggest a common code for number in two different vertebrate taxa that has evolved based on convergent evolution.}, }
@article {pmid27876975, year = {2016}, author = {Mirzaghavami, M and Sadraei, J and Forouzandeh, M}, title = {Detection of Cryptosporidium spp. in free ranging animals of Tehran, Iran.}, journal = {Journal of parasitic diseases : official organ of the Indian Society for Parasitology}, volume = {40}, number = {4}, pages = {1528-1531}, doi = {10.1007/s12639-015-0720-y}, pmid = {27876975}, issn = {0971-7196}, abstract = {Cryptosporidium is a world widely distributed parasite which comparatively has a high prevalence in developing countries. The zoonotic potential of some Cryptosporidium species has made the cryptosporidiosis a significant concern to physicians and veterinarians. The occurrence and zoonotic potential of Cryptosporidium species in probable reservoir hosts for man infections was determined by examining faeces of symptomatic and asymptomatic animals. The aim of this study is to screen the presence of Cryptosporidium in fecal sample of free ranging animals in Tehran using Ziehl-Neelsen staining method. The findings indicate that Cryptosporidium are present in 9/50 (18 %) stray cat (Felis catus), 12/50 (24 %) hooded crows (Corvus cornix), 23/180 (12.7 %) rat (Rattus norvegicus and R. rattus) and 1/40 (2.5 %) pigeons (Columba livia). This investigation confirms the potential role of rats, cats, crows and pigeons for zoonotic transmission of human cryptosporidiosis and they must be considered as reservoir hosts which can endanger public health.}, }
@article {pmid27872403, year = {2017}, author = {Fleisig, GS and Diffendaffer, AZ and Aune, KT and Ivey, B and Laughlin, WA}, title = {Biomechanical Analysis of Weighted-Ball Exercises for Baseball Pitchers.}, journal = {Sports health}, volume = {9}, number = {3}, pages = {210-215}, doi = {10.1177/1941738116679816}, pmid = {27872403}, issn = {1941-0921}, mesh = {Arm/physiology ; Baseball/injuries/*physiology ; Biomechanical Phenomena ; Elbow/physiology ; Electromyography ; Foot/physiology ; Humans ; Knee/physiology ; Lower Extremity/*physiology ; Pelvis/physiology ; Risk Factors ; Shoulder/physiology ; Time and Motion Studies ; Torso/physiology ; Upper Extremity/*physiology ; }, abstract = {BACKGROUND: Weighted-ball throwing programs are commonly used in training baseball pitchers to increase ball velocity. The purpose of this study was to compare kinematics and kinetics among weighted-ball exercises with values from standard pitching (ie, pitching standard 5-oz baseballs from a mound).<br><br>HYPOTHESIS: Ball and arm velocities would be greater with lighter balls and joint kinetics would be greater with heavier balls.<br><br>STUDY DESIGN: Controlled laboratory study.<br><br>METHODS: Twenty-five high school and collegiate baseball pitchers experienced with weighted-ball throwing were tested with an automated motion capture system. Each participant performed 3 trials of 10 different exercises: pitching 4-, 5-, 6-, and 7-oz baseballs from a mound; flat-ground crow hop throws with 4-, 5-, 6-, and 7-oz baseballs; and flat-ground hold exercises with 14- and 32-oz balls. Twenty-six biomechanical parameters were computed for each trial. Data among the 10 exercises were compared with repeated measures analysis of variance and post hoc paired t tests against the standard pitching data.<br><br>RESULTS: Ball velocity increased as ball mass decreased. There were no differences in arm and trunk velocities between throwing a standard baseball and an underweight baseball (4 oz), while arm and trunk velocities steadily decreased as ball weight increased from 5 to 32 oz. Compared with values pitching from a mound, velocities of the pelvis, shoulder, and ball were increased for flat-ground throws. In general, as ball mass increased arm torques and forces decreased; the exception was elbow flexion torque, which was significantly greater for the flat-ground holds. There were significant differences in body positions when pitching on the mound, flat-ground throws, and holds.<br><br>CONCLUSIONS: While ball velocity was greatest throwing underweight baseballs, results from the study did not support the rest of the hypothesis. Kinematics and kinetics were similar between underweight and standard baseballs, while overweight balls correlated with decreased arm forces, torques, and velocities. Increased ball velocity and joint velocities were produced with crow hop throws, likely because of running forward while throwing.<br><br>CLINICAL RELEVANCE: As pitching slightly underweight and overweight baseballs produces variations in kinematics without increased arm kinetics, these exercises seem reasonable for training pitchers. As flat-ground throwing produces increased shoulder internal rotation velocity and elbow varus torque, these exercises may be beneficial but may also be stressful and risky. Flat-ground holds with heavy balls should not be viewed as enhancing pitching biomechanics, but rather as hybrid exercises between throwing and resistance training.}, }
@article {pmid27871752, year = {2017}, author = {Liordos, V and Kontsiotis, VJ and Georgari, M and Baltzi, K and Baltzi, I}, title = {Public acceptance of management methods under different human-wildlife conflict scenarios.}, journal = {The Science of the total environment}, volume = {579}, number = {}, pages = {685-693}, doi = {10.1016/j.scitotenv.2016.11.040}, pmid = {27871752}, issn = {1879-1026}, mesh = {Animals ; Attitude ; Conservation of Natural Resources/*methods ; Crops, Agricultural ; Farmers ; Greece ; Humans ; *Public Opinion ; }, abstract = {Wildlife management seeks to minimise public controversy for successful application of wildlife control methods. Human dimensions research in wildlife seeks a better understanding of public preferences for effective human-wildlife conflict resolution. In face to face interviews, 630 adults in Greece were asked to rate on a 5-point Likert-like scale their acceptance of 3 management methods, i.e., do nothing, non-lethal control, and lethal control, in the context of 5 human-wildlife conflict scenarios: 1) corvids damage crops; 2) starlings damage crops; 3) starlings foul urban structures; 4) coypus damage crops; and 5) coypus transfer disease. Univariate GLMs determined occupation, hunting membership and their interaction as the stronger predictors of public acceptance, generating 4 stakeholder groups: the general public, farmers, hunters, and farmers-hunters. Differences in acceptance and consensus among stakeholder groups were assessed using the Potential for Conflict Index2 (PCI2). All 4 stakeholder groups agreed that doing nothing was unacceptable and non-lethal control acceptable in all 5 scenarios, with generally high consensus within and between groups. The lethal control method was more controversial and became increasingly more acceptable as the severity of scenarios was increased and between non-native and native species. Lethal control was unacceptable for the general public in all scenarios. Farmers accepted lethal methods in the corvids and starlings scenarios, were neutral in the coypus damage crops scenario, whereas they accepted lethal control when coypus transfer disease. Hunters' opinion was neutral in the corvids, starlings and coypus damage crops and starlings foul urban structures scenarios, but they accepted lethal methods in the coypus transfer disease scenario. Farmers-hunters considered lethal control acceptable in all 5 scenarios. Implications from this study could be used for designing a socio-ecological approach which incorporates wildlife management with public interests. The studied species have a wide distribution, therefore present findings might also prove useful elsewhere.}, }
@article {pmid27870033, year = {2016}, author = {Marquis, RJ and Salazar, D and Baer, C and Reinhardt, J and Priest, G and Barnett, K}, title = {Ode to Ehrlich and Raven or how herbivorous insects might drive plant speciation.}, journal = {Ecology}, volume = {97}, number = {11}, pages = {2939-2951}, doi = {10.1002/ecy.1534}, pmid = {27870033}, issn = {0012-9658}, mesh = {Animals ; *Genetic Speciation ; Herbivory/*physiology ; Insecta/*physiology ; *Models, Biological ; Plant Physiological Phenomena ; Plants/*genetics ; Pollination/genetics/physiology ; }, abstract = {Fifty years ago, Ehrlich and Raven proposed that insect herbivores have driven much of plant speciation, particularly at tropical latitudes. There have been no explicit tests of their hypotheses. Indeed there were no proposed mechanisms either at the time or since by which herbivores might generate new plant species. Here we outline two main classes of mechanisms, prezygotic and postzygotic, with a number of scenarios in each by which herbivore-driven changes in host plant secondary chemistry might lead to new plant lineage production. The former apply mainly to a sympatric model of speciation while the latter apply to a parapatric or allopatric model. Our review suggests that the steps of each mechanism are known to occur individually in many different systems, but no scenario has been thoroughly investigated in any one system. Nevertheless, studies of Dalechampia and its herbivores and pollinators, and patterns of defense tradeoffs in trees on different soil types in the Peruvian Amazon provide evidence consistent with the original hypotheses of Ehrlich and Raven. For herbivores to drive sympatric speciation, our findings suggest that interactions with both their herbivores and their pollinators should be considered. In contrast, herbivores may drive speciation allopatrically without any influence by pollinators. Finally, there is evidence that these mechanisms are more likely to occur at low latitudes and thus more likely to produce new species in the tropics. The mechanisms we outline provide a predictive framework for further study of the general role that herbivores play in diversification of their host plants.}, }
@article {pmid27867222, year = {2016}, author = {St Clair, JJ and Klump, BC and van der Wal, JE and Sugasawa, S and Rutz, C}, title = {Strong between-site variation in New Caledonian crows' use of hook-tool-making materials.}, journal = {Biological journal of the Linnean Society. Linnean Society of London}, volume = {118}, number = {2}, pages = {226-232}, doi = {10.1111/bij.12757}, pmid = {27867222}, issn = {0024-4066}, abstract = {Functional tool use requires the selection of appropriate raw materials. New Caledonian crows Corvus moneduloides are known for their extraordinary tool-making behaviour, including the crafting of hooked stick tools from branched vegetation. We describe a surprisingly strong between-site difference in the plant materials used by wild crows to manufacture these tools: crows at one study site use branches of the non-native shrub Desmanthus virgatus, whereas only approximately 7 km away, birds apparently ignore this material in favour of the terminal twigs of an as-yet-unidentified tree species. Although it is likely that differences in local plant communities drive this striking pattern, it remains to be determined how and why crows develop such strong site-specific preferences for certain raw materials.}, }
@article {pmid27864599, year = {2017}, author = {Coran, AG}, title = {In Memory of Jay L. Grosfeld, M.D.}, journal = {Pediatric surgery international}, volume = {33}, number = {1}, pages = {1-2}, doi = {10.1007/s00383-016-4023-x}, pmid = {27864599}, issn = {1437-9813}, mesh = {Animals ; General Surgery/*history ; History, 20th Century ; History, 21st Century ; Humans ; Male ; Pediatrics/*history ; United States ; }, }
@article {pmid27864088, year = {2017}, author = {Moll, FW and Nieder, A}, title = {Modality-invariant audio-visual association coding in crow endbrain neurons.}, journal = {Neurobiology of learning and memory}, volume = {137}, number = {}, pages = {65-76}, doi = {10.1016/j.nlm.2016.11.011}, pmid = {27864088}, issn = {1095-9564}, mesh = {Acoustic Stimulation ; Animals ; Auditory Perception/*physiology ; Behavior, Animal/physiology ; Crows ; Learning/physiology ; Male ; Neurons/*physiology ; Photic Stimulation ; Prefrontal Cortex/physiology ; Telencephalon/*physiology ; Visual Perception/*physiology ; }, abstract = {Single neuron activity in the corvid nidopallium caudolaterale (NCL), the supposed avian functional analog of the prefrontal cortex, represents associations of auditory with visual stimuli. This is of high adaptive value for songbirds that need to rely on audio-visual associations to communicate, find a mate or escape predators. However, it remains unclear whether NCL neurons can represent cross-modal associations in a modality invariant, abstract fashion. To dissociate between modality-dependent and modality-invariant NCL activity, we trained two crows to match auditory sample cues with visual test stimuli, and vice versa, across a temporal memory delay. During sample presentation, NCL activity selectively encoded associations in a modality invariant fashion. During the delay, we observed subject specific, population-level coding biases in NCL activity. Despite of these biases, task relevant information could be decoded equally well from either subject's neuronal delay activity. Decoding success was facilitated by many mixed selectivity neurons, which mediated high dimensional representations of task variables on the NCL population level. These results parallel findings from the mammalian PFC, suggesting common mechanisms responsible for the adaptability of multimodal association areas across taxa.}, }
@article {pmid27859134, year = {2016}, author = {Leverkus, AB and Rey Benayas, JM and Castro, J}, title = {Shifting demographic conflicts across recruitment cohorts in a dynamic post-disturbance landscape.}, journal = {Ecology}, volume = {97}, number = {10}, pages = {2628-2639}, doi = {10.1002/ecy.1527}, pmid = {27859134}, issn = {0012-9658}, mesh = {Animals ; Demography ; *Ecosystem ; *Quercus ; *Seed Dispersal ; Seedlings ; Seeds ; Spain ; }, abstract = {Seed dispersal effectiveness, which measures the number of adult plant individuals produced by seed dispersal, is the product of the number of seeds dispersed and the probability a seed produces an adult. Directed dispersal to certain habitat types may enhance some stages of recruitment but disfavor others, generating demographic conflicts in plant ontogeny. We asked whether temporal changes in habitat features may affect the distribution of seedlings recruited from dispersed acorns, and whether this could induce shifts in the life-stage conflicts experienced by successive cohorts of naturally recruited plants. As early successional habitats are characterized by rapid change, we used a burnt pine stand in southern Spain to monitor the recruitment and performance of a major tree species (Quercus ilex) across 7 yr in four types of post-fire habitats. These differed in structure and included patches of unburnt forest and three management alternatives of burnt trees: logging, partial cutting, and nonintervention. Young oaks that resprouted after the fire were mainly located near acorn sources, while new seedlings initially emerged mostly in habitats with standing snags due to habitat selection by European jays, Garrulus glandarius, for dispersal. The dead pines gradually collapsed and attracted less dispersal, so subsequent seedling cohorts mainly recruited within patches of unburnt pines. These live pines enhanced the survival of the oaks located beneath their canopy but greatly reduced their growth as compared to the other post-fire habitats, thus representing a demographic conflict that was absent elsewhere. As a consequence of the directional shift in the habitat where seedlings recruited, successive seedling cohorts experienced a gradual improvement in their likelihood of survival but a reduction in growth. The progressive intensification of this life-stage conflict hinged on the reduction of vertical structures in the habitat with standing burnt pines. Recruitment success thus involved temporal variation in the habitat where recruitment occurred, likely resulting from changes in the direction of seed dispersal, and spatial variation in habitat suitability for seedling establishment and growth. Temporal changes in habitat structure can indirectly change the environment in which recruitment occurs, and consequently seed dispersal effectiveness, by shifting the direction of seed dispersal.}, }
@article {pmid27853622, year = {2016}, author = {Rutz, C and Sugasawa, S and van der Wal, JE and Klump, BC and St Clair, JJ}, title = {Tool bending in New Caledonian crows.}, journal = {Royal Society open science}, volume = {3}, number = {8}, pages = {160439}, doi = {10.1098/rsos.160439}, pmid = {27853622}, issn = {2054-5703}, support = {BB/G023913/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, abstract = {'Betty' the New Caledonian crow astonished the world when she 'spontaneously' bent straight pieces of garden wire into hooked foraging tools. Recent field experiments have revealed that tool bending is part of the species' natural behavioural repertoire, providing important context for interpreting Betty's iconic wire-bending feat. More generally, this discovery provides a compelling illustration of how natural history observations can inform laboratory-based research into the cognitive capacities of non-human animals.}, }
@article {pmid27840464, year = {2016}, author = {Deventer, SA and Uhl, F and Bugnyar, T and Miller, R and Fitch, WT and Schiestl, M and Ringler, M and Schwab, C}, title = {Behavioural Type Affects Space Use in a Wild Population of Crows (Corvus corone).}, journal = {Ethology : formerly Zeitschrift fur Tierpsychologie}, volume = {122}, number = {11}, pages = {881-891}, doi = {10.1111/eth.12536}, pmid = {27840464}, issn = {0179-1613}, abstract = {While personality-dependent dispersal is well studied, local space use has received surprisingly little attention in this context, despite the multiple consequences on survival and fitness. Regarding the coping style of individuals, recent studies on personality-dependent space use within a habitat indicate that 'proactive' individuals are wider ranging than 'reactive' ones. However, such studies are still scarce and cover limited taxonomic diversity, and thus, more research is needed to explore whether this pattern generalises across species. We examined the link between coping style and space use in a population of crows (Corvus corone) freely inhabiting the urban zoo of Vienna, Austria. We used a binary docility rating (struggle during handling vs. no struggle) and a tonic immobility test to quantify individual coping style. Individual space use was quantified as the number of different sites at which each crow was observed, and we controlled for different number of sightings per individual by creating a space use index. Only the binary docility rating showed repeatability over time, and significantly predicted space use. In contrast to previous studies, we found that reactive crows (no struggle during handling) showed wider ranging space use within the study site than proactive individuals (who struggled during handling). The discrepancy from previous results suggests that the relationship between behavioural type and space use may vary between species, potentially reflecting differences in socioecology.}, }
@article {pmid27838379, year = {2017}, author = {Greggor, AL and Spencer, KA and Clayton, NS and Thornton, A}, title = {Wild jackdaws' reproductive success and their offspring's stress hormones are connected to provisioning rate and brood size, not to parental neophobia.}, journal = {General and comparative endocrinology}, volume = {243}, number = {}, pages = {70-77}, doi = {10.1016/j.ygcen.2016.11.006}, pmid = {27838379}, issn = {1095-6840}, support = {BB/H021817/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; BB/L002264/1//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, mesh = {Animals ; Breeding ; Corticosterone/*metabolism ; Crows/*physiology ; Female ; Nesting Behavior/*physiology ; Phobic Disorders/*physiopathology ; Reproduction/*physiology ; Siblings ; *Social Behavior ; *Stress, Physiological ; }, abstract = {Many species show individual variation in neophobia and stress hormones, but the causes and consequences of this variation in the wild are unclear. Variation in neophobia levels could affect the number of offspring animals produce, and more subtly influence the rearing environment and offspring development. Nutritional deficits during development can elevate levels of stress hormones that trigger long-term effects on learning, memory, and survival. Therefore measuring offspring stress hormone levels, such as corticosterone (CORT), helps determine if parental neophobia influences the condition and developmental trajectory of young. As a highly neophobic species, jackdaws (Corvus monedula) are excellent for exploring the potential effects of parental neophobia on developing offspring. We investigated if neophobic responses, alongside known drivers of fitness, influence nest success and offspring hormone responses in wild breeding jackdaws. Despite its consistency across the breeding season, and suggestions in the literature that it should have importance for reproductive fitness, parental neophobia did not predict nest success, provisioning rates or offspring hormone levels. Instead, sibling competition and poor parental care contributed to natural variation in stress responses. Parents with lower provisioning rates fledged fewer chicks, chicks from larger broods had elevated baseline CORT levels, and chicks with later hatching dates showed higher stress-induced CORT levels. Since CORT levels may influence the expression of adult neophobia, variation in juvenile stress responses could explain the development and maintenance of neophobic variation within the adult population.}, }
@article {pmid27829758, year = {2016}, author = {Saisadan, D and Manimaran, P and Meenapriya, PK}, title = {In vitro comparative evaluation of mechanical properties of temporary restorative materials used in fixed partial denture.}, journal = {Journal of pharmacy &amp; bioallied sciences}, volume = {8}, number = {Suppl 1}, pages = {S105-S109}, doi = {10.4103/0975-7406.191936}, pmid = {27829758}, issn = {0976-4879}, abstract = {INTRODUCTION: Materials used to fabricate provisional restorations can be classified as acrylics or resin composites. Provisional crows can be either prefabricated or custom made.<br><br>ACRYLICS: These materials have been used to fabricate provisional restorations since the 1930s and usually available as powder and liquid. They are the most commonly used materials today for both single-unit and multiple-unit restorations. In general, their popularity is due to their low cost, acceptable esthetics, and versatility.<br><br>COMPOSITES: Composite provisional materials use bis-acryl resin, a hydrophobic material that is similar to bis-GMA. Composites are available as auto-polymerized, dualpolymerized and visible light polymerized.<br><br>PREFORMED CROWNS: Preformed provisional crowns or matrices usually consist of tooth-shaped shells of plastic, cellulose acetate or metal. They are commercially available in various tooth sizes and are usually selected for a particular tooth anatomy. They are commonly relined with acrylic resin to provide a more custom fit before cementation, but the plastic and metal crown shells can also be cemented directly onto prepared teeth.<br><br>AIMS AND OBJECTIVES: The aim of this study is to choose a material to serve as a better interim prosthesis and to compare three different properties - flexural strength, compressive strength, and color stability.<br><br>MATERIALS AND METHODS: The samples were made with three different provisional materials (Revotek LC, Protemp 4, TemSpan).<br><br>RESULT: It was inferred from the study that no one material was superior in all three tested parameters.}, }
@article {pmid27829553, year = {2017}, author = {Zhan, F and Liao, X and Gao, F and Qiu, W and Wang, Q}, title = {Electroactive crown ester-Cu2+ complex with in-situ modification at molecular beacon probe serving as a facile electrochemical DNA biosensor for the detection of CaMV 35s.}, journal = {Biosensors &amp; bioelectronics}, volume = {92}, number = {}, pages = {589-595}, doi = {10.1016/j.bios.2016.10.055}, pmid = {27829553}, issn = {1873-4235}, mesh = {Biosensing Techniques/*methods ; Caulimovirus/*isolation &amp; purification ; Coordination Complexes/*chemistry ; Copper/*chemistry ; Crown Ethers/*chemistry ; DNA, Viral/*analysis ; Electrochemical Techniques/methods ; Electrodes ; Gold/chemistry ; Limit of Detection ; Nucleic Acid Hybridization/methods ; Plant Diseases/*virology ; Signal-To-Noise Ratio ; Soybeans/virology ; }, abstract = {A novel electrochemical DNA biosensor has been facilely constructed by in-situ assembly of electroactive 4'-aminobenzo-18-crown-6-copper(II) complex (AbC-Cu2+) on the free terminal of the hairpin-structured molecule beacon. The 3'-SH modified molecule beacon probe was first immobilized on the gold electrode (AuE) surface through self-assembly chemistry of Au-S bond. Then the crow ester of AbC was covalently coupled with 5'-COOH on the molecule beacon, and served as a platform to attach the Cu2+ by coordination with ether bond (-O-) of the crown cycle. Thus, an electroactive molecule beacon-based biosensing interface was constructed. In comparison with conventional methods for preparation of electroactive molecule beacon, the approach presented in this work is much simpler, reagent- and labor-saving. Selectivity study shows that the in-situ fabricated electroactive molecule beacon remains excellent recognition ability of pristine molecule beacon probe to well differentiate various DNA fragments. The target DNA can be quantatively determined over the range from 0.10pM to 0.50nM. The detection limit of 0.060pM was estimated based on signal-to-noise ratio of 3. When the biosensor was applied for the detection cauliflower mosaic virus 35s (CaMV 35s) in soybean extraction samples, satisfactory results are achieved. This work opens a new strategy for facilely fabricating electrochemical sensing interface, which also shows great potential in aptasensor and immurosensor fabrication.}, }
@article {pmid27826273, year = {2016}, author = {Clary, D and Kelly, DM}, title = {Clark's Nutcrackers (Nucifraga columbiana) Flexibly Adapt Caching Behavior to a Cooperative Context.}, journal = {Frontiers in psychology}, volume = {7}, number = {}, pages = {1643}, doi = {10.3389/fpsyg.2016.01643}, pmid = {27826273}, issn = {1664-1078}, abstract = {Corvids recognize when their caches are at risk of being stolen by others and have developed strategies to protect these caches from pilferage. For instance, Clark's nutcrackers will suppress the number of caches they make if being observed by a potential thief. However, cache protection has most often been studied using competitive contexts, so it is unclear whether corvids can adjust their caching in beneficial ways to accommodate non-competitive situations. Therefore, we examined whether Clark's nutcrackers, a non-social corvid, would flexibly adapt their caching behaviors to a cooperative context. To do so, birds were given a caching task during which caches made by one individual were reciprocally exchanged for the caches of a partner bird over repeated trials. In this scenario, if caching behaviors can be flexibly deployed, then the birds should recognize the cooperative nature of the task and maintain or increase caching levels over time. However, if cache protection strategies are applied independent of social context and simply in response to cache theft, then cache suppression should occur. In the current experiment, we found that the birds maintained caching throughout the experiment. We report that males increased caching in response to a manipulation in which caches were artificially added, suggesting the birds could adapt to the cooperative nature of the task. Additionally, we show that caching decisions were not solely due to motivational factors, instead showing an additional influence attributed to the behavior of the partner bird.}, }
@article {pmid27826268, year = {2016}, author = {Corgnet, B and Espín, AM and Hernán-González, R}, title = {Creativity and Cognitive Skills among Millennials: Thinking Too Much and Creating Too Little.}, journal = {Frontiers in psychology}, volume = {7}, number = {}, pages = {1626}, doi = {10.3389/fpsyg.2016.01626}, pmid = {27826268}, issn = {1664-1078}, abstract = {Organizations crucially need the creative talent of millennials but are reluctant to hire them because of their supposed lack of diligence. Recent studies have shown that hiring diligent millennials requires selecting those who score high on the Cognitive Reflection Test (CRT) and thus rely on effortful thinking rather than intuition. A central question is to assess whether the push for recruiting diligent millennials using criteria such as cognitive reflection can ultimately hamper the recruitment of creative workers. To answer this question, we study the relationship between millennials' creativity and their performance on fluid intelligence (Raven) and cognitive reflection (CRT) tests. The good news for recruiters is that we report, in line with previous research, evidence of a positive relationship of fluid intelligence, and to a lesser extent cognitive reflection, with convergent creative thinking. In addition, we observe a positive effect of fluid intelligence on originality and elaboration measures of divergent creative thinking. The bad news for recruiters is the inverted U-shape relationship between cognitive reflection and fluency and flexibility measures of divergent creative thinking. This suggests that thinking too much may hinder important dimensions of creative thinking. Diligent and creative workers may thus be a rare find.}, }
@article {pmid27824400, year = {2016}, author = {Holcomb, GW and Ure, B}, title = {Jay L. Grosfeld, MD (1935-2016).}, journal = {European journal of pediatric surgery : official journal of Austrian Association of Pediatric Surgery ... [et al] = Zeitschrift fur Kinderchirurgie}, volume = {26}, number = {6}, pages = {542}, doi = {10.1055/s-0036-1594233}, pmid = {27824400}, issn = {1439-359X}, mesh = {General Surgery/*history ; History, 20th Century ; History, 21st Century ; Pediatrics/*history ; United States ; }, }
@article {pmid27815492, year = {2017}, author = {Wang, Z and Jay, CM and Evans, C and Kumar, P and Phalon, C and Rao, DD and Senzer, N and Nemunaitis, J}, title = {Preclinical Biodistribution and Safety Evaluation of a pbi-shRNA STMN1 Lipoplex after Subcutaneous Delivery.}, journal = {Toxicological sciences : an official journal of the Society of Toxicology}, volume = {155}, number = {2}, pages = {400-408}, doi = {10.1093/toxsci/kfw223}, pmid = {27815492}, issn = {1096-0929}, mesh = {Animals ; Female ; Humans ; Injections, Subcutaneous ; Interleukin-6/blood ; Male ; Neoplasms/metabolism/therapy ; *RNA Interference ; RNA, Small Interfering/*administration &amp; dosage/genetics/pharmacokinetics ; Rats ; Rats, Sprague-Dawley ; Stathmin/administration &amp; dosage/*antagonists &amp; inhibitors/*genetics/metabolism ; Tissue Distribution ; }, abstract = {Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study.}, }
@article {pmid27814545, year = {2016}, author = {Orłowski, G and Siebielec, G and Kasprzykowski, Z and Dobicki, W and Pokorny, P and Wuczyński, A and Polechoński, R and Mazgajski, TD}, title = {Effect of spatial resolution of soil data on predictions of eggshell trace element levels in the Rook Corvus frugilegus.}, journal = {Environmental pollution (Barking, Essex : 1987)}, volume = {219}, number = {}, pages = {288-295}, doi = {10.1016/j.envpol.2016.10.048}, pmid = {27814545}, issn = {1873-6424}, mesh = {*Agriculture ; Animals ; Cadmium/analysis ; Copper/analysis ; Egg Shell/*chemistry ; Environment ; Environmental Monitoring ; Metals, Heavy/*analysis ; Nickel/analysis ; *Passeriformes ; Poland ; Soil/*chemistry ; Soil Pollutants/*analysis ; Trace Elements/*analysis ; Zinc/analysis ; }, abstract = {Although a considerable research effort has gone into studying the dietary pathways of metals to the bodies of laying female birds and their eggs in recent years, no detailed investigations have yet been carried out relating the properties of the biogeochemical environment at large spatial scales to eggshell trace element levels in typical soil-invertebrate feeding birds under natural conditions. We used data from a large-scale nationwide monitoring survey of soil quality in Poland (3724 sampling points from the 43 792 available) to predict levels of five trace elements (copper [Cu], cadmium [Cd], nickel [Ni], zinc [Zn] and lead [Pb]) in Rook Corvus frugilegus eggshells from 42 breeding colonies. Our major aim was to test whether differences exist in the explanatory power of soil data (acidity, content of elements and organic matter, and particle size) used as a correlate of concentrations of eggshell trace elements among four different distances (5, 10, 15 and 20 km) around rookeries. Over all four distances around the rookeries only the concentrations of Cu and Cd in eggshells were positively correlated with those in soil, while eggshell Pb was correlated with the soil Pb level at the two longest distances (15 and 20 km) around the rookeries. The physical properties of soil (primarily the increase in pH) adversely affected eggshell Cd and Pb concentrations. The patterns and factors governing metal bioaccumulation in soil invertebrates and eggshells appear to be coincident, which strongly suggests a general similarity in the biochemical pathways of elements at different levels of the food web. The increasing acidification of arable soil as a result of excessive fertilisation and over-nitrification can enhance the bioavailability of toxic elements to laying females and their eggs.}, }
@article {pmid27811974, year = {2016}, author = {Clary, D and Kelly, DM}, title = {Graded Mirror Self-Recognition by Clark's Nutcrackers.}, journal = {Scientific reports}, volume = {6}, number = {}, pages = {36459}, doi = {10.1038/srep36459}, pmid = {27811974}, issn = {2045-2322}, mesh = {Animals ; Feeding Behavior ; Female ; Male ; Passeriformes/*physiology ; Recognition (Psychology)/*physiology ; }, abstract = {The traditional 'mark test' has shown some large-brained species are capable of mirror self-recognition. During this test a mark is inconspicuously placed on an animal's body where it can only be seen with the aid of a mirror. If the animal increases the number of actions directed to the mark region when presented with a mirror, the animal is presumed to have recognized the mirror image as its reflection. However, the pass/fail nature of the mark test presupposes self-recognition exists in entirety or not at all. We developed a novel mirror-recognition task, to supplement the mark test, which revealed gradation in the self-recognition of Clark's nutcrackers, a large-brained corvid. To do so, nutcrackers cached food alone, observed by another nutcracker, or with a regular or blurry mirror. The nutcrackers suppressed caching with a regular mirror, a behavioural response to prevent cache theft by conspecifics, but did not suppress caching with a blurry mirror. Likewise, during the mark test, most nutcrackers made more self-directed actions to the mark with a blurry mirror than a regular mirror. Both results suggest self-recognition was more readily achieved with the blurry mirror and that self-recognition may be more broadly present among animals than currently thought.}, }
@article {pmid27811148, year = {2016}, author = {Tüngler, V and König, N and Günther, C and Engel, K and Fiehn, C and Smitka, M and von der Hagen, M and Berner, R and Lee-Kirsch, MA}, title = {Response to: 'JAK inhibition in STING-associated interferonopathy' by Crow et al.}, journal = {Annals of the rheumatic diseases}, volume = {75}, number = {12}, pages = {e76}, doi = {10.1136/annrheumdis-2016-210565}, pmid = {27811148}, issn = {1468-2060}, mesh = {Chilblains/*metabolism ; Humans ; Interferons ; Janus Kinases/*metabolism ; Lupus Erythematosus, Cutaneous/*metabolism ; Membrane Proteins/*metabolism ; *Signal Transduction ; }, }
@article {pmid27808198, year = {2016}, author = {}, title = {Animal behaviour: Magpies behave cooperatively.}, journal = {Nature}, volume = {539}, number = {7627}, pages = {9}, doi = {10.1038/539009e}, pmid = {27808198}, issn = {1476-4687}, }
@article {pmid27503511, year = {2016}, author = {Levine, RS and Mead, DG and Hamer, GL and Brosi, BJ and Hedeen, DL and Hedeen, MW and McMillan, JR and Bisanzio, D and Kitron, UD}, title = {Supersuppression: Reservoir Competency and Timing of Mosquito Host Shifts Combine to Reduce Spillover of West Nile Virus.}, journal = {The American journal of tropical medicine and hygiene}, volume = {95}, number = {5}, pages = {1174-1184}, doi = {10.4269/ajtmh.15-0809}, pmid = {27503511}, issn = {1476-1645}, support = {T32 AI055404/AI/NIAID NIH HHS/United States ; }, mesh = {Animals ; Culex/virology ; Culicidae/*virology ; Female ; Host-Pathogen Interactions ; Insect Vectors/virology ; Passeriformes/virology ; Seasons ; Seroepidemiologic Studies ; United States/epidemiology ; West Nile Fever/*epidemiology/veterinary ; West Nile virus/*isolation &amp; purification ; }, abstract = {In the eastern United States, human cases of West Nile virus (WNV) result from spillover from urban epizootic transmission between passerine birds and Culex mosquitoes. In Atlanta, GA, substantial WNV presence in hosts and vectors has not resulted in the human disease burden observed in cities with similar infection pressure. Our study goal was to investigate extrinsic ecological conditions that potentially contribute to these reduced transmission rates. We conducted WNV surveillance among hosts and vectors in urban Atlanta and recorded an overall avian seroprevalence of nearly 30%, which was significantly higher among northern cardinals, blue jays, and members of the mimid family, and notably low among American robins. Examination of temporal Culex feeding patterns showed a marked feeding shift from American robins in the early season to northern cardinals in the late season. We therefore rule out American robins as superspreaders in the Atlanta area and suggest instead that northern cardinals and mimids act as WNV &quot;supersuppressor&quot; species, which slow WNV transmission by drawing many infectious bites during the critical virus amplification period, yet failing to amplify transmission due to low host competencies. Of particular interest, urban forest patches provide spillover protection by increasing the WNV amplification fraction on supersuppressor species.}, }
@article {pmid26602225, year = {2016}, author = {Kazemeini, T and Fadardi, JS}, title = {Executive Function: Comparing Bilingual and Monolingual Iranian University Students.}, journal = {Journal of psycholinguistic research}, volume = {45}, number = {6}, pages = {1315-1326}, doi = {10.1007/s10936-015-9403-1}, pmid = {26602225}, issn = {1573-6555}, mesh = {Adult ; Executive Function/*physiology ; Humans ; *Inhibition (Psychology) ; Iran ; Male ; Memory, Short-Term/*physiology ; *Multilingualism ; Universities ; Young Adult ; }, abstract = {The study aimed to examine whether Kurdish-Persian early Bilingual university students (EBL) and Persian Monolingual university students (ML) differ on tasks of executive function (EF). Thirty male EBL and 30 male ML students from Ferdowsi University of Mashhad completed a Persian Stroop Color-Word task (SCWT), Backward Digit Span Test (BDST), Raven Standard Progressive Matrices, and a demographic questionnaire. The results of an analysis of variance showed EBL students responded faster on the SCWT compared with ML students, suggesting an inhibition advantage for EBL students. Moreover, mean scores of BDST showed better performance of EBL students in working memory than ML students. These results provided evidence of advantaged EF among EBL and were consistent with the possibility that individuals who began speaking a second language (L2) earlier in childhood have greater advantages, due either to effects of acquiring an L2 earlier or to a longer duration of bilingual experience.}, }
@article {pmid27801957, year = {2016}, author = {Dawson, DA and Dos Remedios, N and Horsburgh, GJ}, title = {A new marker based on the avian spindlin gene that is able to sex most birds, including species problematic to sex with CHD markers.}, journal = {Zoo biology}, volume = {35}, number = {6}, pages = {533-545}, doi = {10.1002/zoo.21326}, pmid = {27801957}, issn = {1098-2361}, mesh = {Animal Husbandry/*methods ; Animals ; Animals, Zoo/*genetics ; Birds/*genetics ; Cell Cycle Proteins/*genetics ; Female ; Male ; Microsatellite Repeats/genetics ; Microtubule-Associated Proteins/*genetics ; Phosphoproteins/*genetics ; Sequence Homology, Nucleic Acid ; Sex Chromosomes/genetics ; Sex Determination Analysis/*methods ; }, abstract = {We have developed a new marker (Z43B) that can be successfully used to identify the sex of most birds (69%), including species difficult or impossible to sex with other markers. We utilized the zebra finch Taeniopygia guttata EST microsatellite sequence (CK309496) which displays sequence homology to the 5' untranslated region (UTR) of the avian spindlin gene. This gene is known to be present on the Z and W chromosomes. To maximize cross-species utility, the primer set was designed from a consensus sequence created from homologs of CK309496 that were isolated from multiple distantly related species. Both the forward and reverse primer sequences were 100% identical to 14 avian species, including the Z chromosome of eight species and the chicken Gallus gallus W chromosome, as well as the saltwater crocodile Crocodylus porosus. The Z43B primer set was assessed by genotyping individuals of known sex belonging to 61 non-ratite species and a single ratite. The Z and W amplicons differed in size making it possible to distinguish between males (ZZ) and females (ZW) for the majority (69%) of non-ratite species tested, comprising 10 orders of birds. We predict that this marker will be useful for obtaining sex-typing data for ca 6,869 species of birds (69% of non-ratites but not galliforms). A wide range of species could be sex-typed including passerines, shorebirds, eagles, falcons, bee-eaters, cranes, shags, parrots, penguins, ducks, and a ratite species, the brown kiwi, Apteryx australis. Those species sexed include species impossible or problematic to sex-type with other markers (magpie, albatross, petrel, eagle, falcon, crane, and penguin species). Zoo Biol. 35:533-545, 2016. © 2016 The Authors. Zoo Biology published by Wiley Periodicals, Inc.}, }
@article {pmid27796660, year = {2017}, author = {Bílá, K and Beránková, J and Veselý, P and Bugnyar, T and Schwab, C}, title = {Responses of urban crows to con- and hetero-specific alarm calls in predator and non-predator zoo enclosures.}, journal = {Animal cognition}, volume = {20}, number = {1}, pages = {43-51}, doi = {10.1007/s10071-016-1047-5}, pmid = {27796660}, issn = {1435-9456}, mesh = {Animals ; Animals, Zoo ; Birds ; Cities ; *Crows ; *Vocalization, Animal ; }, abstract = {Urban animals and birds in particular are able to cope with diverse novel threats in a city environment such as avoiding novel, unfamiliar predators. Predator avoidance often includes alarm signals that can be used also by hetero-specifics, which is mainly the case in mixed-species flocks. It can also occur when species do not form flocks but co-occur together. In this study we tested whether urban crows use alarm calls of conspecifics and hetero-specifics (jackdaws, Corvus monedula) differently in a predator and a non-predator context with partly novel and unfamiliar zoo animal species. Birds were tested at the Tiergarten Schönbrunn in the city of Vienna by playing back con- and hetero-specific alarm calls and control stimuli (great tit song and no stimuli) at predator (wolf, polar bear) and non-predator (eland antelope and cranes, peccaries) enclosures. We recorded responses of crows as the percentage of birds flying away after hearing the playback (out of those present before the playback) and as the number of vocalizations given by the present birds. A significantly higher percentage of crows flew away after hearing either con- or hetero-specific alarm calls, but it did not significantly differ between the predator and the non-predator context. Crows treated jackdaw calls just as crow calls, indicating that they make proper use of hetero-specific alarm calls. Responding similarly in both contexts may suggest that the crows were uncertain about the threat a particular zoo animal represents and were generally cautious. In the predator context, however, a high percentage of crows also flew away upon hearing the great tit control song which suggests that they may still evaluate those species which occasionally killed crows as more dangerous and respond to any conspicuous sound.}, }
@article {pmid27796282, year = {2016}, author = {Vijay, N and Bossu, CM and Poelstra, JW and Weissensteiner, MH and Suh, A and Kryukov, AP and Wolf, JB}, title = {Evolution of heterogeneous genome differentiation across multiple contact zones in a crow species complex.}, journal = {Nature communications}, volume = {7}, number = {}, pages = {13195}, doi = {10.1038/ncomms13195}, pmid = {27796282}, issn = {2041-1723}, support = {//European Research Council/International ; }, abstract = {Uncovering the genetic basis of species diversification is a central goal in evolutionary biology. Yet, the link between the accumulation of genomic changes during population divergence and the evolutionary forces promoting reproductive isolation is poorly understood. Here, we analysed 124 genomes of crow populations with various degrees of genome-wide differentiation, with parallelism of a sexually selected plumage phenotype, and ongoing hybridization. Overall, heterogeneity in genetic differentiation along the genome was best explained by linked selection exposed on a shared genome architecture. Superimposed on this common background, we identified genomic regions with signatures of selection specific to independent phenotypic contact zones. Candidate pigmentation genes with evidence for divergent selection were only partly shared, suggesting context-dependent selection on a multigenic trait architecture and parallelism by pathway rather than by repeated single-gene effects. This study provides insight into how various forms of selection shape genome-wide patterns of genomic differentiation as populations diverge.}, }
@article {pmid27736787, year = {2016}, author = {Weis, AM and Storey, DB and Taff, CC and Townsend, AK and Huang, BC and Kong, NT and Clothier, KA and Spinner, A and Byrne, BA and Weimer, BC}, title = {Genomic Comparison of Campylobacter spp. and Their Potential for Zoonotic Transmission between Birds, Primates, and Livestock.}, journal = {Applied and environmental microbiology}, volume = {82}, number = {24}, pages = {7165-7175}, doi = {10.1128/AEM.01746-16}, pmid = {27736787}, issn = {1098-5336}, support = {U01 FD003572/FD/FDA HHS/United States ; }, mesh = {Animals ; Animals, Wild/microbiology ; Bird Diseases/*microbiology/transmission ; Birds/microbiology ; Campylobacter/classification/*genetics/isolation &amp; purification/physiology ; Campylobacter Infections/*microbiology/transmission/*veterinary ; Cattle ; Genome, Bacterial ; Genomics ; Genotype ; Humans ; Livestock/microbiology ; Phylogeny ; Primate Diseases/*microbiology/transmission ; Primates/microbiology ; Sheep ; Zoonoses/*microbiology/transmission ; }, abstract = {Campylobacter is the leading cause of human gastroenteritis worldwide. Wild birds, including American crows, are abundant in urban, suburban, and agricultural settings and are likely zoonotic vectors of Campylobacter Their proximity to humans and livestock increases the potential spreading of Campylobacter via crows between the environment, livestock, and humans. However, no studies have definitively demonstrated that crows are a vector for pathogenic Campylobacter We used genomics to evaluate the zoonotic and pathogenic potential of Campylobacter from crows to other animals with 184 isolates obtained from crows, chickens, cows, sheep, goats, humans, and nonhuman primates. Whole-genome analysis uncovered two distinct clades of Campylobacter jejuni genotypes; the first contained genotypes found only in crows, while a second genotype contained &quot;generalist&quot; genomes that were isolated from multiple host species, including isolates implicated in human disease, primate gastroenteritis, and livestock abortion. Two major β-lactamase genes were observed frequently in these genomes (oxa-184, 55%, and oxa-61, 29%), where oxa-184 was associated only with crows and oxa-61 was associated with generalists. Mutations in gyrA, indicative of fluoroquinolone resistance, were observed in 14% of the isolates. Tetracycline resistance (tetO) was present in 22% of the isolates, yet it occurred in 91% of the abortion isolates. Virulence genes were distributed throughout the genomes; however, cdtC alleles recapitulated the crow-only and generalist clades. A specific cdtC allele was associated with abortion in livestock and was concomitant with tetO These findings indicate that crows harboring a generalist C. jejuni genotype may act as a vector for the zoonotic transmission of Campylobacter IMPORTANCE: This study examined the link between public health and the genomic variation of Campylobacter in relation to disease in humans, primates, and livestock. Use of large-scale whole-genome sequencing enabled population-level assessment to find new genes that are linked to livestock disease. With 184 Campylobacter genomes, we assessed virulence traits, antibiotic resistance susceptibility, and the potential for zoonotic transfer to observe that there is a &quot;generalist&quot; genotype that may move between host species.}, }
@article {pmid27534728, year = {2016}, author = {Suzuki, K and Edelson, A and Iversen, LL and Hausmann, L and Schulz, JB and Turner, AJ}, title = {A Learned Society's Perspective on Publishing.}, journal = {Journal of neurochemistry}, volume = {139 Suppl 2}, number = {}, pages = {17-23}, doi = {10.1111/jnc.13674}, pmid = {27534728}, issn = {1471-4159}, mesh = {*Editorial Policies ; Humans ; Learning ; Neurochemistry/methods/*trends ; Peer Review/methods/trends ; Periodicals as Topic/*trends ; Publishing/trends ; Societies, Scientific/*trends ; }, abstract = {Scientific journals that are owned by a learned society, like the Journal of Neurochemistry (JNC), which is owned by the International Society for Neurochemistry (ISN), benefit the scientific community in that a large proportion of the income is returned to support the scientific mission of the Society. The income generated by the JNC enables the ISN to organize conferences as a platform for members and non-members alike to share their research, supporting researchers particularly in developing countries by travel grants and other funds, and promoting education in student schools. These direct benefits and initiatives for ISN members and non-members distinguish a society journal from pure commerce. However, the world of scholarly publishing is changing rapidly. Open access models have challenged the business model of traditional journal subscription and hence provided free access to publicly funded scientific research. In these models, the manuscript authors pay a publication cost after peer review and acceptance of the manuscript. Over the last decade, numerous new open access journals have been launched and traditional subscription journals have started to offer open access (hybrid journals). However, open access journals follow the general scheme that, of all participating parties, the publisher receives the highest financial benefit. The income is generated by researchers whose positions and research are mostly financed by taxpayers' or funders' money, and by reviewers and editors, who frequently are not reimbursed. Last but not least, the authors pay for the publication of their work after a rigorous and sometimes painful review process. JNC itself has an open access option, at a significantly reduced cost for Society members as an additional benefit. This article provides first-hand insights from two former Editors-in-Chief, Kunihiko Suzuki and Leslie Iversen, about the history of JNC's ownership and about the difficulties and battles fought along the way to its current success and reputation. Scientific journals that are owned by a learned society, like the Journal of Neurochemistry (JNC) which is owned by the International Society for Neurochemistry (ISN), benefit the scientific community in that a large proportion of the income is returned to support the scientific mission of the Society. The income generated by the JNC enables the ISN to organize conferences as a platform for members and non-members alike to share their research, supporting researchers particularly in developing countries by travel grants and other funds, and to promote education in student schools. These direct benefits and initiatives for ISN members and non-members distinguish a society journal from pure commerce. However, the world of scholarly publishing is changing rapidly. Open access models have challenged the business model of traditional journal subscription and hence provide free access to publicly funded scientific research. In these models, the manuscript authors pay a publication cost after peer review and acceptance of the manuscript. Over the last decade, numerous new open access journals have been launched and traditional subscription journals have started to offer open access (hybrid journals). However, open access journals pertain to the general scheme that, of all participating parties, the publisher receives the highest financial benefit. The income is generated by researchers whose positions and research are mostly financed by tax payers' or funders' money, reviewers and editors, who frequently are not reimbursed. Last but not least, the authors pay for the publication of their work after a rigorous and sometimes painful review process. JNC itself has an open access option, at a significantly reduced cost for Society members as an additional benefit. This article provides first-hand insights from a long-standing Editor-in-Chief, Kunihiko Suzuki, about the history of JNC's ownership and about difficulties and battles fought on the way to its current success and reputation today. This article is part of the 60th Anniversary special issue.}, }
@article {pmid27790103, year = {2016}, author = {Casanova, R and Wang, X and Reyes, J and Akita, Y and Serre, ML and Vizuete, W and Chui, HC and Driscoll, I and Resnick, SM and Espeland, MA and Chen, JC}, title = {A Voxel-Based Morphometry Study Reveals Local Brain Structural Alterations Associated with Ambient Fine Particles in Older Women.}, journal = {Frontiers in human neuroscience}, volume = {10}, number = {}, pages = {495}, doi = {10.3389/fnhum.2016.00495}, pmid = {27790103}, issn = {1662-5161}, support = {P30 ES007048/ES/NIEHS NIH HHS/United States ; P30 ES010126/ES/NIEHS NIH HHS/United States ; P50 AG005142/AG/NIA NIH HHS/United States ; R21 AG051113/AG/NIA NIH HHS/United States ; UL1 TR001420/TR/NCATS NIH HHS/United States ; }, abstract = {Objective: Exposure to ambient fine particulate matter (PM2.5: PM with aerodynamic diameters < 2.5 μm) has been linked with cognitive deficits in older adults. Using fine-grained voxel-wise analyses, we examined whether PM2.5 exposure also affects brain structure. Methods: Brain MRI data were obtained from 1365 women (aged 71-89) in the Women's Health Initiative Memory Study and local brain volumes were estimated using RAVENS (regional analysis of volumes in normalized space). Based on geocoded residential locations and air monitoring data from the U.S. Environmental Protection Agency, we employed a spatiotemporal model to estimate long-term (3-year average) exposure to ambient PM2.5 preceding MRI scans. Voxel-wise linear regression models were fit separately to gray matter (GM) and white matter (WM) maps to analyze associations between brain structure and PM2.5 exposure, with adjustment for potential confounders. Results: Increased PM2.5 exposure was associated with smaller volumes in both cortical GM and subcortical WM areas. For GM, associations were clustered in the bilateral superior, middle, and medial frontal gyri. For WM, the largest clusters were in the frontal lobe, with smaller clusters in the temporal, parietal, and occipital lobes. No statistically significant associations were observed between PM2.5 exposure and hippocampal volumes. Conclusions: Long-term PM2.5 exposures may accelerate loss of both GM and WM in older women. While our previous work linked smaller WM volumes to PM2.5, this is the first neuroimaging study reporting associations between air pollution exposure and smaller volumes of cortical GM. Our data support the hypothesized synaptic neurotoxicity of airborne particles.}, }
@article {pmid27789089, year = {2016}, author = {Dunn, JC and Gruar, D and Stoate, C and Szczur, J and Peach, WJ}, title = {Can hedgerow management mitigate the impacts of predation on songbird nest survival?.}, journal = {Journal of environmental management}, volume = {184}, number = {Pt 3}, pages = {535-544}, doi = {10.1016/j.jenvman.2016.10.028}, pmid = {27789089}, issn = {1095-8630}, mesh = {Agriculture/*methods ; Animals ; Ecosystem ; England ; *Nesting Behavior ; *Predatory Behavior ; Reproduction ; Songbirds/*physiology ; }, abstract = {Nest predators can have significant impacts on songbird reproductive success. These impacts may be amplified by habitat simplification and here we test whether sympathetic management of farmland hedgerows can reduce nest depredation, especially by corvids. We test whether songbirds select nest sites according to structural features of hedgerows (including nest visibility and accessibility), and whether these features influence nest predation risk. Songbirds selected nesting sites affording higher vegetation cover above the nest, increased visibility on the nest-side of the hedgerow and reduced visibility on the far side of the hedge. Nest survival was unrelated to corvid abundance and only weakly related (at the egg stage) to corvid nest proximity. Nest survival at the chick stage was higher where vegetation structure restricted access to corvid-sized predators (averaging 0.78 vs. 0.53), and at nests close to potential vantage points. Overall nest survival was sensitive to hedgerow structure (accessibility) particularly at low exposure to corvid predation, while the overall impact of corvid exposure was dependent on the relationship involving proximity to vantage points. Nest survival over the chick stage was much higher (0.67) in stock-proof, trimmed and mechanically cut hedgerows, (which tended to provide lower side visibility and accessibility) than in recently laid, remnant or leggy hedgerows (0.18). Long-term reductions in the management of British hedgerows may therefore be exposing nesting songbirds to increased predation risk. We recommend regular rotational cutting of hedgerows to maintain a dense woody structure and thereby reduce songbird nest predation.}, }
@article {pmid27709968, year = {2016}, author = {Ostojić, L and Legg, EW and Dits, A and Williams, N and Brecht, KF and Mendl, M and Clayton, NS}, title = {Experimenter expectancy bias does not explain Eurasian jays' (Garrulus glandarius) performance in a desire-state attribution task.}, journal = {Journal of comparative psychology (Washington, D.C. : 1983)}, volume = {130}, number = {4}, pages = {407-410}, doi = {10.1037/com0000043}, pmid = {27709968}, issn = {1939-2087}, mesh = {Animals ; *Bias ; *Feeding Behavior ; Female ; *Food ; Male ; *Motivation ; Passeriformes/*physiology ; *Social Behavior ; Social Perception ; }, abstract = {Male Eurasian jays have been found to adjust the type of food they share with their female partner after seeing her eat 1 type of food to satiety. One interpretation of this behavior is that the male encoded the female's decreased desire for the food she was sated on, and adjusted his behavior accordingly. However, in these studies, the male's actions were scored by experimenters who knew on which food the female was sated. Thus, it is possible that the experimenters' expectations (subconsciously) affected their behavior during tests that, in turn, inadvertently could have influenced the males' actions. Here, we repeated the original test with an experimenter who was blind to the food on which the female was sated. This procedure yielded the same results as the original studies: The male shared food with the female that was in line with her current desire. Thus, our results rule out the possibility that the Eurasian jay males' actions in the food sharing task could be explained by the effects of an experimenter expectancy bias. (PsycINFO Database Record}, }
@article {pmid27781155, year = {2016}, author = {Lees, JJ and Dimitriadis, G and Nudds, RL}, title = {The influence of flight style on the aerodynamic properties of avian wings as fixed lifting surfaces.}, journal = {PeerJ}, volume = {4}, number = {}, pages = {e2495}, doi = {10.7717/peerj.2495}, pmid = {27781155}, issn = {2167-8359}, abstract = {The diversity of wing morphologies in birds reflects their variety of flight styles and the associated aerodynamic and inertial requirements. Although the aerodynamics underlying wing morphology can be informed by aeronautical research, important differences exist between planes and birds. In particular, birds operate at lower, transitional Reynolds numbers than do most aircraft. To date, few quantitative studies have investigated the aerodynamic performance of avian wings as fixed lifting surfaces and none have focused upon the differences between wings from different flight style groups. Dried wings from 10 bird species representing three distinct flight style groups were mounted on a force/torque sensor within a wind tunnel in order to test the hypothesis that wing morphologies associated with different flight styles exhibit different aerodynamic properties. Morphological differences manifested primarily as differences in drag rather than lift. Maximum lift coefficients did not differ between groups, whereas minimum drag coefficients were lowest in undulating flyers (Corvids). The lift to drag ratios were lower than in conventional aerofoils and data from free-flying soaring species; particularly in high frequency, flapping flyers (Anseriformes), which do not rely heavily on glide performance. The results illustrate important aerodynamic differences between the wings of different flight style groups that cannot be explained solely by simple wing-shape measures. Taken at face value, the results also suggest that wing-shape is linked principally to changes in aerodynamic drag, but, of course, it is aerodynamics during flapping and not gliding that is likely to be the primary driver.}, }
@article {pmid27779445, year = {2017}, author = {Hirst, RB and Teague, AM and Sodos, LM and Wickham, RE and Whittington, LT and Mills, BM and Earleywine, M}, title = {Determining Cannabis Use Status From a Photograph: An Assessment of the &quot;Jay-dar&quot; in Neuropsychologists.}, journal = {Substance use &amp; misuse}, volume = {52}, number = {3}, pages = {401-410}, doi = {10.1080/10826084.2016.1233564}, pmid = {27779445}, issn = {1532-2491}, mesh = {Adult ; Aged ; Humans ; Male ; Marijuana Abuse/*diagnosis/psychology ; Middle Aged ; *Neuropsychology ; Photography ; }, abstract = {BACKGROUND: Few studies examining the cognitive effects of chronic cannabis use utilize research designs where examiners are blind to user status. Even in those that do, researchers may be able to guess the user status of participants, leaving these studies vulnerable to the expectancy effect confound.<br><br>OBJECTIVES: The present study examined the ability of neuropsychologists (those who would conduct research on the cognitive effects of cannabis) to differentiate cannabis users and nonusers based on physical appearance from photographs.<br><br>METHOD: We recruited 84 participants from an international neuropsychology listserv. The sample was 59.5% female and 95.2% Caucasian, with a mean age of 41.39 years (range 26-65). Each neuropsychologist rated 25 target faces (12 cannabis users, 13 nonusers) on a Marijuana Use Likelihood Index based upon individuals' photographs.<br><br>RESULTS: Results indicate a main effect of user group, as neuropsychologists ascribed higher ratings to cannabis users on the Marijuana Use Likelihood Index, suggesting they perceive them as more likely to be users, relative to nonusers. Results also demonstrated a main effect of gender, as males received higher user ratings than females, and a significant main effect of rater gender, as female raters were more likely to rate individuals as cannabis users relative to male raters. Conclusions/Importance: The results demonstrate the importance of assessing researchers' expectations when studying the effects of chronic cannabis use, as even those designs that keep examiners blind to participant user status may be vulnerable to expectancy effects if examiners are able to guess user status based upon appearance alone.}, }
@article {pmid27776017, year = {2016}, author = {Sheynkin, Y and Baron, P and Schulsinger, D}, title = {Levi Jay Hammond and the First Human Organ Transplantations in 1911.}, journal = {Transplantation}, volume = {100}, number = {11}, pages = {2241-2243}, doi = {10.1097/TP.0000000000001499}, pmid = {27776017}, issn = {1534-6080}, mesh = {Animals ; Biomedical Research/*history ; History, 20th Century ; Humans ; Organ Transplantation/*history ; United States ; }, }
@article {pmid27718536, year = {2017}, author = {Wagener, L and Nieder, A}, title = {Encoding of global visual motion in the nidopallium caudolaterale of behaving crows.}, journal = {The European journal of neuroscience}, volume = {45}, number = {2}, pages = {267-277}, doi = {10.1111/ejn.13430}, pmid = {27718536}, issn = {1460-9568}, mesh = {Animals ; Behavior, Animal/*physiology ; Brain/physiology ; Cognition/*physiology ; Crows ; *Motion ; Motion Perception/*physiology ; Neurons/*physiology ; Photic Stimulation/methods ; Songbirds ; Telencephalon/*physiology ; }, abstract = {Songbirds possess acute vision. How higher brain centres represent basic and parameterised visual stimuli to process sensory signals according to their behavioural importance has not been studied in a systematic way. We therefore examined how carrion crows (Corvus corone) and their nidopallial visual neurons process global visual motion information in dynamic random-dot displays during a delayed match-to-sample (DMS) task. The behavioural data show that moderately fast motion speeds (16° of visual angle/s) result in superior direction discrimination performance. To characterise how neurons encode and maintain task-relevant visual motion information, we recorded the single-unit activity in the telencephalic association area 'nidopallium caudolaterale' (NCL) of behaving crows. The NCL is considered to be the avian analogue of the mammalian prefrontal cortex. Almost a third (28%) of randomly selected NCL neurons responded selectively to the motion direction of the sample stimulus, mostly to downward motions. Only few NCL neurons (7.5%) responded consistently to specific motion directions during the delay period. In error trials, when the crows chose the wrong motion direction, the encoding of motion direction was significantly reduced. This indicates that sensory representations of NCL neurons are relevant to the birds' behaviour. These data suggest that the corvid NCL, even though operating at the apex of the telencephalic processing hierarchy, constitutes a telencephalic site for global motion integration.}, }
@article {pmid27669429, year = {2016}, author = {Kiel, JM}, title = {Using Organizational Development for Electronic Medical Record Transformation.}, journal = {The health care manager}, volume = {35}, number = {4}, pages = {305-311}, doi = {10.1097/HCM.0000000000000131}, pmid = {27669429}, issn = {1550-512X}, mesh = {Delivery of Health Care ; Electronic Health Records/*organization &amp; administration ; Humans ; *Models, Organizational ; *Organizational Innovation ; }, abstract = {With mandates requiring the transition from paper medical records to the use of electronic medical records, organizations are embarking on a change process. To engender this process, organizational development models and interventions based predominantly on the theories of Chris Argyris, Warren Bennis, and the team of Paul Lawrence and Jay Lorsch are explored. Interventions are subdivided into behavioral and structural as organizations benefit by recognizing a need for change and, perhaps, a cultural shift in addition to refocusing their mission. To support these interventions, a champion or super user is recommended to maintain the momentum of the transformation and enculturation. With so many changes in the internal and external environments, organizations must respond systematically for, in health care, lives depend on it.}, }
@article {pmid27757574, year = {2017}, author = {McIntosh, CS and Dadour, IR and Voss, SC}, title = {A comparison of carcass decomposition and associated insect succession onto burnt and unburnt pig carcasses.}, journal = {International journal of legal medicine}, volume = {131}, number = {3}, pages = {835-845}, doi = {10.1007/s00414-016-1464-7}, pmid = {27757574}, issn = {1437-1596}, mesh = {Animals ; Case-Control Studies ; *Coleoptera ; *Cremation ; *Diptera ; Entomology ; *Feeding Behavior ; Forensic Sciences ; *Postmortem Changes ; Swine ; Western Australia ; }, abstract = {The rate of decomposition and insect succession onto decomposing pig carcasses were investigated following burning of carcasses. Ten pig carcasses (40-45 kg) were exposed to insect activity during autumn (March-April) in Western Australia. Five replicates were burnt to a degree described by the Crow-Glassman Scale (CGS) level #2, while five carcasses were left unburnt as controls. Burning carcasses greatly accelerated decomposition in contrast to unburnt carcasses. Physical modifications following burning such as skin discolouration, splitting of abdominal tissue and leathery consolidation of skin eliminated evidence of bloat and altered microambient temperatures associated with carcasses throughout decomposition. Insect species identified on carcasses were consistent between treatment groups; however, a statistically significant difference in insect succession onto remains was evident between treatments (PERMANOVA F (1, 224) = 14.23, p < 0.01) during an 8-day period that corresponds with the wet stage of decomposition. Differences were noted in the arrival time of late colonisers (Coleoptera) and the development of colonising insects between treatment groups. Differences in the duration of decomposition stages and insect assemblages indicate that burning has an effect on both rate of decomposition and insect succession. The findings presented here provide baseline data for entomological casework involving burnt remains criminal investigations.}, }
@article {pmid27288106, year = {2016}, author = {Friedman, SG}, title = {Credit where due.}, journal = {Journal of vascular surgery}, volume = {64}, number = {2}, pages = {530-533}, doi = {10.1016/j.jvs.2016.04.033}, pmid = {27288106}, issn = {1097-6809}, mesh = {Biomedical Research/*history ; *Cooperative Behavior ; Correspondence as Topic/history ; History, 20th Century ; Humans ; *Nobel Prize ; Periodicals as Topic/history ; Personality ; Recognition (Psychology) ; Vascular Surgical Procedures/*history ; }, abstract = {The history of medicine is filled with stories of tireless researchers who failed to get credit for their hard work. Examples of this include Rosalind Franklin, who helped to elucidate the structure of DNA; Frederick Banting, who helped to discover insulin; and Jay McLean, who discovered heparin. The founding of the field of vascular surgery provides one of the most vivid examples of uncredited work. Even though Alexis Carrel was an unpaid, untitled assistant in Charles Guthrie's laboratory, it was Carrel alone who received a Nobel Prize for their work. In an attempt to give credit where due, the reasons for this injustice are described.}, }
@article {pmid27746026, year = {2016}, author = {Chen, N and Cosgrove, EJ and Bowman, R and Fitzpatrick, JW and Clark, AG}, title = {Genomic Consequences of Population Decline in the Endangered Florida Scrub-Jay.}, journal = {Current biology : CB}, volume = {26}, number = {21}, pages = {2974-2979}, doi = {10.1016/j.cub.2016.08.062}, pmid = {27746026}, issn = {1879-0445}, support = {R01 GM108779/GM/NIGMS NIH HHS/United States ; }, mesh = {Animals ; Endangered Species ; Florida ; *Gene Flow ; *Genetic Fitness ; *Genome ; *Inbreeding ; Life History Traits ; Phenotype ; Population Dynamics ; Songbirds/*genetics ; }, abstract = {Understanding the population genetic consequences of declining population size is important for conserving the many species worldwide facing severe decline [1]. Thorough empirical studies on the impacts of population reduction at a genome-wide scale in the wild are scarce because they demand huge field and laboratory investments [1, 2]. Previous studies have demonstrated the importance of gene flow in introducing genetic variation to small populations [3], but few have documented both genetic and fitness consequences of decreased immigration through time in a natural population [4-6]. Here we assess temporal variation in gene flow, inbreeding, and fitness using longitudinal genomic, demographic, and phenotypic data from a long-studied population of federally Threatened Florida scrub-jays (Aphelocoma coerulescens). We exhaustively sampled and genotyped the study population over two decades, providing one of the most detailed longitudinal investigations of genetics in a wild animal population to date. Immigrants were less heterozygous than residents but still introduced genetic variation into our study population. Owing to regional population declines, immigration into the study population declined from 1995-2013, resulting in increased levels of inbreeding and reduced fitness via inbreeding depression, even as the population remained demographically stable. Our results show that, contrary to conventional wisdom, small peripheral populations that already have undergone a genetic bottleneck may play a vital role in preserving genetic diversity of larger and seemingly stable populations. These findings underscore the importance of investing in the persistence of small populations and maintaining population connectivity in conservation of fragmented species.}, }
@article {pmid27745723, year = {2018}, author = {Guillod, L and Habersaat, S and Suter, M and Jeanneret, T and Bertoni, C and Stéphan, P and Urben, S}, title = {[Psychological processes of stress management and neuroendocrine regulation in incarcerated adolescent offenders: A pilot study].}, journal = {L'Encephale}, volume = {44}, number = {2}, pages = {111-117}, doi = {10.1016/j.encep.2016.08.012}, pmid = {27745723}, issn = {0013-7006}, abstract = {BACKGROUND: Adolescence is a stressful period where important biological, psychological and social changes occur. Adolescents are particularly vulnerable during this developmental period and can use various strategies to deal with daily stress, such as substance use or externalizing behaviors. In previous studies, stress in adolescents with externalizing behaviors was often linked to ineffective cognitive coping strategies (i.e., constructive thinking) and overlooking the biological aspects involved in stress management such as neuroendocrine regulation. Indeed, repeated activation of the hypothalamic-pituitary-adrenal (HPA) axis in chronic stress situations may have long-term effects on subsequent cortisol regulation and lead to psychological difficulties. It was also shown that basal cortisol levels are lower in adolescents with externalizing behaviors. This study aims to assess the links between constructive thinking and neuroendocrine regulation in adolescent offenders and their association with externalizing symptoms (e.g., aggression, delinquency, psychopathic traits, substance use). Identifying particular biopsychological patterns can help to better understand stress management in youth with externalizing behaviors and to improve clinical treatments.<br><br>METHOD: Sixteen adolescent males aged from 12 to 18 years were recruited in an institution for juvenile offenders. Exclusion criteria were insufficient reasoning abilities assessed using the Raven Matrices Test. Regarding psychological dimensions, constructive thinking was assessed through the Constructive thinking inventory (CTI), psychopathic traits through the Youth psychopathic traits inventory (YPI), externalizing behaviors through 30 items (out of 113) and 2 subscales (aggressive behavior and delinquency problems) from the Child behavior checklist-youth self-report (CBCL), and substance use through the Dep-ado. Regarding biological dimensions, cortisol daily secretion and regulation were assessed through saliva samples that were collected during 3 consecutive days (4 samples per day: directly after awakening, at 10 a.m., at 4 a.m., and before going to bed).<br><br>RESULTS: Adolescent offenders presented maladaptative thinking styles and a particular neuroendocrine regulation in their daily management with stress. In particular, their level of cortisol in the morning was higher than those expected in a general population (20.34 nmol/L while the norm is around 10 nmol/L). They also showed more agressive and delinquent behaviors (CBCL) as well as more psychopathic traits (YPI) than the general population. Moreover, constructive thinking style was associated with personality and behavioral dimensions. Indeed, results indicated positive and significant correlations between categorical thinking style (CTI), psychopathic traits (YPI) (r=0.57, P=0.021) and externalizing behaviors (CBCL) (r=0.55, P=0.028). In other words, the more adolescent offenders used categorical thinking, the more they presented psychopathic traits and externalizing behaviors. With respect to the association between psychological and biological dimensions in stress management, we observed a significant and positive correlation between cortisol regulation and esoteric thinking (r=0.57, P=0.028) and a trend with superstitious thinking (r=0.47, P=0.075). The more adolescent offenders used esoteric and superstitious thinking, the poorer was their cortisol regulation. We also observed a trend between the life style scale of the YPI (i.e., impulsive, irresponsible) and the daily secretion of cortisol (r=0.51; P=0.052) as well as cortisol regulation (r=0.49, P=0.065). The more adolescent offenders presented psychopathic traits, the higher tended to be their daily secretion of cortisol and the poorer their cortisol regulation. Finally, cortisol regulation (r=0.54, P=0.038) and secretion (r=0.73, P=0.002) were significantly correlated with the DEP-Ado score. In other words, a poor cortisol regulation and a high secretion of cortisol seem to be associated with substance use.<br><br>CONCLUSIONS: Adolescent offenders face an important amount of daily stress and do not always have the appropriate skills to deal with it. Indeed, we know from clinical experience that they often report a sense of hopelessness toward their lack of professional perspectives as well as familial conflicts which can be important stressors in addition to the incarceration in itself. Therefore, treatment aiming to improve psychic elaboration can help these adolescents to make their thinking styles more flexible and use more appropriate ways of coping with stress instead of externalizing behaviors and substance use. Moreover, considering the complex cases of these adolescents and the many changes of caregivers and institutions where they have lived, which can be important stressors as well, professionals working with these youth should be aware of their emotional reactions toward them and try to encourage continuity of care.}, }
@article {pmid27738383, year = {2016}, author = {Królikowska, N and Szymkowiak, J and Laidlaw, RA and Kuczyński, L}, title = {Threat-sensitive anti-predator defence in precocial wader, the northern lapwing Vanellus vanellus.}, journal = {Acta ethologica}, volume = {19}, number = {3}, pages = {163-171}, doi = {10.1007/s10211-016-0236-1}, pmid = {27738383}, issn = {0873-9749}, abstract = {Birds exhibit various forms of anti-predator behaviours to avoid reproductive failure, with mobbing-observation, approach and usually harassment of a predator-being one of the most commonly observed. Here, we investigate patterns of temporal variation in the mobbing response exhibited by a precocial species, the northern lapwing (Vanellus vanellus). We test whether brood age and self-reliance, or the perceived risk posed by various predators, affect mobbing response of lapwings. We quantified aggressive interactions between lapwings and their natural avian predators and used generalized additive models to test how timing and predator species identity are related to the mobbing response of lapwings. Lapwings diversified mobbing response within the breeding season and depending on predator species. Raven Corvus corax, hooded crow Corvus cornix and harriers evoked the strongest response, while common buzzard Buteo buteo, white stork Ciconia ciconia, black-headed gull Chroicocephalus ridibundus and rook Corvus frugilegus were less frequently attacked. Lapwings increased their mobbing response against raven, common buzzard, white stork and rook throughout the breeding season, while defence against hooded crow, harriers and black-headed gull did not exhibit clear temporal patterns. Mobbing behaviour of lapwings apparently constitutes a flexible anti-predator strategy. The anti-predator response depends on predator species, which may suggest that lapwings distinguish between predator types and match mobbing response to the perceived hazard at different stages of the breeding cycle. We conclude that a single species may exhibit various patterns of temporal variation in anti-predator defence, which may correspond with various hypotheses derived from parental investment theory.}, }
@article {pmid27736663, year = {2016}, author = {Peviani, V and Scarpa, P and Toraldo, A and Bottini, G}, title = {Accounting for ethnic-cultural and linguistic diversity in neuropsychological assessment of patients with drug-resistant epilepsy: A retrospective study.}, journal = {Epilepsy &amp; behavior : E&amp;B}, volume = {64}, number = {Pt A}, pages = {94-101}, doi = {10.1016/j.yebeh.2016.09.011}, pmid = {27736663}, issn = {1525-5069}, mesh = {*Acculturation ; Adult ; Cognitive Dysfunction/*diagnosis/*ethnology/etiology ; Drug Resistant Epilepsy/complications/*ethnology ; *Emigrants and Immigrants ; Female ; Humans ; Italy/ethnology ; Language Tests/*standards ; Male ; *Multilingualism ; Neuropsychological Tests/*standards ; Retrospective Studies ; Young Adult ; }, abstract = {Neuropsychological assessment is critical in both diagnosis and prognosis of patients with epilepsy. Beyond electrophysiological and anatomical alterations, other factors including different ethnic-cultural and linguistic backgrounds might affect neuropsychological performance. Only a few studies considered migration and acculturation effects and they typically concerned nonclinical samples. The current study aimed at investigating the influence of ethnic background and time spent in Italy on a full neuropsychological battery administered to both Italian and foreign-born patients and at providing a brief interview for obtaining relevant information on each patient's transcultural and language-related history. Clinical reports from 43 foreign-born patients with drug-resistant epilepsy were collected from the archives of Milan Niguarda Hospital. Epileptogenic zone, age, education, profession, illness duration, seizure frequency, handedness, and gender were considered in selecting 43 Italian controls. Ethnicity (Italian/foreign-born) and years spent in Italy were analyzed as main predictors on 21 neuropsychological scales by means of General(ized) Linear Models. An additional analysis studied two composite scores of overall verbal and nonverbal abilities. Ethnicity significantly affected the following: the verbal overall score, Verbal Fluency, Naming, Token-test, Digit Span, Attentional Matrices, Trail-Making-Test, Line-Orientation-Test, and Raven matrices; no effects were found on the nonverbal overall score, Word Pairs Learning, Episodic Memory, reading accuracy, visual span, Bells test, Rey Figure, and face memory and recognition. No significant effects of years spent in Italy emerged. While years spent in Italy does not predict neuropsychological performance, linguistic background had a strong impact on it. With respect to Italian-speaking patients, those who were foreign-born showed large task-related variability, with an especially low performance on language-related tests. Hence, language tests should not be considered as valid measures of neuropsychological impairment in this population, not even in foreign-born patients with good Italian fluency. Clinicians should consider such asymmetries in order to improve the accuracy of neuropsychological assessment of foreign-born patients.}, }
@article {pmid27721395, year = {2016}, author = {Saakian, DB and Yakushkina, T and Hu, CK}, title = {The rich phase structure of a mutator model.}, journal = {Scientific reports}, volume = {6}, number = {}, pages = {34840}, doi = {10.1038/srep34840}, pmid = {27721395}, issn = {2045-2322}, mesh = {*Evolution, Molecular ; *Models, Genetic ; *Mutation ; Mutation Rate ; Selection, Genetic ; }, abstract = {We propose a modification of the Crow-Kimura and Eigen models of biological molecular evolution to include a mutator gene that causes both an increase in the mutation rate and a change in the fitness landscape. This mutator effect relates to a wide range of biomedical problems. There are three possible phases: mutator phase, mixed phase and non-selective phase. We calculate the phase structure, the mean fitness and the fraction of the mutator allele in the population, which can be applied to describe cancer development and RNA viruses. We find that depending on the genome length, either the normal or the mutator allele dominates in the mixed phase. We analytically solve the model for a general fitness function. We conclude that the random fitness landscape is an appropriate choice for describing the observed mutator phenomenon in the case of a small fraction of mutators. It is shown that the increase in the mutation rates in the regular and the mutator parts of the genome should be set independently; only some combinations of these increases can push the complex biomedical system to the non-selective phase, potentially related to the eradication of tumors.}, }
@article {pmid27709603, year = {2017}, author = {Kennedy, JD and Borregaard, MK and Jønsson, KA and Holt, B and Fjeldså, J and Rahbek, C}, title = {Does the colonization of new biogeographic regions influence the diversification and accumulation of clade richness among the Corvides (Aves: Passeriformes)?.}, journal = {Evolution; international journal of organic evolution}, volume = {71}, number = {1}, pages = {38-50}, doi = {10.1111/evo.13080}, pmid = {27709603}, issn = {1558-5646}, mesh = {Animals ; *Biodiversity ; Biological Evolution ; *Genetic Speciation ; Phylogeny ; Songbirds/classification/genetics/*physiology ; }, abstract = {Regional variation in clade richness can be vast, reflecting differences in the dynamics of historical dispersal and diversification among lineages. Although it has been proposed that dispersal into new biogeographic regions may facilitate diversification, to date there has been limited assessment of the importance of this process in the generation, and maintenance, of broad-scale biodiversity gradients. To address this issue, we analytically derive biogeographic regions for a global radiation of passerine birds (the Corvides, c. 790 species) that are highly variable in the geographic and taxonomic distribution of species. Subsequently, we determine rates of historical dispersal between regions, the dynamics of diversification following regional colonization, and spatial variation in the distribution of species that differ in their rates of lineage diversification. The results of these analyses reveal spatiotemporal differences in the build-up of lineages across regions. The number of regions occupied and the rate of transition between regions both predict family richness well, indicating that the accumulation of high clade richness is associated with repeated expansion into new geographic areas. However, only the largest family (the Corvidae) had significantly heightened rates of both speciation and regional transition, implying that repeated regional colonization is not a general mechanism promoting lineage diversification among the Corvides.}, }
@article {pmid27690192, year = {2017}, author = {Mete, A and Rogers, K and Houston, R}, title = {Systemic Collyriclum faba (Trematoda: Collyriclidae) Infection in a Wild Common Raven (Corvus corax).}, journal = {Journal of wildlife diseases}, volume = {53}, number = {1}, pages = {193-196}, doi = {10.7589/2016-02-032}, pmid = {27690192}, issn = {1943-3700}, mesh = {Animals ; Bird Diseases ; California ; Crows/*parasitology ; Trematoda/*isolation &amp; purification ; Trematode Infections/*veterinary ; }, abstract = {A hatch-year Common Raven (Corvus corax) with subcutaneous and internal pseudocysts, filled with fluid, containing a pair of adult trematodes and numerous eggs consistent with Collyriclum faba, died near a riverbank in California, US. While C. faba is incidental in many Passeriformes, this case was a fatal systemic infection.}, }
@article {pmid27688847, year = {2016}, author = {Rahman, NA and Ali, Z and Zuharah, WF and Fadzly, N}, title = {Counting with Colours? Effect of Colours on the Numerical Abilities of House Crows (Corvus splendens) and Common Myna (Acridotheres tristis).}, journal = {Tropical life sciences research}, volume = {27}, number = {2}, pages = {1-12}, doi = {10.21315/tlsr2016.27.2.1}, pmid = {27688847}, issn = {1985-3718}, abstract = {UNLABELLED: We conducted several aviary experiments to investigate the influence of colours in quantity judgments of two species of birds; house crow (Corvus splendens) and common myna (Acridotheres tristis). Different quantity (in seven different food proportions) of mealworms were presented nonsequentially to all birds using artificially coloured red mealworms, for experiment 1, and using artificially coloured green mealworms, for experiment 2. Both red and green coloured mealworms have no significant effect on house crow's quantity judgments (red:<br><br>ANOVA: F6,30 = 1.748, p = 0.144; and green:<br><br>ANOVA: F6,30= 1.085, p = 0.394). Common myna, however, showed a strong influence of red colour in their quantity judgment (<br><br>ANOVA: F6,30 = 2.922, p = 0.023) as they succeeded in choosing the largest amount of food between two cups, but not when offered food using green coloured mealworms (<br><br>ANOVA: F6,30 = 1.183, p = 0.342). In the next experiment, we hypothesised that both house crow and common myna will prefer red coloured food items over green coloured food items, when factors such as the amount of food is equal. We chose to test red and green colours because both colours play an important role in most avian food selections. Results showed that there were no significant differences in the selection of red or green coloured mealworms for both house crows (<br><br>ANOVA: F6,30 = 2.310, p = 0.06) and common myna (<br><br>ANOVA: F6,30 = 0.823, p = 0.561).}, }
@article {pmid27682557, year = {2016}, author = {Bates, J}, title = {Animal magic in tending the sick.}, journal = {Nursing standard (Royal College of Nursing (Great Britain) : 1987)}, volume = {31}, number = {5}, pages = {31}, doi = {10.7748/ns.31.5.31.s33}, pmid = {27682557}, issn = {2047-9018}, mesh = {Animals ; Cats ; Humans ; *Magic ; Pets/*psychology ; United Kingdom ; }, abstract = {Most people are given grapes or flowers when they are ill. My friend got a dead magpie from her moggie Fergus.}, }
@article {pmid27677399, year = {2017}, author = {Scofield, RP and Mitchell, KJ and Wood, JR and De Pietri, VL and Jarvie, S and Llamas, B and Cooper, A}, title = {The origin and phylogenetic relationships of the New Zealand ravens.}, journal = {Molecular phylogenetics and evolution}, volume = {106}, number = {}, pages = {136-143}, doi = {10.1016/j.ympev.2016.09.022}, pmid = {27677399}, issn = {1095-9513}, mesh = {Animals ; Australia ; Biological Evolution ; Crows/*classification/genetics ; Cytochromes b/classification/genetics/metabolism ; DNA/chemistry/isolation &amp; purification/metabolism ; Fossils ; New Zealand ; Phylogeny ; Sequence Alignment ; Sequence Analysis, DNA ; Skull/anatomy &amp; histology ; }, abstract = {The relationships of the extinct New Zealand ravens (Corvus spp.) are poorly understood. We sequenced the mitogenomes of the two currently recognised species and found they were sister-taxa to a clade comprising the Australian raven, little raven, and forest raven (C.coronoides, C. mellori and C. tasmanicus respectively). The divergence between the New Zealand ravens and Australian raven clade occurred in the latest Pliocene, which coincides with the onset of glacial deforestation. We also found that the divergence between the two putative New Zealand species C. antipodum and C. moriorum probably occurred in the late Pleistocene making their separation as species untenable. Consequently, we consider Corax antipodum (Forbes, 1893) to be a subspecies of Corvus moriorum Forbes, 1892. We re-examine the osteological evidence that led 19th century researchers to assign the New Zealand taxa to a separate genus, and re-assess these features in light of our new phylogenetic hypotheses. Like previous researchers, we conclude that the morphology of the palate of C. moriorum is unique among the genus Corvus, and suggest this may be an adaptation for a specialist diet.}, }
@article {pmid27672510, year = {2016}, author = {Maslo, B and Schlacher, TA and Weston, MA and Huijbers, CM and Anderson, C and Gilby, BL and Olds, AD and Connolly, RM and Schoeman, DS}, title = {Regional drivers of clutch loss reveal important trade-offs for beach-nesting birds.}, journal = {PeerJ}, volume = {4}, number = {}, pages = {e2460}, doi = {10.7717/peerj.2460}, pmid = {27672510}, issn = {2167-8359}, abstract = {Coastal birds are critical ecosystem constituents on sandy shores, yet are threatened by depressed reproductive success resulting from direct and indirect anthropogenic and natural pressures. Few studies examine clutch fate across the wide range of environments experienced by birds; instead, most focus at the small site scale. We examine survival of model shorebird clutches as an index of true clutch survival at a regional scale (∼200 km), encompassing a variety of geomorphologies, predator communities, and human use regimes in southeast Queensland, Australia. Of the 132 model nests deployed and monitored with cameras, 45 (34%) survived the experimental exposure period. Thirty-five (27%) were lost to flooding, 32 (24%) were depredated, nine (7%) buried by sand, seven (5%) destroyed by people, three (2%) failed by unknown causes, and one (1%) was destroyed by a dog. Clutch fate differed substantially among regions, particularly with respect to losses from flooding and predation. 'Topographic' exposure was the main driver of mortality of nests placed close to the drift line near the base of dunes, which were lost to waves (particularly during storms) and to a lesser extent depredation. Predators determined the fate of clutches not lost to waves, with the depredation probability largely influenced by region. Depredation probability declined as nests were backed by higher dunes and were placed closer to vegetation. This study emphasizes the scale at which clutch fate and survival varies within a regional context, the prominence of corvids as egg predators, the significant role of flooding as a source of nest loss, and the multiple trade-offs faced by beach-nesting birds and those that manage them.}, }
@article {pmid27668272, year = {2016}, author = {McKay, HS and Bream, JH and Margolick, JB and Martínez-Maza, O and Magpantay, LI and Phair, JP and Rinaldo, CR and Abraham, AG and Jacobson, LP}, title = {Data on serologic inflammatory biomarkers assessed using multiplex assays and host characteristics in the Multicenter AIDS Cohort Study (MACS).}, journal = {Data in brief}, volume = {9}, number = {}, pages = {262-270}, doi = {10.1016/j.dib.2016.08.019}, pmid = {27668272}, issn = {2352-3409}, support = {U01 AI035042/AI/NIAID NIH HHS/United States ; U01 AI035041/AI/NIAID NIH HHS/United States ; UM1 AI035043/AI/NIAID NIH HHS/United States ; U01 AI035043/AI/NIAID NIH HHS/United States ; UM1 AI068613/AI/NIAID NIH HHS/United States ; U01 AI035040/AI/NIAID NIH HHS/United States ; U01 AI035039/AI/NIAID NIH HHS/United States ; }, abstract = {This article contains data on the associations between fixed and modifiable host characteristics and twenty-three biomarkers of inflammation and immune activation measured longitudinally in a cohort of 250 HIV-uninfected men from the Multicenter AIDS Cohort Study (1984-2009) after adjusting for age, study site, and blood draw time of day using generalized gamma regression. This article also presents associations between each biomarker and each host characteristic in a sample restricted to 2001-2009. These data are supplemental to our original research article entitled &quot;Host factors associated with serologic inflammatory markers assessed using multiplex assays&quot; (McKay, S. Heather, Bream, H. Jay, Margolick, B. Joseph, Martínez-Maza, Otoniel, Phair, P. John, Rinaldo, R. Charles, Abraham, G. Alison, L.P. Jacobson, 2016) [1].}, }
@article {pmid27658204, year = {2016}, author = {Eimes, JA and Lee, SI and Townsend, AK and Jablonski, P and Nishiumi, I and Satta, Y}, title = {Early Duplication of a Single MHC IIB Locus Prior to the Passerine Radiations.}, journal = {PloS one}, volume = {11}, number = {9}, pages = {e0163456}, doi = {10.1371/journal.pone.0163456}, pmid = {27658204}, issn = {1932-6203}, abstract = {A key characteristic of MHC genes is the persistence of allelic lineages over macroevolutionary periods, often through multiple speciation events. This phenomenon, known as trans-species polymorphism (TSP), is well documented in several major taxonomic groups, but has less frequently been observed in birds. The order Passeriformes is arguably the most successful terrestrial vertebrate order in terms of diversity of species and ecological range, but the reasons for this success remain unclear. Passerines exhibit the most highly duplicated MHC genes of any major vertebrate taxonomic group, which may generate increased immune response relative to other avian orders with fewer MHC loci. Here, we describe phylogenetic patterns of the MHC IIB in the passerine family Corvidae. Our results indicate wide-spread TSP within this family, with at least four supported MHC IIB allelic lineages that predate speciation by many millions of years. Markov chain Monte Carlo simulations indicate that divergence of these lineages occurred near the time of the divergence of the Passeriformes and other avian orders. We suggest that the current MHC diversity observed in passerines is due in part to the multiple duplication of a single MHC locus, DAB1, early in passerine evolution and that subsequent duplications of these paralogues have contributed to the enormous success of this order by increasing their ability to recognize and mount immune responses to novel pathogens.}, }
@article {pmid27639565, year = {2016}, author = {van Horik, JO and Emery, NJ}, title = {Transfer of physical understanding in a non-tool-using parrot.}, journal = {Animal cognition}, volume = {19}, number = {6}, pages = {1195-1203}, doi = {10.1007/s10071-016-1031-0}, pmid = {27639565}, issn = {1435-9456}, mesh = {Animals ; Cognition ; *Comprehension ; Cues ; *Parrots ; Passeriformes ; }, abstract = {Physical cognition has generally been assessed in tool-using species that possess a relatively large brain size, such as corvids and apes. Parrots, like corvids and apes, also have large relative brain sizes, yet although parrots rarely use tools in the wild, growing evidence suggests comparable performances on physical cognition tasks. It is, however, unclear whether success on such tasks is facilitated by previous experience and training procedures. We therefore investigated physical comprehension of object relationships in two non-tool-using species of captive neotropical parrots on a new means-end paradigm, the Trap-Gaps task, using unfamiliar materials and modified training procedures that precluded procedural cues. Red-shouldered macaws (Diopsittaca nobilis) and black-headed caiques (Pionites melanocephala) were presented with an initial task that required them to discriminate between pulling food trays through gaps while attending to the respective width of the gaps and size of the trays. Subjects were then presented with a novel, but functionally equivalent, transfer task. Six of eight birds solved the initial task through trial-and-error learning. Four of these six birds solved the transfer task, with one caique demonstrating spontaneous comprehension. These findings suggest that non-tool-using parrots may possess capacities for sophisticated physical cognition by generalising previously learned rules across novel problems.}, }
@article {pmid27631734, year = {2016}, author = {Furtado, K and Banks, KH}, title = {A Research Agenda for Racial Equity: Applications of the Ferguson Commission Report to Public Health.}, journal = {American journal of public health}, volume = {106}, number = {11}, pages = {1926-1931}, doi = {10.2105/AJPH.2016.303390}, pmid = {27631734}, issn = {1541-0048}, mesh = {*Health Policy ; Health Status Disparities ; Human Rights ; Humans ; Law Enforcement/methods ; *Public Health ; *Racism ; *Residence Characteristics ; Schools/organization &amp; administration ; *Social Justice ; }, abstract = {The Ferguson Commission was an independent body of 16 commissioners in operation from November 2014 to December 2015 and appointed by Missouri governor Jay Nixon to examine the root causes underlying the death of Michael Brown Jr. Its report, &quot;Forward Through Ferguson: A Path Toward Racial Equity,&quot; raises many issues on racial equity that public health is well suited to address, such as trends in police use of force, the health implications of the school-based discipline gap, and the health benefits of a coordinated housing strategy. Public health can also learn from the principles the commission adopted, including being unflinching in the questions asked and conclusions drawn, applying a racial equity lens to public health work, and moving beyond programmatic solutions to policy solutions.}, }
@article {pmid27629645, year = {2016}, author = {Rutz, C and Klump, BC and Komarczyk, L and Leighton, R and Kramer, J and Wischnewski, S and Sugasawa, S and Morrissey, MB and James, R and St Clair, JJ and Switzer, RA and Masuda, BM}, title = {Discovery of species-wide tool use in the Hawaiian crow.}, journal = {Nature}, volume = {537}, number = {7620}, pages = {403-407}, doi = {10.1038/nature19103}, pmid = {27629645}, issn = {1476-4687}, mesh = {Aging ; Animals ; Animals, Zoo/physiology ; Biological Evolution ; Cognition ; Crows/classification/*physiology ; Female ; Hawaii ; Male ; Phylogeny ; Species Specificity ; *Tool Use Behavior ; }, abstract = {Only a handful of bird species are known to use foraging tools in the wild. Amongst them, the New Caledonian crow (Corvus moneduloides) stands out with its sophisticated tool-making skills. Despite considerable speculation, the evolutionary origins of this species' remarkable tool behaviour remain largely unknown, not least because no naturally tool-using congeners have yet been identified that would enable informative comparisons. Here we show that another tropical corvid, the 'Alalā (C. hawaiiensis; Hawaiian crow), is a highly dexterous tool user. Although the 'Alalā became extinct in the wild in the early 2000s, and currently survives only in captivity, at least two lines of evidence suggest that tool use is part of the species' natural behavioural repertoire: juveniles develop functional tool use without training, or social input from adults; and proficient tool use is a species-wide capacity. 'Alalā and New Caledonian crows evolved in similar environments on remote tropical islands, yet are only distantly related, suggesting that their technical abilities arose convergently. This supports the idea that avian foraging tool use is facilitated by ecological conditions typical of islands, such as reduced competition for embedded prey and low predation risk. Our discovery creates exciting opportunities for comparative research on multiple tool-using and non-tool-using corvid species. Such work will in turn pave the way for replicated cross-taxonomic comparisons with the primate lineage, enabling valuable insights into the evolutionary origins of tool-using behaviour.}, }
@article {pmid27584142, year = {2017}, author = {de Oliveira, RT and Felippe, LA and Bucken Gobbi, LT and Barbieri, FA and Christofoletti, G}, title = {Benefits of Exercise on the Executive Functions in People with Parkinson Disease: A Controlled Clinical Trial.}, journal = {American journal of physical medicine &amp; rehabilitation}, volume = {96}, number = {5}, pages = {301-306}, doi = {10.1097/PHM.0000000000000612}, pmid = {27584142}, issn = {1537-7385}, mesh = {Aged ; *Executive Function ; *Exercise ; Female ; Humans ; Male ; Neuropsychological Tests ; Parkinson Disease/*rehabilitation ; }, abstract = {OBJECTIVE: We have made a 3-arm trial (group vs. individual exercise vs. no treatment) to test the effects of a 6-month exercise program upon the executive functions in participants with Parkinson disease.<br><br>METHODS: Twenty-four subjects were randomly allocated in 3 groups and undertook individualized exercises (G1, n = 8), group exercises (G2, n = 8), or monitoring (G3, n = 8). Executive functions were evaluated by means of the Wisconsin card sorting test and the Raven colored matrices, both assessed at the beginning of the program and after 6 months. The statistical analyses consisted of the application of repeated measurement tests, with a significant level of 5%.<br><br>RESULTS: The findings showed similar behavior of groups in terms of the Wisconsin card sorting test (P = 0.792), reporting no benefit of the program on such instrument. Differently, Raven colored matrices evidenced a significant benefit provided by the intervention (P = 0.032). Compared with the control group, individuals from G1 had a substantial improvement on executive functions (P = 0.031) and from G2 had a trend of significance (P = 0.072).<br><br>CONCLUSION: Findings of this study show that 6 months of exercise improved some aspects of executive functions when compared with control peers. Individual therapy seems to have a more prominent improvement than group therapy.}, }
@article {pmid27548738, year = {2016}, author = {Dietrich, EA and Langevin, SA and Huang, CY and Maharaj, PD and Delorey, MJ and Bowen, RA and Kinney, RM and Brault, AC}, title = {West Nile Virus Temperature Sensitivity and Avian Virulence Are Modulated by NS1-2B Polymorphisms.}, journal = {PLoS neglected tropical diseases}, volume = {10}, number = {8}, pages = {e0004938}, doi = {10.1371/journal.pntd.0004938}, pmid = {27548738}, issn = {1935-2735}, support = {U54 AI065359/AI/NIAID NIH HHS/United States ; }, mesh = {Animals ; Bird Diseases/virology ; Birds/*virology ; Kenya/epidemiology ; Mutation ; North America/epidemiology ; *Polymorphism, Genetic ; Temperature ; Viral Nonstructural Proteins/*genetics ; Viremia ; Virulence/genetics ; Virus Replication ; West Nile Fever/epidemiology/virology ; West Nile virus/*genetics/*pathogenicity/physiology ; }, abstract = {West Nile virus (WNV) replicates in a wide variety of avian species, which serve as reservoir and amplification hosts. WNV strains isolated in North America, such as the prototype strain NY99, elicit a highly pathogenic response in certain avian species, notably American crows (AMCRs; Corvus brachyrhynchos). In contrast, a closely related strain, KN3829, isolated in Kenya, exhibits a low viremic response with limited mortality in AMCRs. Previous work has associated the difference in pathogenicity primarily with a single amino acid mutation at position 249 in the helicase domain of the NS3 protein. The NY99 strain encodes a proline residue at this position, while KN3829 encodes a threonine. Introduction of an NS3-T249P mutation in the KN3829 genetic background significantly increased virulence and mortality; however, peak viremia and mortality were lower than those of NY99. In order to elucidate the viral genetic basis for phenotype variations exclusive of the NS3-249 polymorphism, chimeric NY99/KN3829 viruses were created. We show herein that differences in the NS1-2B region contribute to avian pathogenicity in a manner that is independent of and additive with the NS3-249 mutation. Additionally, NS1-2B residues were found to alter temperature sensitivity when grown in avian cells.}, }
@article {pmid27546698, year = {2016}, author = {Furdova, A and Horkovicova, K and Justusova, P and Sramka, M}, title = {Is it sufficient to repeat LINEAR accelerator stereotactic radiosurgery in choroidal melanoma?.}, journal = {Bratislavske lekarske listy}, volume = {117}, number = {8}, pages = {456-462}, pmid = {27546698}, issn = {0006-9248}, mesh = {Adult ; Aged ; Aged, 80 and over ; Choroid Neoplasms/pathology/*surgery ; Female ; Humans ; Magnetic Resonance Imaging ; Male ; Melanoma/pathology/*surgery ; Middle Aged ; Optic Nerve ; *Particle Accelerators ; Radiosurgery/*methods ; Radiotherapy Dosage ; Retrospective Studies ; Tomography, X-Ray Computed ; Treatment Outcome ; Tumor Burden ; Uveal Neoplasms/pathology/*surgery ; }, abstract = {OBJECTIVES: One day session LINAC based stereotactic radiosurgery (SRS) at LINAC accelerator is a method of &quot;conservative&quot; attitude to treat the intraocular malignant uveal melanoma.<br><br>METHODS: We used model Clinac 600 C/D Varian (system Aria, planning system Corvus version 6.2 verification IMRT OmniPro) with 6 MeV X by rigid immobilization of the eye to the Leibinger frame. The stereotactic treatment planning after fusion of CT and MRI was optimized according to the critical structures (lens, optic nerve, also lens and optic nerve at the contralateral side, chiasm). The first plan was compared and the best plan was applied for therapy at C LINAC accelerator. The planned therapeutic dose was 35.0 Gy by 99 % of DVH (dose volume histogram).<br><br>RESULTS: In our clinical study in the group of 125 patients with posterior uveal melanoma treated with SRS, in 2 patients (1.6 %) was repeated SRS indicated. Patient age of the whole group ranged from 25 to 81 years with a median of 54 TD was 35.0 Gy. In 2 patients after 5 year interval after stereotactic radiosurgery for uveal melanoma stage T1, the tumor volume increased to 50 % of the primary tumor volume and repeated SRS was necessary.<br><br>CONCLUSION: To find out the changes in melanoma characteristics after SRS in long term interval after irradiation is necessary to follow up the patient by an ophthalmologist regularly. One step LINAC based stereotactic radiosurgery with a single dose 35.0 Gy is one of treatment options to treat T1 to T3 stage posterior uveal melanoma and to preserve the eye globe. In some cases it is possible to repeat the SRS after more than 5 year interval (Fig. 8, Ref. 23).}, }
@article {pmid27546381, year = {2016}, author = {Tella, JL and Dénes, FV and Zulian, V and Prestes, NP and Martínez, J and Blanco, G and Hiraldo, F}, title = {Endangered plant-parrot mutualisms: seed tolerance to predation makes parrots pervasive dispersers of the Parana pine.}, journal = {Scientific reports}, volume = {6}, number = {}, pages = {31709}, doi = {10.1038/srep31709}, pmid = {27546381}, issn = {2045-2322}, mesh = {Animals ; Brazil ; *Ecosystem ; Endangered Species ; Feeding Behavior/physiology ; Geography ; Parrots/*physiology ; Pinus/*physiology ; *Seed Dispersal ; Seeds/*physiology ; }, abstract = {Parrots are largely considered plant antagonists as they usually destroy the seeds they feed on. However, there is evidence that parrots may also act as seed dispersers. We evaluated the dual role of parrots as predators and dispersers of the Critically Endangered Parana pine (Araucaria angustifolia). Eight of nine parrot species predated seeds from 48% of 526 Parana pines surveyed. Observations of the commonest parrot indicated that 22.5% of the picked seeds were dispersed by carrying them in their beaks. Another five parrot species dispersed seeds, at an estimated average distance of c. 250 m. Dispersal distances did not differ from those observed in jays, considered the main avian dispersers. Contrary to jays, parrots often dropped partially eaten seeds. Most of these seeds were handled by parrots, and the proportion of partially eaten seeds that germinated was higher than that of undamaged seeds. This may be explained by a predator satiation effect, suggesting that the large seeds of the Parana pine evolved to attract consumers for dispersal. This represents a thus far overlooked key plant-parrot mutualism, in which both components are threatened with extinction. The interaction is becoming locally extinct long before the global extinction of the species involved.}, }
@article {pmid27545961, year = {2016}, author = {Heiz, J and Barisnikov, K}, title = {Visual-motor integration, visual perception and motor coordination in a population with Williams syndrome and in typically developing children.}, journal = {Journal of intellectual disability research : JIDR}, volume = {60}, number = {10}, pages = {945-955}, doi = {10.1111/jir.12328}, pmid = {27545961}, issn = {1365-2788}, mesh = {Adolescent ; Adult ; Child ; Child Development/*physiology ; Child, Preschool ; Female ; Humans ; Male ; Psychomotor Performance/*physiology ; Williams Syndrome/*physiopathology ; Young Adult ; }, abstract = {BACKGROUND: Williams syndrome (WS) is characterised by severe deficits in visual-spatial abilities in contrast to relatively well-developed language abilities. There is very limited knowledge about visual-motor integration (VMI) in people with WS.<br><br>METHOD: Twenty-six participants with WS aged 6 to 41 years were assessed with all three tests of the Beery-VMI test, namely the VMI test, the visual perception test (VP) and the motor coordination test (MC). Their results were compared with those of 154 typically developing children (TD) aged 4 to 12.<br><br>RESULTS: No influence of age on the three tested abilities was found amongst the participants with WS in comparison with the TD children. The participants with WS scored similarly to the 5-year-old TD children in all three tasks; their scores on the VMI correlated with the results on the VP and MC tests, which were similar to those of the TD children. Finally, the scores on the non-verbal intelligence test (Raven Coloured Progressive Matrices) were highly predictive of the scores in the VMI and VP tests and partially explain the variance in the MC scores.<br><br>CONCLUSIONS: The present study is the first to use all three tasks of the Beery-VMI test. For the TD children, the performances on the three subtests did not show the same developmental trajectory. In contrast, the participants with WS did not show the same developmental trajectory. The participants with WS exhibited poor performances on all tasks with scores comparable with the 5-year-old TD children. As high correlations between these abilities were observed, improving VP and MC could help the development of VMI, which in turn could improve visual-spatial abilities in individuals with WS.}, }
@article {pmid27543758, year = {2016}, author = {Zarza, E and Faircloth, BC and Tsai, WL and Bryson, RW and Klicka, J and McCormack, JE}, title = {Hidden histories of gene flow in highland birds revealed with genomic markers.}, journal = {Molecular ecology}, volume = {25}, number = {20}, pages = {5144-5157}, doi = {10.1111/mec.13813}, pmid = {27543758}, issn = {1365-294X}, mesh = {Animals ; DNA, Mitochondrial/genetics ; *Gene Flow ; *Genetic Speciation ; *Genetics, Population ; Genomics ; Mexico ; Models, Genetic ; Passeriformes/*genetics ; Phylogeny ; Polymorphism, Single Nucleotide ; Sequence Analysis, DNA ; }, abstract = {Genomic studies are revealing that divergence and speciation are marked by gene flow, but it is not clear whether gene flow has played a prominent role during the generation of biodiversity in species-rich regions of the world where vicariance is assumed to be the principal mode by which new species form. We revisit a well-studied organismal system in the Mexican Highlands, Aphelocoma jays, to test for gene flow among Mexican sierras. Prior results from mitochondrial DNA (mtDNA) largely conformed to the standard model of allopatric divergence, although there was also evidence for more obscure histories of gene flow in a small sample of nuclear markers. We tested for these 'hidden histories' using genomic markers known as ultraconserved elements (UCEs) in concert with phylogenies, clustering algorithms and newer introgression tests specifically designed to detect ancient gene flow (e.g. ABBA/BABA tests). Results based on 4303 UCE loci and 2500 informative SNPs are consistent with varying degrees of gene flow among highland areas. In some cases, gene flow has been extensive and recent (although perhaps not ongoing today), whereas in other cases there is only a trace signature of ancient gene flow among species that diverged as long as 5 million years ago. These results show how a species complex thought to be a model for vicariance can reveal a more reticulate history when a broader portion of the genome is queried. As more organisms are studied with genomic data, we predict that speciation-with-bouts-of-gene-flow will turn out to be a common mode of speciation.}, }
@article {pmid27541152, year = {2016}, author = {Janaydeh, M and Ismail, A and Zulkifli, SZ and Bejo, MH and Aziz, NA and Taneenah, A}, title = {The use of feather as an indicator for heavy metal contamination in house crow (Corvus splendens) in the Klang area, Selangor, Malaysia.}, journal = {Environmental science and pollution research international}, volume = {23}, number = {21}, pages = {22059-22071}, doi = {10.1007/s11356-016-7223-y}, pmid = {27541152}, issn = {1614-7499}, mesh = {Age Factors ; Animals ; Crows/*metabolism ; Environmental Monitoring/*methods ; Environmental Pollutants/*analysis ; Feathers/*chemistry ; Female ; Malaysia ; Male ; Metals, Heavy/*analysis ; Sex Factors ; Spectrophotometry, Atomic ; }, abstract = {The Klang area of Peninsular Malaysia has experienced rapid industrial growth with intense activities, which can increase the concentration of pollutants in the environment that significantly impact on habitats and the human health. The purpose of this study was to determine the levels of selected heavy metals (Cu, Zn, Ni, Fe, and Pb) in the heart, lung, brain, liver, kidney, muscle tissues, and feathers of house crow, Corvus splendens, in Klang, Peninsular Malaysia. House crow samples were collected from the Klang area through the Department of Public Health at Majlis Perbandaran Klang. Quantitative determination of heavy metals was carried out using atomic absorption spectrophotometer (AAS). The result shows the presence of heavy metals in all biological samples of house crows. For heavy metals in all the house crow tissues analyzed, Fe concentrations were the highest, followed by those of Zn, Cu, Pb, and Ni. The feathers and kidney accumulated high concentrations of Pb, whereas the liver accumulated high concentrations of essential heavy metals (Fe > Zn > Cu > Ni). Significant variations were also detected in the concentrations of Pb among adult and juvenile and male and female bird samples. The results also revealed significant positive correlations between Pb metal concentration in the breast feathers and all internal organs. Accumulation of toxic heavy metals in feathers reflected storing and elimination processes, while the accumulation of toxic heavy metals in the kidney can be consequential to chronic exposure. The present study clearly shows the usefulness of house crow breast feather as a suitable indicator for heavy metal accumulation in the internal organs of house crows in the Klang area.}, }
@article {pmid27540060, year = {2016}, author = {Nelson, RL and Castro, MA and Katti, M and Eisen, JA and Van Laar, TA}, title = {Genome Sequence of a Multidrug-Resistant Strain of Bacillus pumilus, CB01, Isolated from the Feces of an American Crow, Corvus brachyrhynchos.}, journal = {Genome announcements}, volume = {4}, number = {4}, pages = {}, doi = {10.1128/genomeA.00807-16}, pmid = {27540060}, issn = {2169-8287}, abstract = {Avian species have the potential to serve as important reservoirs for the spread of pathogenic microorganisms. Here, we report the genome sequence of a drug-resistant strain of Bacillus pumilus, CB01, isolated from the feces of an American crow, Corvus brachyrhynchos.}, }
@article {pmid27533282, year = {2016}, author = {Audet, JN and Ducatez, S and Lefebvre, L}, title = {Bajan Birds Pull Strings: Two Wild Antillean Species Enter the Select Club of String-Pullers.}, journal = {PloS one}, volume = {11}, number = {8}, pages = {e0156112}, doi = {10.1371/journal.pone.0156112}, pmid = {27533282}, issn = {1932-6203}, mesh = {Animals ; Barbados ; Behavior, Animal/*physiology ; *Cognition ; Passeriformes/*physiology ; *Problem Solving ; Reward ; }, abstract = {String-pulling is one of the most popular tests in animal cognition because of its apparent complexity, and of its potential to be applied to very different taxa. In birds, the basic procedure involves a food reward, suspended from a perch by a string, which can be reached by a series of coordinated pulling actions with the beak and holding actions of the pulled lengths of string with the foot. The taxonomic distribution of species that pass the test includes several corvids, parrots and parids, but in other families, data are much spottier and the number of individuals per species that succeed is often low. To date, the association between string-pulling ability and other cognitive traits was never tested. It is generally assumed that string-pulling is a complex form of problem-solving, suggesting that performance on string-pulling and other problem-solving tasks should be correlated. Here, we show that individuals of two innovative species from Barbados, the bullfinch Loxigilla barbadensis and the Carib grackle Quiscalus lugubris fortirostris, pass the string-pulling test. Eighteen of the 42 bullfinches tested succeeded, allowing us to correlate performance on this test to that on several other behavioral measurements. Surprisingly, string-pulling in bullfinches was unrelated to shyness, neophobia, problem-solving, discrimination and reversal learning performance. Only two of 31 grackles tested succeeded, precluding correlational analyses with other measures but still, the two successful birds largely differed in their other behavioral traits.}, }
@article {pmid27529809, year = {2016}, author = {Jay, J and Buse, K and Hart, M and Wilson, D and Marten, R and Kellerman, S and Odetoyinbo, M and Quick, JD and Evans, T and Piot, P and Dybul, M and Binagwaho, A}, title = {Building from the HIV Response toward Universal Health Coverage.}, journal = {PLoS medicine}, volume = {13}, number = {8}, pages = {e1002083}, doi = {10.1371/journal.pmed.1002083}, pmid = {27529809}, issn = {1549-1676}, mesh = {Developing Countries ; Global Health ; HIV Infections/*therapy ; Health Expenditures ; Health Policy ; Health Priorities ; Healthcare Financing ; Human Rights ; Humans ; Politics ; Rwanda ; Social Determinants of Health ; *Universal Coverage ; }, abstract = {Jonathan Jay and colleagues draw lessons from the the global HIV response that could help guide the universal health coverage movement.}, }
@article {pmid27524823, year = {2016}, author = {Durden, LA and Beckmen, KB and Gerlach, RF}, title = {New Records of Ticks (Acari: Ixodidae) From Dogs, Cats, Humans, and Some Wild Vertebrates in Alaska: Invasion Potential.}, journal = {Journal of medical entomology}, volume = {53}, number = {6}, pages = {1391-1395}, doi = {10.1093/jme/tjw128}, pmid = {27524823}, issn = {1938-2928}, mesh = {Alaska ; *Animal Distribution ; Animals ; Bird Diseases/parasitology ; *Birds ; Cat Diseases/parasitology ; Cats ; Dog Diseases/parasitology ; Dogs ; Female ; Humans ; *Introduced Species ; Ixodidae/growth &amp; development/*physiology ; Larva/growth &amp; development/physiology ; Male ; *Mammals ; Nymph/growth &amp; development/physiology ; Tick Infestations/parasitology/*veterinary ; }, abstract = {During 2010-2016, tick specimens were solicited from veterinarians, biologists, and members of the public in Alaska. Eight species of ticks were recorded from domestic dogs. Some ticks were collected from dogs with recent travel histories to other countries or other U.S. states, which appears to explain records of ticks not native to Alaska such as Amblyomma americanum (L.) (lone star tick), Ixodes scapularis (Say) (blacklegged tick), and Ixodes ricinus (L.). However, we recorded Dermacentor variabilis (Say) (American dog tick) from dogs (and humans) both with and without travel history, suggesting that this nonindigenous tick could be establishing populations in Alaska. Other ticks commonly recorded from dogs included the indigenous Ixodes angustus Neumann and the invasive Rhipicephalus sanguineus (Latreille) (brown dog tick). Domestic cats were only parasitized by one tick species, the native I. angustus Six species of ticks were recorded from humans: A. americanum (with and without travel history), Dermacentor andersoni Stiles (Rocky Mountain wood tick; travel associated), D. variabilis (with and without travel history), Haemaphysalis leporispalustris (Packard) (rabbit tick, native to Alaska), I. angustus, and R. sanguineus. Ixodes angustus predominated among tick collections from native mammals. Also, Ixodes texanus Banks (first record from Alaska) was collected from an American marten, Martes americana (Turton), H. leporispalustris was recorded from a snowshoe hare, Lepus americanus Erxleben, and Ixodes auritulus Neumann was collected from a Northwestern crow, Corvus caurinus Baird. The establishment of D. variabilis, D. andersoni, A. americanum, and/or I. scapularis in Alaska would have strong implications for animal and human health.}, }
@article {pmid27503195, year = {2017}, author = {Magnotti, JF and Wright, AA and Leonard, K and Katz, JS and Kelly, DM}, title = {Abstract-concept learning in Black-billed magpies (Pica hudsonia).}, journal = {Psychonomic bulletin &amp; review}, volume = {24}, number = {2}, pages = {431-435}, doi = {10.3758/s13423-016-1132-4}, pmid = {27503195}, issn = {1531-5320}, mesh = {Animals ; Appetitive Behavior ; *Birds ; *Concept Formation ; *Conditioning (Psychology) ; *Discrimination Learning ; Female ; Male ; *Pattern Recognition, Visual ; Transfer (Psychology) ; }, abstract = {relational concepts depend upon relationships between stimuli (e.g., same vs. different) and transcend features of the training stimuli. Recent evidence shows that learning abstract concepts is shared across a variety species including birds. Our recent work with a highly-skilled food-storing bird, Clark's nutcracker, revealed superior same/different abstract-concept learning compared to rhesus monkeys, capuchin monkeys, and pigeons. Here we test a more social, but less reliant on food-storing, corvid species, the Black-billed magpie (Pica hudsonia). We used the same procedures and training exemplars (eight pairs of the same rule, and 56 pairs of the different rule) as were used to test the other species. Magpies (n = 10) showed a level of abstract-concept learning that was equivalent to nutcrackers and greater than the primates and pigeons tested with these same exemplars. These findings suggest that superior initial abstract-concept learning abilities may be shared across corvids generally, rather than confined to those strongly reliant on spatial memory.}, }
@article {pmid27499485, year = {2016}, author = {Capron, AM}, title = {Henry Knowles Beecher, Jay Katz, and the Transformation of Research with Human Beings.}, journal = {Perspectives in biology and medicine}, volume = {59}, number = {1}, pages = {55-77}, doi = {10.1353/pbm.2016.0025}, pmid = {27499485}, issn = {1529-8795}, mesh = {Bioethical Issues ; Bioethics/*history ; Biomedical Research/*ethics/*history ; History, 20th Century ; Human Experimentation/*ethics/*history ; Humans ; Informed Consent/ethics/history ; Morals ; National Socialism/history ; Policy ; Research Personnel/*ethics ; United States ; }, abstract = {The modern history of experimentation with human beings is notable for its ethical lacunae, when even the clearest directives fail to prevent violations of subjects' rights and welfare. One such lacuna occurred during the 25 years between 1947, when the Nuremberg Code was articulated in the judgment passed on the men who had performed medical experiments in the Nazi concentration camps, and 1972, when the revelation of the 40-year-long Tuskegee Syphilis Study shocked the public and pushed Congress to adopt legislation that eventually transformed the governance of human subjects research. The work that Henry Beecher and Jay Katz did on the ethics of human experimentation beginning in 1964-which was mutually supportive but also divergent in its premises and prescriptions-played a prominent role in the policy-making processes. Beecher, whose detailed disclosure of the ethical lapses of leading researchers in his renowned 1966 New England Journal of Medicine article initiated the policy reform process, proved less influential in shaping those reforms than Katz. Ultimately, Beecher was one of the last and best exemplars of &quot;medical ethics,&quot; while Katz-in his service on the Tuskegee Syphilis Study Ad Hoc Advisory Panel and in his testimony before, and work with, the Senate Health subcommittee-was an early practitioner of bioethics, a field in which the rules are not all written and applied by the medical profession but arise through a messier process involving outsiders and formal regulatory decisions.}, }
@article {pmid27493780, year = {2016}, author = {Kulahci, IG and Rubenstein, DI and Bugnyar, T and Hoppitt, W and Mikus, N and Schwab, C}, title = {Social networks predict selective observation and information spread in ravens.}, journal = {Royal Society open science}, volume = {3}, number = {7}, pages = {160256}, doi = {10.1098/rsos.160256}, pmid = {27493780}, issn = {2054-5703}, abstract = {Animals are predicted to selectively observe and learn from the conspecifics with whom they share social connections. Yet, hardly anything is known about the role of different connections in observation and learning. To address the relationships between social connections, observation and learning, we investigated transmission of information in two raven (Corvus corax) groups. First, we quantified social connections in each group by constructing networks on affiliative interactions, aggressive interactions and proximity. We then seeded novel information by training one group member on a novel task and allowing others to observe. In each group, an observation network based on who observed whose task-solving behaviour was strongly correlated with networks based on affiliative interactions and proximity. Ravens with high social centrality (strength, eigenvector, information centrality) in the affiliative interaction network were also central in the observation network, possibly as a result of solving the task sooner. Network-based diffusion analysis revealed that the order that ravens first solved the task was best predicted by connections in the affiliative interaction network in a group of subadult ravens, and by social rank and kinship (which influenced affiliative interactions) in a group of juvenile ravens. Our results demonstrate that not all social connections are equally effective at predicting the patterns of selective observation and information transmission.}, }
@article {pmid27478138, year = {2016}, author = {Taufique, SK and Kumar, V}, title = {Differential activation and tyrosine hydroxylase distribution in the hippocampal, pallial and midbrain brain regions in response to cognitive performance in Indian house crows exposed to abrupt light environment.}, journal = {Behavioural brain research}, volume = {314}, number = {}, pages = {21-29}, doi = {10.1016/j.bbr.2016.07.046}, pmid = {27478138}, issn = {1872-7549}, mesh = {Animals ; Crows ; Dopamine/metabolism ; Hippocampus/*enzymology ; Learning/*physiology ; Light ; Memory/*physiology ; Mesencephalon/*enzymology ; Neurons/metabolism ; Songbirds ; Substantia Nigra/enzymology ; Tyrosine 3-Monooxygenase/*metabolism ; }, abstract = {Disruption of the cyclic feature of the day-night environment can cause negative effects on daily activity and advanced brain functions such as learning, memory and decision-making behaviour. These functions in songbirds, including corvids, involve the hippocampus, pallium and midbrain, as revealed by ZENK (a neuronal activation marker) and tyrosine hydroxylase (TH) expressions. TH is rate-limiting marker enzyme of the biosynthesis of dopamine, widely implicated in learning and memory. Here, we measured ZENK and TH immunoreactivity in the hippocampal, pallial and midbrain regions in response to cognitive performance (learning-memory retrieval) tests in Indian house crows (Corvus splendens) exposed to constant light environment (LL) with controls on 12h light:12h darkness. Along with the decay of circadian rhythm in activity behaviour, LL caused a significant decline in the cognitive performance. There was also a decrease under LL in the activity of neurons in the hippocampus, medial and central caudal nidopallium, and hyperpallium apicale, which are widely distributed with TH-immunoreactive fibres. Further, under LL, TH- immunoreactive neurons were reduced in number in midbrain dopamine synthesis sites, the venteral tegmental area (VTA) and substantia nigra (SN), with a negative correlation of co-localized ZENK/TH- immunoreactive cells on errors during the association tasks. These results show decreased activity of learning and memory neural systems, and underscore the role of dopamine in reduced cognitive performance of diurnal corvids with disrupted circadian rhythms under an abrupt light environment.}, }
@article {pmid29491924, year = {2016}, author = {Skórka, P and Sierpowska, K and Haidt, A and Myczko, Ł and Ekner-Grzyb, A and Rosin, ZM and Kwieciński, Z and Suchodolska, J and Takacs, V and Jankowiak, Ł and Wasielewski, O and Graclik, A and Krawczyk, AJ and Kasprzak, A and Szwajkowski, P and Wylegała, P and Malecha, AW and Mizera, T and Tryjanowski, P}, title = {Habitat preferences of two sparrow species are modified by abundances of other birds in an urban environment.}, journal = {Current zoology}, volume = {62}, number = {4}, pages = {357-368}, doi = {10.1093/cz/zow069}, pmid = {29491924}, issn = {1674-5507}, abstract = {Every species has certain habitat requirements, which may be altered by interactions with other co-occurring species. These interactions are mostly ignored in predictive models trying to identify key habitat variables correlated with species population abundance/occurrence. We investigated how the structure of the urban landscape, food resources, potential competitors, predators, and interaction between these factors influence the abundance of house sparrow Passer domesticus and the tree sparrow P. montanus in sixty 25 ha plots distributed randomly across residential areas of the city of Poznań (Poland). The abundance of the house sparrow was positively correlated with the abundance of pigeons but negatively correlated with human-related food resources. There were significant interaction terms between abundances of other urban species and habitat variables in statistical models. For example, the abundance of house sparrow was negatively correlated with the abundance of corvids and tree sparrows but only when food resources were low. The abundance of tree sparrows positively correlated with density of streets and the distance from the city center. The abundance of this species positively correlated with the abundance of corvids when food resources were low but negatively correlated at low covers of green area. Our study indicates that associations between food resources, habitat covers, and the relative abundance of two sparrow species are altered by the abundance of other urban species. Competition, niche separation and social facilitation may be responsible for these interactive effects. Thus, biotic interactions should be included not only as an additive effect but also as an interaction term between abundance and habitat variables in statistical models predicting species abundance and occurrence.}, }
@article {pmid29491922, year = {2016}, author = {Loretto, MC and Schuster, R and Bugnyar, T}, title = {GPS tracking of non-breeding ravens reveals the importance of anthropogenic food sources during their dispersal in the Eastern Alps.}, journal = {Current zoology}, volume = {62}, number = {4}, pages = {337-344}, doi = {10.1093/cz/zow016}, pmid = {29491922}, issn = {1674-5507}, abstract = {In many songbirds, the space use of breeders is well studied but poorly understood for non-breeders. In common ravens, some studies of non-breeders indicate high vagrancy with large individual differences in home range size, whereas others show that up to 40% of marked non-breeders can be regularly observed at the same anthropogenic food source over months to years. The aim of this study was to provide new insights on ravens' behavior during dispersal in the Eastern Alps. We deployed Global Positioning System (GPS) loggers on 10 individuals to gather accurate spatial and temporal information on their movements to quantify: 1) the dimension of the birds' space use (home range size with seasonal effects and daily/long-term travel distances), 2) how long they stayed in a dispersal stage of wandering as opposed to settling temporarily, and 3) their destination of movements. We recorded movements of up to 40 km per hour, more than 160 km within 1 day and more than 11,000 km within 20 months, indicating high vagrancy. Switching frequently between temporarily settling and travelling large distances in short time intervals leads to extensive home ranges, which also explains and combines the different findings in the literature. The destinations are rich anthropogenic food sources, where the birds spent on average 75% of their time. We discuss how ravens may find these &quot;feeding hot spots&quot; and which factors may influence their decision to stay/leave a site. The strong dependence on anthropogenic resources found in this population may have implications for site management and conservation issues.}, }
@article {pmid27470204, year = {2016}, author = {Hofmann, MM and Cheke, LG and Clayton, NS}, title = {Western scrub-jays (Aphelocoma californica) solve multiple-string problems by the spatial relation of string and reward.}, journal = {Animal cognition}, volume = {19}, number = {6}, pages = {1103-1114}, doi = {10.1007/s10071-016-1018-x}, pmid = {27470204}, issn = {1435-9456}, support = {//Biotechnology and Biological Sciences Research Council/United Kingdom ; }, mesh = {Animals ; Cognition ; *Passeriformes ; *Problem Solving ; *Reward ; }, abstract = {String-pulling is a widely used paradigm in animal cognition research to assess what animals understand about the functionality of strings as a means to obtain an out-of-reach reward. This study aimed to systematically investigate what rules Western scrub-jays (Aphelocoma californica) use to solve different patterned string tasks, i.e. tasks in which subjects have to choose between two or more strings of which only one is connected to the reward, or where one is more efficient. Arranging strings in a parallel configuration showed that the jays were generally capable of solving multiple-string tasks and acted in a goal-directed manner. The slanted and crossed configurations revealed a reliance on a &quot;proximity rule&quot;, that is, a tendency to choose the string-end closest to the reward. When confronted with strings of different lengths attached to rewards at different distances the birds chose according to the reward distance, preferring the reward closest to them, and were sensitive to the movement of the reward, but did not consistently prefer the shorter and therefore more efficient string. Generally, the scrub-jays were successful in tasks where the reward was closest to the string-ends they needed to pull or when string length and reward distance correlated, but the birds had problems when the wrong string-end was closest to the reward or when the food items were in close proximity to each other. These results show that scrub-jays had a partial understanding of the physical principles underlying string-pulling but relied on simpler strategies such as the proximity rule to solve the tasks.}, }
@article {pmid27468639, year = {2016}, author = {Expósito-Granados, M and De La Cruz, C and Parejo, D and Valencia, J and Alarcos, S and Avilés, JM}, title = {Exploratory behaviour modulates the relationship between colony familiarity and helping in a cooperative bird.}, journal = {Behavioural processes}, volume = {131}, number = {}, pages = {9-14}, doi = {10.1016/j.beproc.2016.07.013}, pmid = {27468639}, issn = {1872-8308}, mesh = {Animals ; Exploratory Behavior/*physiology ; Female ; Helping Behavior ; Male ; Passeriformes ; Personality/*physiology ; Sexual Behavior, Animal/*physiology ; *Social Behavior ; }, abstract = {Individuals within animal groups may differ in personality and degree of familiarity raising the question of how this influences their social interactions. In Iberian magpies Cyanopica cooki, a portion of first-year males engage in cooperative behaviours and dispersal, allowing addressing this question. In this study, we first investigate the relationship between colony familiarity (native versus foreign) and reproductive status (breeding versus helping) of males during 21 years. Secondly, we measure the exploratory behaviour and monitor reproductive status of a sample of individuals with different colony familiarity during 2 years. Long-term monitoring revealed that foreign individuals were more likely breeders. The analysis on the subset of individuals in which exploratory behaviour was measured revealed a mediatory effect of exploratory behaviour in the association between colony familiarity and helping behaviour. Specifically, among foreign individuals, higher explorative males were more frequently involved in helping behaviour than lower explorative ones. Conversely, among native males, breeders were more explorative than helpers. Our results suggest that aspects of personality may mediate the value of familiarity in reproductive tasks in social species.}, }
@article {pmid27466440, year = {2016}, author = {Bhat, AA and Mohan, V and Sandini, G and Morasso, P}, title = {Humanoid infers Archimedes' principle: understanding physical relations and object affordances through cumulative learning experiences.}, journal = {Journal of the Royal Society, Interface}, volume = {13}, number = {120}, pages = {}, doi = {10.1098/rsif.2016.0310}, pmid = {27466440}, issn = {1742-5662}, mesh = {Animals ; Hominidae/*physiology ; Humans ; Learning/*physiology ; Memory, Long-Term/*physiology ; *Models, Neurological ; Nerve Net/*physiology ; }, abstract = {Emerging studies indicate that several species such as corvids, apes and children solve 'The Crow and the Pitcher' task (from Aesop's Fables) in diverse conditions. Hidden beneath this fascinating paradigm is a fundamental question: by cumulatively interacting with different objects, how can an agent abstract the underlying cause-effect relations to predict and creatively exploit potential affordances of novel objects in the context of sought goals? Re-enacting this Aesop's Fable task on a humanoid within an open-ended 'learning-prediction-abstraction' loop, we address this problem and (i) present a brain-guided neural framework that emulates rapid one-shot encoding of ongoing experiences into a long-term memory and (ii) propose four task-agnostic learning rules (elimination, growth, uncertainty and status quo) that correlate predictions from remembered past experiences with the unfolding present situation to gradually abstract the underlying causal relations. Driven by the proposed architecture, the ensuing robot behaviours illustrated causal learning and anticipation similar to natural agents. Results further demonstrate that by cumulatively interacting with few objects, the predictions of the robot in case of novel objects converge close to the physical law, i.e. the Archimedes principle: this being independent of both the objects explored during learning and the order of their cumulative exploration.}, }
@article {pmid27460795, year = {2016}, author = {Zylberberg, M and Van Hemert, C and Dumbacher, JP and Handel, CM and Tihan, T and DeRisi, JL}, title = {Novel Picornavirus Associated with Avian Keratin Disorder in Alaskan Birds.}, journal = {mBio}, volume = {7}, number = {4}, pages = {}, doi = {10.1128/mBio.00874-16}, pmid = {27460795}, issn = {2150-7511}, support = {/HHMI/Howard Hughes Medical Institute/United States ; }, mesh = {Alaska ; Animals ; Beak/*pathology ; Bird Diseases/*virology ; Birds ; Computational Biology ; Gene Order ; High-Throughput Nucleotide Sequencing ; Keratins/*metabolism ; Metagenomics ; Phylogeny ; Picornaviridae/classification/genetics/*isolation &amp; purification ; Picornaviridae Infections/pathology/*veterinary/virology ; Sequence Homology ; }, abstract = {UNLABELLED: Avian keratin disorder (AKD), characterized by debilitating overgrowth of the avian beak, was first documented in black-capped chickadees (Poecile atricapillus) in Alaska. Subsequently, similar deformities have appeared in numerous species across continents. Despite the widespread distribution of this emerging pathology, the cause of AKD remains elusive. As a result, it is unknown whether suspected cases of AKD in the afflicted species are causally linked, and the impacts of this pathology at the population and community levels are difficult to evaluate. We applied unbiased, metagenomic next-generation sequencing to search for candidate pathogens in birds affected with AKD. We identified and sequenced the complete coding region of a novel picornavirus, which we are calling poecivirus. Subsequent screening of 19 AKD-affected black-capped chickadees and 9 control individuals for the presence of poecivirus revealed that 19/19 (100%) AKD-affected individuals were positive, while only 2/9 (22%) control individuals were infected with poecivirus. Two northwestern crows (Corvus caurinus) and two red-breasted nuthatches (Sitta canadensis) with AKD-consistent pathology also tested positive for poecivirus. We suggest that poecivirus is a candidate etiological agent of AKD.<br><br>IMPORTANCE: Avian keratin disorder (AKD) is an increasingly common disease of wild birds. This disease, characterized by beak overgrowth, was first described in the late 1990s and has been spreading rapidly both geographically and in terms of host species affected. AKD decreases host fitness and can be fatal. However, the cause of the disease has remained elusive, and its impact on host populations is poorly understood. We found a novel and divergent picornavirus in 19/19 AKD-affected black-capped chickadees that we examined but in only 2/9 control cases. We also found this virus in 4 individuals of 2 other passerine species that exhibited symptoms consistent with AKD. Our data suggest that this novel picornavirus warrants further investigation as the causative agent of AKD.}, }
@article {pmid27455197, year = {2016}, author = {Wille, M and McBurney, S and Robertson, GJ and Wilhelm, SI and Blehert, DS and Soos, C and Dunphy, R and Whitney, H}, title = {A PELAGIC OUTBREAK OF AVIAN CHOLERA IN NORTH AMERICAN GULLS: SCAVENGING AS A PRIMARY MECHANISM FOR TRANSMISSION?.}, journal = {Journal of wildlife diseases}, volume = {52}, number = {4}, pages = {793-802}, doi = {10.7589/2015-12-342}, pmid = {27455197}, issn = {1943-3700}, mesh = {Animals ; Bird Diseases/*epidemiology ; Birds ; Canada ; Charadriiformes/*microbiology ; Cholera/epidemiology/*transmission ; Disease Outbreaks ; *Feeding Behavior ; Newfoundland and Labrador/epidemiology ; }, abstract = {Avian cholera, caused by the bacterium Pasteurella multocida , is an endemic disease globally, often causing annual epizootics in North American wild bird populations with thousands of mortalities. From December 2006 to March 2007, an avian cholera outbreak caused mortality in marine birds off the coast of Atlantic Canada, largely centered 300-400 km off the coast of the island of Newfoundland. Scavenging gulls (Larus spp.) were the primary species detected; however, mortality was also identified in Black-legged Kittiwakes (Rissa tridactyla) and one Common Raven (Corvus corax), a nonmarine species. The most common gross necropsy findings in the birds with confirmed avian cholera were acute fibrinous and necrotizing lesions affecting the spleen, air sacs, and pericardium, and nonspecific hepatomegaly and splenomegaly. The etiologic agent, P. multocida serotype 1, was recovered from 77 of 136 carcasses examined, and confirmed or probable avian cholera was diagnosed in 85 cases. Mortality observed in scavenging gull species was disproportionately high relative to their abundance, particularly when compared to nonscavenging species. The presence of feather shafts in the ventricular lumen of the majority of larid carcasses diagnosed with avian cholera suggests scavenging of birds that died from avian cholera as a major mode of transmission. This documentation of an outbreak of avian cholera in a North American pelagic environment affecting primarily scavenging gulls indicates that offshore marine environments may be a component of avian cholera dynamics.}, }
@article {pmid27454122, year = {2016}, author = {Syrová, M and Němec, M and Veselý, P and Landová, E and Fuchs, R}, title = {Facing a Clever Predator Demands Clever Responses - Red-Backed Shrikes (Lanius collurio) vs. Eurasian Magpies (Pica pica).}, journal = {PloS one}, volume = {11}, number = {7}, pages = {e0159432}, doi = {10.1371/journal.pone.0159432}, pmid = {27454122}, issn = {1932-6203}, mesh = {Animals ; *Birds ; *Nesting Behavior ; *Predatory Behavior ; }, abstract = {Red-backed shrikes (Lanius collurio) behave quite differently towards two common nest predators. While the European jay (Garrulus glandarius) is commonly attacked, in the presence of the Eurasian magpie (Pica pica), shrikes stay fully passive. We tested the hypotheses that this passive response to the magpie is an alternative defense strategy. Nesting shrikes were exposed to the commonly attacked European kestrel (Falco tinnunculus) in a situation in which i) a harmless domestic pigeon, ii) a commonly attacked European jay, and iii) a non-attacked black-billed magpie are (separately) presented nearby. The kestrel dummy presented together with the magpie dummy was attacked with a significantly lower intensity than when it was presented with the other intruders (pigeon, jay) or alone. This means that the presence of the magpie inhibited the shrike's defense response towards the other intruder. These results support our previous hypotheses that shrikes use an alternative defense strategy in the magpie's presence. We hypothesize that the magpie is able to associate the active defense of the shrikes with the close proximity of a nest and that shrikes try not to draw the magpie's attention to the nest. The reason why this strategy is not used against the jay remains unanswered as jays as well as magpies show very similar cognitive and foraging skills enabling them to individuate the nest presence according to active parental defense.}, }
@article {pmid27449007, year = {2016}, author = {Freedman, D and Bao, Y and Shen, L and Schaefer, CA and Brown, AS}, title = {Maternal T. gondii, offspring bipolar disorder and neurocognition.}, journal = {Psychiatry research}, volume = {243}, number = {}, pages = {382-389}, doi = {10.1016/j.psychres.2016.06.057}, pmid = {27449007}, issn = {1872-7123}, support = {K02 MH065422/MH/NIMH NIH HHS/United States ; R01 MH069819/MH/NIMH NIH HHS/United States ; R01 MH073080/MH/NIMH NIH HHS/United States ; T32 MH013043/MH/NIMH NIH HHS/United States ; N01HD13334/HD/NICHD NIH HHS/United States ; }, mesh = {Adult ; Antibodies, Protozoan/blood ; Bipolar Disorder/blood/diagnosis/*epidemiology ; Case-Control Studies ; Child ; Child, Preschool ; Cognition/*physiology ; Cognitive Dysfunction/blood/diagnosis/epidemiology ; Female ; Follow-Up Studies ; Humans ; Immunoglobulin G/blood ; Intelligence Tests ; Male ; Pregnancy ; Pregnancy Complications, Infectious/blood/diagnosis/*epidemiology ; Prenatal Exposure Delayed Effects/blood/diagnosis/*epidemiology ; Random Allocation ; *Toxoplasma/metabolism ; Toxoplasmosis/blood/diagnosis/*epidemiology ; Young Adult ; }, abstract = {Prenatal exposure to maternal Toxoplasma gondii (T. gondii) IgG antibody titer has been associated previously with an increased risk of offspring schizophrenia (SZ) and cognitive impairment. We examined maternal T. gondii, offspring bipolar disorder (BP) and childhood cognition using a population-based birth cohort. Maternal sera, drawn in the third trimester, were analyzed for T. gondii IgG antibody titer, and offspring cognition at ages 5 and 9-11 was measured with the Peabody Picture Vocabulary Test (PPVT) and the Raven Matrices (Raven). Raw scores were standardized and the ages combined. Potential cases with BP from the cohort were identified by database linkages. This protocol identified 85 cases who were matched 1:2 to controls. Maternal T. gondii IgG was not associated with the risk of BP in offspring. Neither moderate [HR=1.43 (CI: 0.49, 4.17)] nor high IgG titer [HR=1.6 [CI: 0.74, 3.48)] were associated with offspring BP. Associations were not observed between maternal T. gondii and BP with psychotic features or BP type 1. In addition, maternal T. gondii was not associated with childhood cognition. Our study suggests that T. gondii may be specific to SZ among major psychotic disorders, though further studies with larger sample sizes are required.}, }
@article {pmid27447230, year = {2016}, author = {Mironov, SV and Palma, RL}, title = {A new feather mite of the genus Trouessartia Canestrini 1899 (Acariformes: Trouessartiidae) from the Seychelles magpie-robin, Copsychus sechellarum (Passeriformes: Muscicapidae).}, journal = {Acta parasitologica}, volume = {61}, number = {3}, pages = {629-635}, doi = {10.1515/ap-2016-0084}, pmid = {27447230}, issn = {1896-1851}, mesh = {Animals ; Bird Diseases/*parasitology ; Body Size ; Feathers/*parasitology ; Female ; Male ; Mite Infestations/parasitology/*veterinary ; Mites/anatomy &amp; histology/*classification/genetics ; Passeriformes/*parasitology ; Seychelles ; }, abstract = {A new feather mite species, Trouessartia sechellarum sp. n. (Astigmata: Analgoidea: Trouessartiidae), is described from the Seychelles magpie-robin Copsychus sechellarum (Passeriformes: Muscicapidae), an endangered endemic passerine bird inhabiting the Seychelles Islands. The most clear features distinguishing this mite from the related species, T. microfolia Gaud, 1952, are as follows: in both sexes, setae c2 do not exceed 30 μm and are subequal in length to setae c3 and sRIII; in males, the hysteronotal shield is completely split into the prohysteronotal and lobar parts by a narrow groove, and the terminal lamellae are attenuate apically; in females, the median part of the hysteronotal shield bears numerous ovate lacunae, the terminal cleft width is approximately equal to the opisthosomal lobe width, and the collar of the spermathecal head is smooth.}, }
@article {pmid27438979, year = {2016}, author = {Veloso, LA and Mello, MJ and Ribeiro Neto, JP and Barbosa, LN and Silva, EJ}, title = {Quality of life, cognitive level and school performance in children with functional lower urinary tract dysfunction.}, journal = {Jornal brasileiro de nefrologia : 'orgao oficial de Sociedades Brasileira e Latino-Americana de Nefrologia}, volume = {38}, number = {2}, pages = {234-244}, doi = {10.5935/0101-2800.20160033}, pmid = {27438979}, issn = {2175-8239}, mesh = {*Academic Performance ; Adolescent ; Child ; Child, Preschool ; *Cognition ; Female ; Humans ; Male ; *Quality of Life ; Urination Disorders/physiopathology/*psychology ; }, abstract = {INTRODUCTION: Lower urinary tract dysfunction (LUTD) are voiding dysfunctions without anatomical or neurological defects. The diagnosis is primarily clinical, with symptoms standardized by the International Children's Continence Society. Few studies relate quality of life of patients with cognitive and school performance.<br><br>OBJECTIVE: To evaluate milestones of bladder control, daily problems, quality of life (QoL), cognitive function and school performance of children with LUTD.<br><br>METHODS: Case series of patients followed in the Pediatric Nephrology tertiary hospital with assessment of QoL (Pediatric Quality of Life Inventory - PedsQoL version 4), School Performance Test (TDE) and Raven Progressive Matrices test.<br><br>RESULTS: Girls of lower social class were (90.9%) of eligible children. The mean age was 9.1 ± 4.8 years old. The most common symptoms were urge incontinence (81%), holding maneuvers (77.3%) and enuresis (59.1%) associated with the elimination disorder syndrome (63.6%). Caregivers considered volunteers urinary losses and/ or symptoms, and fought and/or beat the child. Children had been subjected to embarrassing situations such as warnings of teachers, they hid symptoms and/or the dirty clothes. Mean score of QoL was 71.0 ± 12.6 with the lowest mean score on the school dimension. In TDE 55% had lower performance and in Raven Matrices 60% were intellectually in the medium level. It was observed lower QoL scores in the medium and lower level of TDE and average intellectual capacity/below average in Raven matrices.<br><br>CONCLUSION: LUTD may negatively affect family and social relationships, school performance and QoL of children with the dysfunction.}, }
@article {pmid27437926, year = {2016}, author = {Jacobs, IF and von Bayern, A and Osvath, M}, title = {A novel tool-use mode in animals: New Caledonian crows insert tools to transport objects.}, journal = {Animal cognition}, volume = {19}, number = {6}, pages = {1249-1252}, doi = {10.1007/s10071-016-1016-z}, pmid = {27437926}, issn = {1435-9456}, mesh = {Animals ; *Crows ; *Tool Use Behavior ; }, abstract = {New Caledonian crows (Corvus moneduloides) rely heavily on a range of tools to extract prey. They manufacture novel tools, save tools for later use, and have morphological features that facilitate tool use. We report six observations, in two individuals, of a novel tool-use mode not previously reported in non-human animals. Insert-and-transport tool use involves inserting a stick into an object and then moving away, thereby transporting both object and tool. All transported objects were non-food objects. One subject used a stick to transport an object that was too large to be handled by beak, which suggests the tool facilitated object control. The function in the other cases is unclear but seems to be an expression of play or exploration. Further studies should investigate whether it is adaptive in the wild and to what extent crows can flexibly apply the behaviour in experimental settings when purposive transportation of objects is advantageous.}, }
@article {pmid27437006, year = {2016}, author = {Aliabadi, B and Davari-Ashtiani, R and Khademi, M and Arabgol, F}, title = {Comparison of Creativity between Children with and without Attention Deficit Hyperactivity Disorder: A Case-Control Study.}, journal = {Iranian journal of psychiatry}, volume = {11}, number = {2}, pages = {99-103}, pmid = {27437006}, issn = {1735-4587}, abstract = {OBJECTIVE: The aim of this study was to compare creativity in children with and without attention deficit hyperactivity disorder.<br><br>METHOD: This was an analytic and descriptive study. Participants were 33 children aged 7-12 years selected from a child and adolescent psychiatric clinic at Imam Hossein hospital (Tehran, Iran), who were diagnosed with ADHD by a child and adolescent psychiatrist. They met the DSM-IV diagnostic criteria for ADHD and had no comorbidity according to K-SADS (Kiddi-Scadule for Affective disorders and Schizophrenia). They were requested not to take any medication. They took the Figural TTCT (Torrance Test of Creativity Thinking) and Raven Intelligence test after using medication. Thirty-three age and sex-matched children selected from the regional schools were recruited for the control group. They did not have any psychiatric disorders according to K-SADS. The Figural TTCT and Raven Intelligence test were conducted for the controls as well.<br><br>RESULTS: No statistically significant difference was found in the intelligence score and the mean±SD of the total score of creativity between children with ADHD (125.2 ± 42.6) and the control group (130.6 ± 47.5) (P value = 0.49). Children with ADHD had worse function in fluency and flexibility items and were not different in originality and elaboration items.<br><br>CONCLUSION: The creativity of children with ADHD is not different from that of the control group.}, }
@article {pmid27432044, year = {2016}, author = {deShazo, RD and Minor, WF and Smith, R and Skipworth, LB}, title = {An Unwilling Partnership With the Great Society Part I: Head Start and the Beginning of Change in the White Medical Community.}, journal = {The American journal of the medical sciences}, volume = {352}, number = {1}, pages = {109-119}, doi = {10.1016/j.amjms.2016.04.003}, pmid = {27432044}, issn = {1538-2990}, mesh = {African Americans/history ; Civil Rights/*history ; European Continental Ancestry Group/history ; Healthcare Disparities/*history ; History, 20th Century ; Humans ; Mississippi ; Politics ; }, abstract = {By 1965, the policies and programs of Lyndon B. Johnson's Great Society brought optimism to black physicians and a new wave of resistance against black civil rights advocates in the American South. The largest of the first Head Start programs, Child Development Group of Mississippi (CDGM), had its roots in Freedom Summer 1964 and the Medical Committee for Human Rights. Like other proposed programs with strong medical components, CDGM was caught in a legislative Bermuda triangle created by the powerful Mississippi congressional delegation to maintain white supremacy and plantation economics. Physician-led investigations exposed the extraordinary level of poor health among Mississippi's black children, supported Head Start as a remedy, and awakened the white medical establishment to health disparities of the Jim Crow period. It was also the beginning of positive change in the previously silent white medical community in the South and their support of civil justice in health.}, }
@article {pmid27429456, year = {2016}, author = {Greggor, AL and Clayton, NS and Fulford, AJ and Thornton, A}, title = {Street smart: faster approach towards litter in urban areas by highly neophobic corvids and less fearful birds.}, journal = {Animal behaviour}, volume = {117}, number = {}, pages = {123-133}, doi = {10.1016/j.anbehav.2016.03.029}, pmid = {27429456}, issn = {0003-3472}, abstract = {The extent to which animals respond fearfully to novel stimuli may critically influence their ability to survive alongside humans. However, it is unclear whether the fear of novel objects, object neophobia, consistently varies in response to human disturbance. Where variation has been documented, it is unclear whether this variation is due to a change in fear towards specific novel stimuli, or whether it is symptomatic of a general change in fear behaviour. We measured levels of object neophobia in free-flying birds across urban and rural habitats, comparing corvids, a family known for being behaviourally flexible and innovative, with other urban-adapting bird species. Neophobic responses were measured in the presence of different types of objects that varied in their novelty, and were compared to behaviour during a baited control. Corvids were more neophobic than noncorvid species towards all object types, but their hesitancy abated after conspecifics approached in experimental conditions in which objects resembled items they may have experienced previously. Both sets of species were faster to approach objects made from human litter in urban than rural areas, potentially reflecting a category-specific reduction in fear based on experience. These results highlight species similarities in behavioural responses to human-dominated environments despite large differences in baseline neophobia.}, }
@article {pmid27421709, year = {2016}, author = {Hamilton, TJ and Myggland, A and Duperreault, E and May, Z and Gallup, J and Powell, RA and Schalomon, M and Digweed, SM}, title = {Episodic-like memory in zebrafish.}, journal = {Animal cognition}, volume = {19}, number = {6}, pages = {1071-1079}, doi = {10.1007/s10071-016-1014-1}, pmid = {27421709}, issn = {1435-9456}, mesh = {Animals ; *Memory ; Mental Recall ; *Zebrafish ; }, abstract = {Episodic-like memory tests often aid in determining an animal's ability to recall the what, where, and which (context) of an event. To date, this type of memory has been demonstrated in humans, wild chacma baboons, corvids (Scrub jays), humming birds, mice, rats, Yucatan minipigs, and cuttlefish. The potential for this type of memory in zebrafish remains unexplored even though they are quickly becoming an essential model organism for the study of a variety of human cognitive and mental disorders. Here we explore the episodic-like capabilities of zebrafish (Danio rerio) in a previously established mammalian memory paradigm. We demonstrate that when zebrafish were presented with a familiar object in a familiar context but a novel location within that context, they spend more time in the novel quadrant. Thus, zebrafish display episodic-like memory as they remember what object they saw, where they saw it (quadrant location), and on which occasion (yellow or blue walls) it was presented.}, }
@article {pmid27421643, year = {2016}, author = {Remmers, T and Van Kann, D and Thijs, C and de Vries, S and Kremers, S}, title = {Playability of school-environments and after-school physical activity among 8-11 year-old children: specificity of time and place.}, journal = {The international journal of behavioral nutrition and physical activity}, volume = {13}, number = {}, pages = {82}, doi = {10.1186/s12966-016-0407-5}, pmid = {27421643}, issn = {1479-5868}, mesh = {Child ; *Environment Design ; *Exercise ; Female ; Humans ; Male ; *Play and Playthings ; *Schools ; Sports ; }, abstract = {BACKGROUND: Physical Activity (PA) occurs in several behavioral domains (e.g., sports, active transport), and is affected by distinct environmental factors. By filtering objective PA using children's school schedules, daily PA can be separated into more conceptually meaningful domains. We used an ecological design to investigate associations between &quot;playability&quot; of 21 school-environments and children's objectively measured after-school PA. We also examined to what extent distinct time-periods after-school and the distance from children's residence to their school influenced this association.<br><br>METHODS: PA was measured in 587 8-11 year-old children by accelerometers, and separated in four two-hour time-periods after-school. For each school-environment, standardized playability-scores were calculated based on standardized audits within 800 m network buffers around each school. Schools and children's residences were geocoded, and we classified each child to be residing in 400, 800, 1600, or >1600 m crow-fly buffers from their school. The influence of network-distance buffers was also examined using the same approach.<br><br>RESULTS: Playability was associated with light PA and moderate-to-vigorous PA after-school, especially in the time-period directly after-school and among children who lived within 800 m from their school. Playability explained approximately 30% of the after-school PA variance between schools. Greater distance from children's residence to their school weakened the association between playability of the school-environments and after-school PA.<br><br>CONCLUSIONS: This study demonstrated that relationships between the conceptually matched physical environment and PA can be revealed and made plausible with increasing specificity in time and distance.}, }
@article {pmid27419017, year = {2016}, author = {McCracken, DS and Allen, DA and Gow, AJ}, title = {Associations between urban greenspace and health-related quality of life in children.}, journal = {Preventive medicine reports}, volume = {3}, number = {}, pages = {211-221}, doi = {10.1016/j.pmedr.2016.01.013}, pmid = {27419017}, issn = {2211-3355}, support = {T32 GM007337/GM/NIGMS NIH HHS/United States ; }, abstract = {With research to suggest that urban greenspace use can affect the health and wellbeing of adults, it is important to investigate this association in children. Compared with factors such as physical activity, research considering greenspace and its association with the health and wellbeing of children from urban areas is relatively rare. This study examined the health-related quality of life of 276 children residing in the city of Edinburgh in relation to quantity and use of greenspace. As much of the existing research has employed parental reports of children's health, the current study assessed health-related quality of life via self-report, measured using the Kid-KINDL questionnaire (Ravens-Sieberer &amp; Bullinger, 1998). Spatial analysis of greenspace quantity and typology was undertaken using mapping software, ArcGIS (Esri, 2011). In regression analysis, higher greenspace use and having fewer siblings were significantly associated with better health-related quality of life. Further analysis revealed that these variables were also associated with the 'friends' sub-scale score of the Kid-KINDL. Higher greenspace use was positively associated with 'self-esteem' sub-scale scores. However, the quantity of residential greenspace was not associated with the health-related quality of life of children. This study suggests that increased use of greenspace in urban areas might have a small but positive impact on child health-related quality of life, though future longitudinal and intervention studies are required to confirm these causal assumptions.}, }
@article {pmid27406172, year = {2017}, author = {Szabo, B and Bugnyar, T and Auersperg, AM}, title = {Within-group relationships and lack of social enhancement during object manipulation in captive Goffin's cockatoos (Cacatua goffiniana).}, journal = {Learning &amp; behavior}, volume = {45}, number = {1}, pages = {7-19}, doi = {10.3758/s13420-016-0235-0}, pmid = {27406172}, issn = {1543-4508}, mesh = {Animals ; *Choice Behavior ; *Cockatoos ; Crows ; *Learning ; Parrots ; Social Behavior ; }, abstract = {Different types of social relationships can influence individual learning strategies in structured groups of animals. Studies on a number of avian species have suggested that local and/or stimulus enhancement are important ingredients of the respective species' exploration modes. Our aim was to identify the role of enhancement during object manipulation in different social contexts. We used focal observations to identify a linear dominance hierarchy as well as affiliative relationships between individuals in a group of 14 Goffin's cockatoos (Cacatua goffiniana, formerly goffini). Thereafter, in an unrewarded object choice task, several pairs of subjects were tested for a possible influence of social enhancement (local vs. stimulus) in three conditions: dominance, affiliation, and kinship. Our results suggest strong individual biases. Whereas previous studies on ravens and kea had indicated that enhancement in a non-food-related task was influenced by the social relationship between a demonstrator and an observer (affiliated - nonaffiliated), we found no such effects in our study group. In this context, Goffin's cockatoos' object learning seems to take place more on an individual level, despite their generally high motivation to manipulate nonfood items.}, }
@article {pmid27404915, year = {2016}, author = {Inger, R and Per, E and Cox, DT and Gaston, KJ}, title = {Key role in ecosystem functioning of scavengers reliant on a single common species.}, journal = {Scientific reports}, volume = {6}, number = {}, pages = {29641}, doi = {10.1038/srep29641}, pmid = {27404915}, issn = {2045-2322}, abstract = {The importance of species richness in maintaining ecosystem function in the field remains unclear. Recent studies however have suggested that in some systems functionality is maintained by a few abundant species. Here we determine this relationship by quantifying the species responsible for a key ecosystem role, carcass removal by scavengers. We find that, unlike those within largely unaltered environments, the scavenger community within our highly altered system is dominated by a single species, the Carrion crow, despite the presence of a number of other scavenging species. Furthermore, we find no relationship between abundance of crows and carcass removal. However, the overall activity of crows predicts carcass biomass removal rate in an asymptotic manner, suggesting that a relatively low level of abundance and scavenging activity is required to maintain this component of ecosystem function.}, }
@article {pmid27384024, year = {2016}, author = {Dove, WF}, title = {Weaving a Tapestry from Threads Spun by Geneticists: The Series Perspectives on Genetics, 1987-2008.}, journal = {Genetics}, volume = {203}, number = {3}, pages = {1011-1022}, doi = {10.1534/genetics.116.191155}, pmid = {27384024}, issn = {1943-2631}, mesh = {Genetics/*history ; History, 20th Century ; Humans ; *Peer Review, Research ; United States ; }, abstract = {The Perspectives column was initiated in 1987 when Jan Drake, Editor-in-Chief of GENETICS, invited Jim Crow and William Dove to serve as coeditors of &quot;Anecdotal, Historical, and Critical Commentaries.&quot; As the series evolved over 21 years, under the guidance of Crow and Dove, the input of stories told by geneticists from many countries created a panorama of 20th-century genetics. Three recurrent themes are visible: how geneticists have created the science (as solitary investigators, in pairs, or in cooperative groups); how geneticists work hard, but find ways to have fun; and how public and private institutions have sustained the science of genetics, particularly in the United States. This article ends by considering how the Perspectives series and other communication formats can carry forward the core science of genetics from the 20th into the 21st century.}, }
@article {pmid27378720, year = {2016}, author = {Thompson-Miller, R and Picca, LH}, title = {&quot;There Were Rapes!&quot;: Sexual Assaults of African American Women and Children in Jim Crow.}, journal = {Violence against women}, volume = {}, number = {}, pages = {}, doi = {10.1177/1077801216654016}, pmid = {27378720}, issn = {1552-8448}, abstract = {Using data from 92 interviews, this article examines the narratives of African Americans' experiences as children and young adults during Jim Crow in the Southeast and Southwest. It gives voice to the realities of sexual assaults committed by ordinary White men who systematically terrorized African American families with impunity after the post-Reconstruction south until the 1960s. The interviewees discuss the short- and long-term impact of physical, mental, emotional, and sexual assaults in their communities. We discuss the top four prevalent themes that emerged related to sexual assault, specifically (a) the normalization of sexual assaults, (b) protective measures to avoid White violence, (c) the morality of African American women, and (d) the long-term consequences of assaults on children.}, }
@article {pmid27376186, year = {2016}, author = {Frömer, R and Stürmer, B and Sommer, W}, title = {Come to think of it: Contributions of reasoning abilities and training schedule to skill acquisition in a virtual throwing task.}, journal = {Acta psychologica}, volume = {170}, number = {}, pages = {58-65}, doi = {10.1016/j.actpsy.2016.06.010}, pmid = {27376186}, issn = {1873-6297}, mesh = {Adult ; Female ; Humans ; Individuality ; Learning/*physiology ; Male ; Motor Skills/*physiology ; Physical Education and Training/methods ; Psychomotor Performance/*physiology ; Retention (Psychology) ; Thinking/*physiology ; Transfer (Psychology) ; Young Adult ; }, abstract = {According to Schmidt's schema theory skill acquisition is based on schema formation where multiple learning incidents with varying task features are abstracted to a unifying pattern, the schema. Practice can be scheduled block-wise, with low contextual interference (CI) or randomly, with high CI. The greater effort during high CI training usually results in reduced training success but enhanced retention and transfer performance. In contrast to well-established CI effects for simple tasks, findings for complex tasks are heterogeneous, supposedly due to the detrimental accumulation of task demands. We assumed that in complex tasks, cognitive reasoning abilities might impose a limit upon schema formation and hence the effectiveness of CI. In a virtual overarm-throwing experiment participants practiced target positions at center, left, or right and were retested for retention - at the center position - and transfer with a larger target distance. Although there was no main effect of CI on performance, either in training, retention or transfer, under high CI, training performance was better for participants with higher reasoning ability, as measured with the Raven matrices. This advantage persisted across retention and transfer. Under low CI, reasoning was positively related to performance improvement only in the last third of training. We argue, that variability of practice is a necessary prerequisite for beneficial effects of reasoning abilities. Based on previous findings, we discuss feedback evaluation as a possible locus of the relationship between reasoning and performance in motor skill acquisition.}, }
@article {pmid27359074, year = {2016}, author = {Miller, R and Schwab, C and Bugnyar, T}, title = {Explorative innovators and flexible use of social information in common ravens (Corvus corax) and carrion crows (Corvus corone).}, journal = {Journal of comparative psychology (Washington, D.C. : 1983)}, volume = {130}, number = {4}, pages = {328-340}, doi = {10.1037/com0000039}, pmid = {27359074}, issn = {1939-2087}, mesh = {Animals ; Behavior, Animal/*physiology ; Choice Behavior ; *Crows ; Exploratory Behavior/*physiology ; Humans ; *Problem Solving ; *Social Behavior ; Species Specificity ; }, abstract = {Innovation and social information use are influenced by individual characteristics, and are important for the creation and transmission of novel behavioral patterns. Here, we investigated which individual factors predict innovation rates and social transmission of information in a comparative study with identically reared common ravens (Corvus corax) and carrion crows (Corvus corone corone; Corvus corone cornix). In the innovation experiment (1), we presented the birds with a novel problem-solving task while alone, to determine which individuals would quickly solve (&quot;innovators&quot;) or not solve (&quot;noninnovators&quot;) this task. We then related these findings to sex, object exploration (frequency of novel item manipulation), object neophobia (latency to novel item interaction), and social rank position. We found that innovators were more explorative than noninnovators, although they did not differ significantly in social rank, object neophobia or sex. In the social information use experiments (2 &amp; 3), subjects first observed a model (Exp. 2: conspecific, heterospecific; Exp. 3: conspecific innovator &amp; noninnovator) demonstrate a specific color selection in a 2-choice cup task, before being allowed to make their own cup selection. Innovator and noninnovator observers did not significantly differ in their tendency to use social information, that is, to select the demonstrated cup first, from a conspecific or heterospecific model. Furthermore, observers did not preferentially use social information from an innovator over a noninnovator model. We discuss our findings in relation to the likely benefits of flexible information use, and the role of other model characteristics, such as relationships, on the use of social information. (PsycINFO Database Record}, }
@article {pmid29232095, year = {2016}, author = {Asdell, J}, title = {Address to IDA House of Delegates IDA President Dr. Jay Asdell May 21, 2016.}, journal = {Journal (Indiana Dental Association)}, volume = {95}, number = {3}, pages = {32-34}, pmid = {29232095}, issn = {0019-6568}, mesh = {Congresses as Topic ; Dentistry/*trends ; Humans ; Indiana ; *Societies, Dental ; }, }
@article {pmid27349580, year = {2017}, author = {Halayem, S and Hammami, M and Fakhfakh, R and Gaddour, N and Tabbane, K and Amado, I and Krebs, MO and Bouden, A}, title = {[Adaptation and validation of the neurological soft sign's scale of Krebs et al. to children].}, journal = {L'Encephale}, volume = {43}, number = {2}, pages = {128-134}, doi = {10.1016/j.encep.2016.02.018}, pmid = {27349580}, issn = {0013-7006}, mesh = {Autistic Disorder/*diagnosis/physiopathology/psychology ; Calibration ; Child ; Child Development ; Female ; Humans ; Male ; Neurologic Examination/methods/*standards ; Psychiatric Status Rating Scales ; Psychology, Child/methods/*standards ; Psychology, Developmental/methods/standards ; Psychometrics/methods/*standards ; Reproducibility of Results ; Tunisia ; }, abstract = {BACKGROUND: Neurological soft signs (NSS) include anomalies in motor integration, coordination, sensory integration and lateralization and could be endophenotypic markers in autism spectrum disorders (ASD). Their characterization provides a more precise phenotype of ASD and more homogeneous subtypes to facilitate clinical and genetic research. Few scales for NSS have been adapted and validated in children including children with ASD. Our objective was to perform an adaptation to the child of a scale assessing neurological soft signs and a validation study in both general and clinical populations.<br><br>METHODS: We have selected the NSS scale of Krebs et al. (2000) already validated in adults. It encompasses 5 dimensions: motor coordination, motor integration, sensory integration, involuntary movement, laterality. After a preliminary study that examined 42 children, several changes have been made to the original version to adapt it to the child and to increase its feasibility, particularly in children with ASD. Then we conducted a validation study by assessing the psychometric properties of this scale in a population of 86 children including 26 children with ASD (DSM 5 Criteria) and 60 typically developing children. Children's ages ranged between 6 and 12 years, and patients and controls were matched for gender, age and intelligence. Patients were assessed using the Autism diagnostic Interview-revised and the Childhood Autism Rating Scale to confirm diagnosis. Typically developing children were assessed using the semi-structured Mini International Neuropsychiatric Interview for Children and Adolescents to eliminate any psychiatric disorder. All children with neurological pathologies (history of cerebral palsy, congenital anomaly of the central nervous system, epilepsy, tuberous sclerosis, neurofibromatosis, antecedent of severe head trauma) and obvious physical deformities or sensory deficits that could interfere with neurological assessment were excluded from the study. Both patients and controls were assessed using the Raven Progressive Matrices to exclude intellectual disability, and the adapted Krebs' scale for the assessment of NSS.<br><br>RESULTS: Adaptation of the scale consisted of a modification in the order of items, in the use of concrete supports for the assessment of laterality and in the elimination of item constructive praxis. The internal consistency was good with a Cronbach alpha of 0.87. Inter-rater reliability was good, kappa coefficient was greater than 0.75 for 16 items, 3 items had a kappa value between 0.74 and 0.60, only 1 item had a kappa coefficient